Demonstration of Direct Effects of Growth Hormone onNeonatal Cardiomyocytes*

Received for publication, December 22, 2000, and in revised form, March 30, 2001Published, JBC Papers in Press, April 12, 2001, DOI 10.1074/jbc.M011647200

Chunxia Lu, Gary Schwartzbauer, Mark A. Sperling, Sherin U. Devaskar‡,Shanthie Thamotharan‡, Paul D. Robbins§, Charles F. McTiernan¶, Jun-Li Liui,Jiang Jiang**, Stuart J. Frank**, and Ram K. Menon‡‡

From the Departments of Pediatrics, §Molecular Genetics and Biochemistry, and ¶Cardiology, University of PittsburghSchool of Medicine, Pittsburgh, Pennsylvania 15213, the ‡Department of Pediatrics, UCLA School of Medicine,Los Angeles, California 90095, the **Department of Medicine, University of Alabama at Birmingham and BirminghamVeterans Affairs Medical Center, Birmingham, Alabama 35294, and the iDepartment of Medicine, McGill University,Montreal, Quebec, H3A-1A1, Canada

The cellular and molecular basis of growth hormone(GH) actions on the heart remain poorly defined, and itis unclear whether GH effects on the myocardium aredirect or mediated at least in part via insulin-likegrowth factor (IGF-1). Here, we demonstrate that thecultured neonatal cardiomyocyte is not an appropriatemodel to study the effects of GH because of artifactualloss of GH receptors (GHRs). To circumvent this prob-lem, rat neonatal cardiomyocytes were infected with arecombinant adenovirus expressing the murine GHR.Functional integrity of GHR was suggested by GH-in-duced activation of the cognate JAK2/STAT5, MAPK,and Akt intracellular pathways in the cells expressingGHR. Although exposure to GH resulted in a significantincrease in the size of the cardiomyocyte and increasedexpression of c-fos, myosin light chain 2, and skeletala-actin mRNAs, there were no significant changes inIGF-1 or atrial natriuretic factor mRNA levels in re-sponse to GH stimulation. In this model, GH increasedincorporation of leucine, uptake of palmitic acid, andabundance of fatty acid transport protein mRNA. In con-trast, GH decreased uptake of 2-deoxy-D-glucose and lev-els of Glut1 protein. Thus, in isolated rat neonatal car-diomyocytes expressing GHR, GH induces hypertrophyand causes alterations in cellular metabolic profile inthe absence of demonstrable changes in IGF-1 mRNA,suggesting that these effects may be independent ofIGF-1.

Several observations implicate a role for growth hormone(GH)1 in modulation of cardiac structure and function (1). Pa-tients with excess endogenous GH (i.e. acromegaly) suffer from

cardiac complications including biventricular hypertrophy, im-paired diastolic filling, and decreased cardiac performance oneffort due to diastolic and systolic dysfunction (2). Patientswith chronic GH deficiency also show cardiac abnormalities; ingeneral, the data support the presence of a hypokinetic cardiacsyndrome in patients with GH deficiency that can be reversedwith GH replacement therapy (3–5). Fazio et al. (6) reportedthat GH therapy in patients with idiopathic dilated cardiomy-opathy was associated with significant improvement in leftventricular ejection fraction, isovolumic relaxation time, andefficiency of myocardial energy utilization. Subsequent to theselandmark findings, some studies have supported a beneficialeffect of exogenous GH on cardiac function (7), whereas otherinvestigators were unable to demonstrate salutary effects ofGH on cardiac function in patients with heart failure (8).

A particularly well studied animal model is that of the trans-planted GH-secreting pituitary tumor cell line, GH3. In thismodel of GH excess, there is increased myocardial contractilityand calcium sensitivity of myocardial contractile proteins (1).Similarly, normal rats given recombinant GH show an increasein left ventricular mass, as well as an increase in severalaspects of cardiac performance (9). In the rodent model ofmyocardial infarction, administration of GH results in im-provements in myocardial contractility, left ventricular end-systolic and end-diastolic pressures, and cardiac index with noincrease in the size of the infarct (10–13). In general, animalmodels of GH deficiency also support a role for GH in themaintenance of cardiac structure and function. Thus, geneti-cally GH-deficient dwarf mice show cardiac abnormalities thatcan be reversed following GH therapy (14). However, hypoph-ysectomized rats given GH show little improvement in ventric-ular function, indicating that GH may cooperate with otherfactors (e.g. thyroid hormone) in its effects on the heart (15).

In the intact animal, GH increases the circulating levels ofIGF-1 by stimulating the production of IGF-1 (16). IGF-1 itselfinduces hypertrophy and alters gene expression in isolatedcardiomyocytes and increases myocardial contractility (17, 18).IGF-1 may also serve to inhibit cardiomyocytes from undergo-ing apoptosis following infarction (19). However, to date, stud-ies have not been able to demonstrate direct effects of GH onisolated cardiomyocytes. Thus, Ito et al. (20) reported that,whereas IGF-1 was able to induce hypertrophy with concomi-tant increase in expression of muscle-specific genes in isolatedrat neonatal cardiomyocytes, GH did not have an observable

* This work was supported by National Institutes of Health GrantsDK49845 (to R. K. M.), HD25024 and 33997 (to S. U. D.), DK46395 (toS. J. F.), and T32DK07729, the Children’s Hospital of Pittsburgh, theVira I. Heinz Foundation, and American Heart Association Grant9951280U (to R. K. M.). The costs of publication of this article weredefrayed in part by the payment of page charges. This article musttherefore be hereby marked “advertisement” in accordance with 18U.S.C. Section 1734 solely to indicate this fact.

‡‡ To whom correspondence should be addressed: Division of Endo-crinology, Department of Pediatrics, Children’s Hospital of Pittsburgh,3705 Fifth Ave., Pittsburgh, PA 15213. Tel.: 412-692-5806; Fax: 412-692-6449; E-mail: menonr@chplink.chp.edu.

1 The abbreviations used are: GH, growth hormone; IGF-1, insulin-like growth factor; GHR, GH receptor; DMEM, Dulbecco’s modifiedEagle’s medium; rGH, rat GH; PCR, polymerase chain reaction; RT-PCR, reverse transcription-PCR; MAPK, mitogen-activated protein;ERK, extracellular signal-regulated kinase; STAT, signal transducers

and activators of transcription; PBS, phosphate-buffered saline;ANOVA, analysis of variance; FATP, fatty acid transport protein.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 276, No. 25, Issue of June 22, pp. 22892–22900, 2001Printed in U.S.A.

This paper is available on line at http://www.jbc.org22892

by guest on August 31, 2016

http://ww

w.jbc.org/

Dow

nloaded from

effect in this model. Similarly, Donath et al. (17) reported thatin cardiomyocytes from adult rats IGF-1, but not GH, enhancesmyofibril development and down-regulates smooth muscle-aactin. In support of a direct (i.e. not secondary to stimulation ofcirculating IGF-1) effect of GH on cardiac function is the dem-onstration that ex vivo perfusion of the isolated rat heart withGH results in enhanced protein synthesis (21).

At present, it is not known if GH, acting through its cognatereceptor (growth hormone receptor (GHR)), has direct effectson the heart or if some or all of the observed cardiovasculareffects of GH administration are secondary to an increase incirculating levels of IGF-1 and/or hemodynamic changes invascular tone and blood pressure (22). Recently, Lupu et al. (23)reported that in a knockout model of GHR deficiency charac-terized by severe growth retardation, the weight of the heart inthe adult animal, although decreased in absolute terms, wassimilar to controls when expressed relative to total bodyweight. Moreover, relative levels of IGF-1 transcripts in theheart also were unaffected. Thus, in this model of GHR defi-ciency, myocardial growth and IGF-1 expression are implicitlyindependent of the GH/GHR axis. However, the studies of Lupuet al. (23) do not preclude a role for GH/GHR in normal growthand development of the neonatal heart, including adaptivemyocardial metabolism, characterized by a transition from vir-tually exclusive utilization of glucose and lactate in the fetus tofatty acids in the mature animal (24).

A major impediment to investigating the role of GH/GHR inthe heart is the lack of a suitable in vitro tissue culture model.We have developed such a model by exploiting the strategy ofrecombinant adenovirus-mediated overexpression of GHR inneonatal rat cardiomyocytes. Using this model, we demon-strate that GH stimulates hypertrophy of the isolated cardiom-yocyte, and these actions of GH seem to be largely independentof changes in IGF-1 gene expression, findings that support animportant independent role for the GH/GHR axis in normalcardiac growth. In addition, GH alters the metabolic profile ofrat neonatal cardiomyocytes by inhibiting glucose uptake,stimulating fatty acid uptake, and increasing protein synthe-sis, changes that facilitate both postnatal cardiac growth andmaturation of myocardial metabolism.

EXPERIMENTAL PROCEDURES

Isolation of Cardiomyocytes—Neonatal ventricular myocytes wereprepared from hearts of 1–3-day-old Harlan Sprague-Dawley rats usinga previously described protocol (25, 26). Briefly, hearts were removedand transferred to a 100-mm dish containing heparin solution (13Hanks’ balanced saline solution, 0.8 mM MgSO4, 20 mM HEPES, and 10units of heparin). After dissecting hearts into two pieces with a razorblade, the tissue was washed once with the heparin solution and incu-bated with gentle rocking in a solution containing 13 Hanks’ balancedsaline solution, 0.8 mM MgSO4, 20 mM HEPES, 2 mg/ml DNase, and 2mg/ml trypsin. Tissue was pipetted three times every 20-min with a10-ml-wide mouth pipette, and the supernatant was discarded at eachtime. Cardiomyocytes were recovered afterward by alternating rockingand pipetting of tissue every 5 min and pooled into a 50-ml tubecontaining 7 ml of fetal bovine serum. Cells were centrifuged at 1000rpm for 5 min and washed once with cold DMEM containing 5% fetalbovine serum. Fibroblasts were removed by plating (100-mm dishes)cells at 37 °C for 30 min in DMEM containing 5% fetal bovine serum.Cardiomyocytes were recovered by collecting the nonadherent cells andcultured in DMEM/F-12 medium containing 5% charcoal-stripped calfserum (Sigma), 10 mM HEPES, insulin-transferrin sodium selenite (5mg/ml insulin, 5 mg/ml transferrin, and 5 ng/ml selinium selenite, re-spectively), 10 mM glutamine, 30 mg/ml bromodeoxyuridine, and 10mg/ml gentamicin. Cells were plated on Pronectin (BIOSOURCE)-coated tissue culture plates at a density of 1 3 105 cells/cm2 and grownat 37 °C in 5% CO2. As assessed by staining with antisarcomeric anti-body (MF20; Developmental Studies Hybridoma Bank, University ofIowa), these cell preparations typically contain greater than 95% car-diomyocytes, form a nearly confluent monolayer by the second day afterplating, and beat spontaneously and synchronously. After 24 or 48 h of

incubation, cells were washed with serum-free DMEM/F-12 culturemedium and infected with recombinant adenovirus expressing eitherthe murine GHR (GHRAdlox) or the b-galactosidase (b-galAdlox) gene.

Engineering and Production of Recombinant Adenoviral Vectors—The second generation shuttle vector pADLOX was modified to containeither the b-galactosidase (b-galAdlox) or the murine GHR cDNA(GHRAdlox). The in vitro coupled transcription-translation technique(Promega) was used to confirm that the plasmids coded for proteins ofappropriate molecular weight (data not shown). The production of thereplication-deficient adenoviral vectors expressing either the b-galacto-sidase or GHR cDNA was achieved by a protocol based on the Cre-loxprinciple for efficient and relatively quick identification of recombinantviral particles (27). The adenovirus was plaque-purified, and a cesiumchloride preparation was used for the experiments.

Scatchard Analysis—The number of cell surface receptors was de-termined by competition binding using 125I-labeled human GH. 1 3 106

aliquots of neonatal cardiomyocytes (uninfected and infected at MOI of12.5 plaque-forming units/cell for 48 h) were washed with bindingbuffer (25 mM HEPES (pH 7.4), 125 mM NaCl, 4 mM KCl, 1 mM CaCl2,1.5 mM MgCl2, 2 mM KH2PO4, and 1% human serum albumin), incu-bated with 50,000 cpm 125I-human GH (PerkinElmer Life Sciences) andvarious concentrations of unlabeled GH for 90 min in binding bufferbefore centrifugation through 100 ml of dibutyl phthalate. Specific bind-ing was determined by subtracting the amount of 125I-human GH boundin the presence of excess unlabeled rGH (National Hormone and Pitu-itary Program, National Institutes of Health), and the binding charac-teristics were analyzed using a computer program (GraphPad).

Immunofluorescence and Planimetry—After 24 h of adenoviral infec-tion, cells were rinsed with phosphate-buffered saline, fixed in 4%paraformaldehyde, and permeabilized with 0.1% Triton X-100. Follow-ing three phosphate-buffered saline washes, the chamber slides wereincubated in 0.1% bovine serum albumin for 30 min to block nonspecificsites. Subsequently, the cells were covered with either anti-GHR anti-body (GHR-2; specific for the cytoplasmic region of the GHR moleculeand does not cross-react with GH-binding protein (28)) or antisarcom-eric myosin antibody (MF-20). Following incubation for 1 h in the darkwith the primary antibody, the cells were washed four times withphosphate-buffered saline prior to exposure to Texas Red-conjugatedsecondary antibodies. A Zeiss Axiovert 135 microscope equipped with avideo camera system was used to capture images and to determine cellsize, estimated by measuring the area to which individual MF-20-positive cells attached. 20–45 randomly selected cells from each group(b-galAdlox- or GHRAdlox-infected, with and without exposure to rGH)were chosen for such analysis, which was conducted by an operatorblinded to the identity of the cells being examined. The data gatheredwere analyzed using ImagePro software.

Isolation of RNA—GHRAdlox- or b-galAdlox-infected cells were in-cubated with or without rGH for certain time periods. Cells werewashed once with ice-cold phosphate-buffered saline, and total RNAwas prepared by the Tri-Reagent method and quantitated by absorb-ance at 260 nm. The integrity of the RNA and the accuracy of thespectrophotometric determinations were confirmed by visual inspectionof the ethidium bromide-stained 28 and 18 S ribosomal RNA bandsafter agarose-formaldehyde gel electrophoresis.

Ribonuclease Protection Assay for IGF-1—IGF-I gene expression wasstudied by RNase protection assay as previously reported (29, 30).Briefly, 10–50-mg aliquots of total RNA were hybridized to 32P-labeledriboprobes generated from templates containing exon 4 of the rat IGF-Igene (a 376-base pair Sau3AI–EcoRI fragment) or 18 S rRNA (Ambion).Protected probes were denatured, electrophoresed on an 8% polyacryl-amide gel, and exposed to X-Omat AR film for 1–2 days. The protectedbands corresponding to IGF-I mRNA and 18 S rRNA were scannedusing an Agfa Arcus II scanner, and densitometric analysis was per-formed using the MacBAS version 2.31 computer program (Fuji PhotoFilm Co., Tokyo, Japan). The level of IGF-I mRNA was normalized forthe amount of 18 S rRNA and analyzed as relative abundance tountreated control samples.

Real Time Semiquantitative RT-PCR Assay—Real-time quantitativeRT-PCR using the ABI Prism 7700 Sequence Detection System (PEBiosystems, Foster City, CA) was carried out using established proto-cols (31–35). The primers (synthesized by Life Technologies, Inc.) andTaqMan probes (synthesized by Applied Biosystems) for the quantita-tion of the GHR, IGF-1, fatty acid transport protein (FATP), c-fos, andANF transcripts were designed using the primer design softwarePrimer Express (Applied Biosystems) (Table I). The primers and Taq-Man probe for 18 S rRNA were purchased from a commercial vendor(PerkinElmer Life Sciences). The 18 S probe was labeled with reporterfluorescent dyes VIC and the GHR, IGF-1, FATP, c-fos, and ANF probes

Cardiac Effects of Growth Hormone 22893

by guest on August 31, 2016

http://ww

w.jbc.org/

Dow

nloaded from

with 6-carboxyfluorescein. The relative efficiencies of the GHR andIGF-1 primers/probe sets and the 18 S primer/probe pair were tested bysubjecting serial dilutions of a single RNA sample from each of thetissues analyzed to real time RT-PCR analysis. The plot of log inputversus DCT was ,0.1, which satisfies the previously established crite-rion for equivalence of efficiency of amplification (34). CT, or thresholdcycle, represents the PCR cycle at which an increase in reporter fluo-rescence above a base-line signal can first be detected, and DCT refers tothe difference between the threshold cycles for the target and thereference. After confirming that the efficiencies of amplification of thegene of interest (e.g. GHR) and 18 S transcripts were approximatelyequal, the amount of the transcripts for the specific gene relative to the18 S transcript was determined by using the comparative CT (separatetube) method (34). The comparative CT method is similar to the con-ventional standard curve method, except it uses arithmetic formulas toachieve the same result for relative quantitation. The amount of target,normalized to an endogenous reference and relative to a calibrator isgiven by the following formula: -fold induction 5 2DDCT, where DDCT 5(CT GI (unknown sample) 2 CT 18 S (unknown sample)) 2 (CT GI (adultheart) 2 CT 18 S (adult heart)); GI represents the gene of interest (e.g.GHR). Briefly, 2-ng aliquots of total RNA were analyzed using theOne-Tube RT-PCR protocol (Applied Biosystems). Following reversetranscription at 48 °C for 30 min, the samples were subjected to PCRanalysis using the following cycling parameters: 95 °C for 10 min; 95 °Cfor 15 s 3 60 °C for 1 min for 40 cycles. Each sample was analyzed intriplicate in individual assays performed on two or more occasions.

Western Blot Analysis—For biochemical activation experiments, se-rum-starved cardiomyocytes were treated with rGH (500–1250 ng/ml)or vehicle for the indicated duration. The pelleted cells were solubilizedfor 15 min at 4 °C in fusion lysis buffer (1% (v/v) Triton X-100, 150 mM

NaCl, 10% (v/v) glycerol, 50 mM Tris-HCl (pH 8.0), 100 mM NaF, 2 mM

EDTA, 1 mM phenylmethylsulfonyl fluoride, 1 mM sodium orthovana-date, 10 mM benzamidine, 10 mg/ml aprotinin), as indicated. Aftercentrifugation at 15,000 3 g for 15 min at 4 °C, 10–15-mg aliquots of thedetergent extracts were resolved under reduced conditions by SDS-polyacrylamide gel electrophoresis. Western transfer of proteins andblocking of Hybond-ECL membranes (Amersham Pharmacia Biotech)with 2% bovine serum albumin were performed as previously described(36–39). Equality of loading and efficiency of transfer were assessed byPonceau staining of the nitrocellulose filters. Membranes were immu-noblotted with the indicated dilutions of antibodies against total MAPK(1 mg/ml), phospho-MAPK (1:20,000), phosphotyrosine-STAT5 (1:5000),phospho-Akt (1:1000), anti-JAK2 (1:1000), anti-GHR (1:1000), anti-Glut1 (1:2500), anti-Glut4 (1:2500), or anti-b-actin (1:500). Detection byECL detection reagents (Amersham Pharmacia Biotech) and strippingand reprobing of blots were accomplished according to the manufactur-er’s suggestions.

Antibodies—Anti-GHR used for immunostaining was a gift of Dr. F.Talamantes (28). Antisarcomeric myosin antibody (MF-20) was ob-tained from the Developmental Studies Hybridoma Bank (University of

Iowa). Antibodies against Glut1 and Glut4 have been described previ-ously (39), and anti-actin antibody was purchased from Sigma. Anti-phosphotyrosine monoclonal antibody (4G10) and anti-MAPK affinity-purified rabbit antibody (directed at residues 333–367 of rat ERK1;recognizes both ERK1 and ERK2) were purchased from Upstate Bio-technology, Inc. (Lake Placid, NY). Anti-activated (anti-phospho-)MAPK affinity-purified rabbit antibody (recognizing the dually phos-phorylated Thr183 and Tyr185 residues that correspond to the activeforms of ERK1 and ERK2) was purchased from Promega (Madison, WI).Anti-phospho-Akt (specifically recognizing Akt phosphorylated atSer473) affinity-purified rabbit antibodies were purchased from NewEngland Biolabs (Beverly, MA). Rabbit anti-phosphotyrosine-STAT5polyclonal antibody (raised against a phosphopeptide surroundingphosphorylated Tyr694 of murine STAT5A, which is conserved in bothSTAT5A and STAT5B) was obtained from Zymed Laboratories Inc.(San Francisco, CA). The rabbit polyclonal serum, anti-JAK2AL33 (re-ferred to herein as anti-JAK2), has been described previously (40).

Anti-GHRcyt-AL47 (referred to as anti-GHR in immunoblotting exper-iments) is a new antibody developed in the Frank laboratory. Thisrabbit serum was raised against a bacterially expressed N-terminallyHis-tagged fusion protein incorporating the entire cytoplasmic domainof the human GHR (residues 271–620) (41). The cDNA encoding thisfusion was created by PCR in the pET vector system (Novagen) (PCRprimer sequences available upon request). Molecular biology tech-niques, cDNA sequencing for verification of fidelity, bacterial fusionprotein expression, and preparation of Ni21-agarose-purified fusionprotein were performed according to our previous methods (36, 37, 40,42) and the manufacturer’s suggestions.

Quantification of Glucose Transport—Glucose uptake was assayed at37 °C as 2-deoxy-D-glucose (2-G-3H-labeled) internalization. Briefly,cardiomyocytes exposed to either rGH (1250 ng/ml) or the vehicle wereincubated in DMEM (1 g/liter glucose) containing 1 mci/ml 2-deoxy-D-glucose (2-3H-G-labeled) (PerkinElmer Life Sciences). At specific timepoints, cultures were removed from the incubator, and cytochalasin B(250 mM final concentration) was added to halt further hexose uptake.The monolayer was then washed three times with ice-cold PBS, thewashed cardiomyocytes were solubilized by exposure to 0.5 N NaOH for10 min and neutralized with equal volume of 0.5 N HCl, and aliquotswere taken for measurement of 3H activity by scintillation counting andestimation of protein content by the Bradford assay. The glucose uptakewas calculated by subtracting nonspecific cell-associated radioactivitymeasured by including 250 mM cytochalasin B in a parallel series ofcultures during the incubation with 2-deoxy-D-glucose (2-3H-G-labeled).The basal level of glucose transport in cells transduced with recombi-nant adenovirus ranged between 2 and 8.1 nmol/mg of protein.

Incorporation of Leucine (L-3,4,5-3H-Labeled)—Infected or unin-fected cardiomyocytes were incubated in DMEM/F-12 medium contain-ing 12.5 mCi/ml L-[3,4,5-3H]leucine (PerkinElmer Life Sciences) with orwithout rGH (0.5–1250 ng/ml) for 24 h. At the end of incubation, cellswere washed two times with ice-cold PBS and incubated with 10%

TABLE ISequence of primer and probe sets for TaqMan RT-PCR assay

59-End reporter dyes were FAM (6-carboxylfluorescein) and VIC (proprietary; Applied Biosystems). The quencher fluorescent dye at the 39-endwas TAMRA (6-carboxytetramethylrhodamine) for all probes.

Gene/transcript Primer/probe Sequence

Rat GHR Forward CTACTTCTGTGAGTCAGATGCCAAAReverse TGGTGATGTAAATGTCCTCTTGGTTProbe (FAM) CGCTGCGGCCCCTCACATG

Rat IGF-1 Forward CCGGACCAGAGACCCTTTGReverse CCTGTGGGCTTGTTGAAGTAAAAProbe (FAM) AAGAGCGTCCACCAGCT

FATP Forward ATGGATGATCGGCTATTTACATCTReverse GTAGGCAGTCATAGAGCACATCGTProbe (FAM) CCTTCGGCCACCATT

Rat skeletal a-actin Forward TCAGGCGGTGCTGTCTCTCTReverse TCCCCAGAATCCAACACGATProbe (FAM) TGCCTCCGGCCGAACCACC

Rat heart myosin light chain 2 Forward TCAACGCCTTCAAGGTGTTTGReverse TCAGCATCTCCCGGACATAGTProbe (FAM) CCCCGAAGGCAAAGGGTCGC

Rat c-fos Forward GGGACAGCCTTTCCTACTACCATTReverse CGCAAAAGTCCTGTGTGTTGAProbe (FAM) CCAGCCGACTCCTTCTCCAGCATG

18 S Forward Proprietary (Applied Biosystems)Reverse Proprietary (Applied Biosystems)Probe (V1C) Proprietary (Applied Biosystems)

Cardiac Effects of Growth Hormone22894

by guest on August 31, 2016

http://ww

w.jbc.org/

Dow

nloaded from

trichloroacetic acid at 4 °C for 10 min. After washing with ice-coldethanol, the cells were solubilized in 0.5 N NaOH for 10 min and thenneutralized with an equal amount of 0.5 N HCl. The uptake of 3H wasdetermined by scintillation counting.

Palmitic Acid Uptake Assay—Palmitate uptake studies were per-formed in infected and uninfected cardiomyocytes that were treated oruntreated with rGH (0.5–1250 ng/ml) for 4 h. Albumin-bound palmitatewas prepared by dissolving unlabeled sodium palmitate (hexadecanoicacid; Sigma) and [9,10-3H]palmitic acid (American Radiolabeled Chem-icals) in 10 ml of water, to give a concentration of 320 mM (60 mCi/ml).Fatty acid-free bovine serum albumin was added to the above solutionto obtain a palmitate/PBS ratio of 4.0. This stock solution was diluted1:8 with PBS before adding to the cells, and the incubation was carriedout for 2 min. Palmitate uptake was terminated by adding cold PBScontaining 0.1% PBS and 200 mM phloretin. Cells were then washed fivetimes with cold PBS containing 0.1% bovine serum albumin, solubilizedwith 0.5 N NaOH, and then neutralized with 0.5 N HCl. Palmitateuptake was determined by scintillation counting.

Data Analysis—Data are presented as either mean 6 S.D. or mean 6S.E. as indicated. Statistical differences between groups were deter-mined by ANOVA. p values equal to or less than 0.05 were consideredsignificant.

The study protocol was approved by the Children’s Hospital of Pitts-burgh Animal Care and Use Committee, and the animals receivedhumane care in compliance with the National Research Council’s cri-teria as outlined in the Guide for the Care and Use of LaboratoryAnimals prepared by the National Institutes of Health.

RESULTS

Dysregulation of Expression of GHR during Isolation of Neo-natal Cardiomyocytes—Isolated cardiomyocytes from the neo-natal rat heart are a standard and accepted cell culture modelfor studying mammalian cardiac cell physiology that has beenused to examine the role of the GH/IGF-1 system in the heart(20). To ascertain if cultured cardiac cells are an appropriatemodel in which to study the effects of GH, qualitative RT-PCRwas performed using RNA isolated directly from rat heart orfrom cultured cardiomyocytes (Fig. 1A). Comparison of GHR

transcript levels in isolated neonatal cells (Fig. 1A, lane 9)versus that found in neonatal whole heart (Fig. 1A, lane 7)indicates that either during isolation and/or culture, GHRmRNA levels decrease significantly in isolated cardiomyocytes.To confirm these qualitative data, a quantitative analysis wasnext performed using a fluorescent 59-nuclease (TaqMan) as-say. These data confirmed that the expression of GHR mRNAwas decreased in isolated rat neonatal cardiomyocytes by ;70–80% compared with either the intact neonatal or the adultheart, respectively (Table II). Indirect immunofluorescence mi-croscopy revealed that most of the endogenous GHR in thecultured cardiomyocyte was perinuclear and not in the cellularmembranes, as seen in tissues, including the heart, in theintact animal (Fig. 1B) (43, 44). Thus, the dual findings of lowlevels of GHR mRNA and the aberrant localization of the GHRprotein in these cells may explain the observation of others thatGH treatment has little effect on the rat primary neonatalcardiomyocyte in culture (17, 20). Furthermore, adult wholeheart expresses about 35% more GHR transcripts than theneonatal heart (Fig. 1A and Table II), thus increasing thepossibility that GH has direct effects on adult cardiomyocytesin vivo.

Adenovirus-mediated Overexpression of GHR—To determinewhether cultured cardiomyocytes could be made sensitive tothe effects of GH, we explored means to increase the expressionof GHR in rat neonatal cardiomyocytes. Pilot experiments re-vealed that strategies to obtain a homogenous population ofcardiomyocytes overexpressing GHR, such as a selection proc-ess based on co-transfection of the plasmid pHook-2 (Invitro-gen), resulted in poor yields. Hence, we chose to employ analternate strategy using recombinant adenovirus (45, 46). Thesecond generation shuttle vector pADLOX was modified tocontain either the b-galactosidase (b-galAdlox) or the murineGHR cDNA (GHRAdlox) under the control of the cytomegalo-virus promoter. The production of replication-deficient adeno-viral vectors expressing either b-galactosidase or GHR cDNAwas achieved by a protocol based on the Cre-lox principle (27).A multiplicity of infection of ;12.5 plaque-forming units/cellwas routinely used in this study because pilot experimentsdetermined this multiplicity of infection to be the upper limit oftolerance of the isolated cardiomyocytes to adenoviral infection.Analysis of cell lysates by Western blot with an antiserumagainst the GHR cytoplasmic domain shows the expected GHRprotein product (lower panel of Fig. 2A and upper panel of Fig.2B). The number of cell surface receptors was determined bycompetition binding using 125I-labeled human GH. Whereasthere was no specific binding with noninfected cardiomyocytes,140,000 6 23,000 receptors/cell with a Kd of 4.9 6 1.1 nM weredetected on the infected cardiomyocytes.

GH-GHR Signaling Pathways in Isolated Cardiomyo-cytes—GH signaling is initiated by ligand-induced GHR dimer-ization and activation of the receptor-associated tyrosine ki-nase, JAK2 (38, 47, 48). This results in tyrosinephosphorylation of JAK2, the GHR, and other intracellularproteins (see Refs. 49 and 50 and references therein). With theexception of calcium influx (51), the GH-dependent activationof intracellular signal cascades, such as the STAT5, phosphati-dylinositol 3-kinase/Akt, and MAPK pathways requires JAK2activation (49, 50). To determine if GH signaling in our in vitromodel system was similarly associated with intracellular tyro-sine phosphorylation, cells stimulated with GH or vehicle weredetergent-solubilized, and proteins resolved by SDS-polyacryl-amide gel electrophoresis were immunoblotted with anti-phos-photyrosine antibodies (Fig. 2A, upper panel). Stimulation ofisolated cardiomyocytes transduced with the GHR-overex-pressing virus with GH for 15 or 30 min resulted in the ap-

FIG. 1. A, RT-PCR measurement of GHR mRNA levels in adult andneonatal rat heart and neonatal rat isolated cardiomyocytes. Expres-sion of GHR transcripts in rodent heart or liver is shown. RT-PCR wasperformed using total RNA from no RT control-adult rat liver (lane 1);adult mouse liver (lane 2); adult mouse heart (lane 3); adult rat liver(lane 4); adult rat heart (lane 5); adult rat primary cardiomyocytes (lane6); neonatal rat heart (lane 7); neonatal rat noncardiomyocytes (lane 8);and neonatal rat primary cardiomyocytes (lane 9). A 1-mg aliquot oftotal RNA was split to amplify either rodent GHR (upper panel) orGAPDH transcripts (bottom panel). Note the low levels of GHR inisolated neonatal cardiomyocytes (lane 9) compared with adult hearttissue (lane 5) or neonatal rat heart (lane 7). B, pattern of expression ofGHR in cultured cardiomyocytes. Isolated primary rat neonatal car-diomyocytes were cultured for 48 h before fixation in 4% paraformal-dehyde. Cells were analyzed by indirect immunofluorescence usingprimary antibody specific for the cytoplasmic region of the GHR (GHR-2). Note perinuclear localization of GHR fluorescence (arrow) with littlemembrane-associated fluorescence.

Cardiac Effects of Growth Hormone 22895

by guest on August 31, 2016

http://ww

w.jbc.org/

Dow

nloaded from

pearance of two prominent tyrosine-phosphorylated bands inthe 100–125-kDa range, which were not detected in extracts ofthe cells transduced with the b-galactosidase overexpressingvirus (lanes 4–6 versus lanes 1–3). By analogy to our previousstudies of rodent cells (36, 38), these GH-induced tyrosinephosphoproteins (a sharp band designated by an arrow and adiffuse, more rapidly migrating band designated by a bracket)probably include JAK2 and the GHR. To further their identi-fication, the nitrocellulose filter was sequentially stripped andreprobed with anti-JAK2AL33 (Fig. 2A, middle panel) and anti-

GHRAL47 (Fig. 2A, lower panel) sera. As expected, endogenousJAK2 (arrow) was detectable at similar levels in each sample,while GHR (bracket that includes the fully glycosylated andfaster migrating incompletely glycosylated GHR forms (52))was present only in the GHR-overexpressing cells. The tyrosinephosphoproteins present in lanes 5 and 6 of the upper panelexactly comigrated with JAK2 and the fully glycosylated GHRand are thus designated P-JAK2 and P-GHR, as indicated.These data strongly suggest that GH acutely promotes JAK2and GHR tyrosine phosphorylation in the GHR-reconstitutedcardiomyocytes.

To further characterize signaling pathways downstream ofJAK2 activated by GH in our cardiomyocyte model system, weperformed a similar experiment in which b-galactosidase- orGHR-overexpressing cardiomyocytes were treated with vehicleor GH for 15 min. Extracted proteins were separated by SDS-polyacrylamide gel electrophoresis and sequentially immuno-blotted with activation state-specific antibodies that detect thephosphorylated forms of STAT5, Akt, and MAPK (ERK1 andERK2) (Fig. 2B). We observed robust GH-induced phosphoryl-ation of each signaling molecule in the GHR-overexpressingcells, while the b-galactosidase-overexpressing cells exhibited amore modest degree of activation of STAT5 and Akt phospho-rylation and minimal MAPK phosphorylation (with a higherbasal degree of MAPK activation in these cells). Similarity ofloading was demonstrated by assaying for total MAPK (Fig. 2B,bottom panel). In other experiments (not shown), GH-depend-ent activation of the STAT5, Akt, and MAPK pathways wasconsistently observed in GHR-transduced cells, in contrast toinconsistent and weak responses in the b-galactosidase-over-expressing cells. These data suggest that the canonical path-ways of GH-GHR signaling cascades are reliably intact in car-diomyocytes overexpressing the GHR.

GH Modulates Metabolic Parameters in Isolated Cardiomyo-cytes—GH is known to alter metabolic parameters of GH-re-sponsive tissues. Having established that the recombinant ad-enovirus-infected cardiomyocytes expressed GHR, we nexttested the effect of GH on metabolic parameters such as incor-poration of amino acids, fatty acids, and glucose uptake ofcardiomyocytes in this model. GH did not alter the uptake ofany of the metabolites in nontransduced or b-galactosidase-overexpressing adenovirus-transduced cardiomyocytes. How-ever, in GHR-overexpressing neonatal cardiomyocytes, GHincreased the incorporation of L-[3,4,5-3H]leucine in a dose-de-pendent manner: 127 6 7, 144 6 14, and 163 6 28% at doses of0.5, 50, and 1250 ng/ml, respectively (mean 6 S.E.; n 5 3) (Fig.3). Likewise, GH increased the uptake of [9,10-3H]palmiticacid, although a statistically significant effect (151 6 10%) wasobservable only at a GH concentration of 1250 ng/ml (Fig. 4). Incontrast, the uptake of 2-deoxy-D-glucose (2-G-3H-labeled) wasinhibited by 60 6 11% after 4 h of exposure to a GH concen-tration of 1250 ng/ml (Fig. 5).

To ascertain the possible mechanism for the impaired glu-cose uptake, we next measured the levels of glucose transportproteins in these samples. Western blot analysis of cell lysatesdetermined that GH decreased the levels of Glut1 by ;25–30%in GHR-overexpressing cardiomyocytes compared with car-

TABLE IITaqMan RT-PCR assay for relative quantification of GHR transcripts in adult heart, neonatal heart, and isolated neonatal cardiomyocytesAH, adult rat heart RNA; NH, neonatal rat heart RNA; NCM, isolated neonatal cardiomyocyte RNA. Results represent the average of at least

three independent measurements. *, p , 0.05 compared with NH.

Origin GHR CT value(mean 6 S.D.)

18 S CT value(mean 6 S.D.)

DCT GHR-18 S(mean 6 S.D.)

DDCT DCT 2 DCTAH (mean 6 S.D.)

GHR relative to AH(mean and range)

AH 21.26 6 0.07 16.27 6 0.14 4.99 6 0.18 0.00 6 0.18 1 (0.89–1.13)NH 21.76 6 0.35 16.15 6 0.26 5.62 6 0.17 0.63 6 0.17 0.65 (0.57–0.73)NCM 23.13 6 0.17 15.73 6 0.38 7.40 6 0.35* 2.41 6 0.35 0.19 (0.15–0.24)

FIG. 2. GH stimulates GH-dependent post-receptor signalingpathways in GHR-overexpressing rat neonatal cardiomyocytes.A and B, isolated rat neonatal cardiomyocytes overexpressing eitherb-galactosidase or GHR were stimulated with rGH (500 ng/ml) or ve-hicle (0 min) for the indicated durations. Detergent-solubilized proteinswere resolved by SDS-polyacrylamide gel electrophoresis and sequen-tially immunoblotted with the indicated antibodies. In A, the position ofthe prestained 97-kDa molecular mass marker is indicated. P-GHR,P-JAK2, and P-STAT5, tyrosine-phosphorylated GHR, JAK2, andSTAT5, respectively. P-Akt, serine-phosphorylated (activated) Akt; P-MAPK, dually (threonine and tyrosine) phosphorylated (activated)ERK-1 and -2, as described under “Experimental Procedures.” Theabundance of total MAPK is indicated in the bottom panel. The posi-tions of JAK2 and GHR present in the extracts are indicated also. Theexperiments shown are representative of two such experiments.

Cardiac Effects of Growth Hormone22896

by guest on August 31, 2016

http://ww

w.jbc.org/

Dow

nloaded from

diomyocytes transduced with the b-galactosidase adenovirus(Fig. 6, A and B). In contrast, there was no change in the levelsof Glut4 transport protein in these samples. In addition, esti-mation of hexokinase activity did not reveal any significantchanges in cells after exposure to GH (data not shown). Theseresults indicate that the GH-induced decrease in glucose up-take by cardiomyocytes is in part due to alteration in levels ofthe Glut1 protein.

Fatty acid transport across membranes can be due to bothdiffusion and carrier-mediated processes (53). Many proteinsare thought to participate in the transmembrane translocationof fatty acids. These include fatty acid-binding proteins, fattyacid translocase, and fatty acid transport proteins (54). Havingdemonstrated that GH increased the uptake of fatty acids inthe GHR-overexpressing cardiomyocytes, we used the fluores-cent 59-nuclease (TaqMan) assay to measure the levels ofmRNA for one of the known FATPs in this model system (55).These studies revealed that the GH increased the levels ofmRNA for FATP by ;50% in GHR-overexpressing cardiomyo-cytes in comparison with b-galactosidase-overexpressing car-diomyocytes (Fig. 7).

GH Stimulates Hypertrophy of Isolated Cardiomyocytes—IGF-1 is known to induce hypertrophy of the isolated cardiom-yocyte, and previous reports have concluded that GH does nothave a similar effect on these cells (20). We reexamined theissue of direct effects of GH in our model of GHR-overexpress-ing cardiomyocytes. For this purpose, we measured the area ofcells exposed to GH or the vehicle only. These experimentsrevealed that cardiomyocytes transduced with the b-galacto-sidase-overexpressing adenovirus did not undergo changes incell size on exposure to rGH (GH(2) versus GH(1), 1083 6 36

FIG. 3. Stimulation of leucine uptake by GH in GHR-overex-pressing rat neonatal cardiomyocytes. GHR overexpressing car-diac myocytes were incubated with 12.5 mci/ml leucine (L-3,4,5-3H-labeled) and exposed to varying concentrations of rGH (0, 0.5, 50, and1250 ng/ml) for 24 h. Cellular uptake of leucine (L-3,4,5-3H-labeled) wasmeasured by scintillation counting at the end of the incubation period.Results represent mean 6 S.E. of three separate experiments. ,, p ,0.05 compared with GH (0 ng/ml) control by ANOVA.

FIG. 4. Stimulation of fatty acid uptake by GH in GHR-overex-pressing rat neonatal cardiomyocytes. GHR-overexpressing car-diomyocytes were incubated with 0, 50, 500, or 1250 ng/ml of rGH for4 h. Fatty acid uptake was measured 2 min after the addition of asolution containing 40 mM palmitic acid, 10 mM bovine serum albumin,and tracer [9,10-3H]palmitic acid. Fatty acid uptake was estimated byscintillation counting at the end of the incubation period. Results rep-resent mean 6 S.E. of three separate experiments. ,, p , 0.05 (ANOVA)compared with in the absence of GH.

FIG. 5. Inhibition of glucose uptake by GH in GHR-overex-pressing rat neonatal cardiomyocytes. GHR-overexpressing car-diomyocytes were incubated in DMEM containing 1 g/liter glucose plus1 mCi/ml 2-deoxy-D-glucose (2-G-3H-labeled) in the absence (open bar) orpresence (solid bar) of rGH (1250 ng/ml) for 10 min, 1 h, or 4 h.2-deoxy-D-glucose (2-G-3H-labeled) uptake was measured by scintilla-tion counting at the end of the respective incubation period. Resultsrepresent mean 6 S.E. of three separate experiments. ,, p , 0.05(ANOVA) compared with in the absence of GH.

FIG. 6. Glut1 and Glut4 protein levels in GH-treated GHR-overexpressing rat neonatal cardiomyocytes. A, quantitativeanalysis of Glut1 and -4 protein expression. b-Galactosidase-overex-pressing (open bars) or GHR-overexpressing (solid bars) cardiomyocyteswere stimulated with 1250 ng/ml rGH for 4 h. Cell lysates were col-lected from these two treatment groups. 20-mg aliquots of protein lysatewere analyzed for Glut1 or Glut4 expression by Western blot analysisusing anti-rat Glut1 or Glut4 antibodies. The blots were reprobed forb-actin to normalize for protein loading. The intensity of signal wasdetermined by densitometry quantification. Results represent mean 6S.E. of three separate experiments. ,, p , 0.05 (ANOVA) compared withb-galactosidase-overexpressing cardiomyocytes. B, Western blot analy-sis of Glut1 and Glut4 expression. Representative Western blots dem-onstrating the 50-kDa Glut1, 48-kDa Glut4, and the actin bands areshown.

Cardiac Effects of Growth Hormone 22897

by guest on August 31, 2016

http://ww

w.jbc.org/

Dow

nloaded from

versus 1087 6 58, mean 6 S.E.; p . 0.05 by ANOVA). Incontrast, exposure to rGH (500 ng/ml) for 24 h resulted in asignificant increase in the size of the cardiomyocyte transducedwith the GHR-overexpressing adenovirus (GH(2) versusGH(1), 947 6 48 versus 1651 6 64 mm; p , 0.01 by ANOVA).

Cardiac hypertrophy is associated with characteristic changesin gene expression. Thus, it is well established that the expres-sion of early response genes (e.g. c-fos, c-myc, c-jun, egr-1) areactivated within 30–60 min after exposure to a hypertrophicstimulus. Additionally, “late” markers of cardiac hypertrophy(e.g. ANF, myosin light chain 2, a-skeletal actin, b-myosin heavychain) are also variably activated in various forms of cardiachypertrophy. We utilized the TaqMan assay to profile the GH-dependent expression of representative genes from the “early”(i.e. c-fos) and from the “late” (i.e. ANF, myosin light chain 2,a-skeletal actin) response group of genes in our model system(Fig. 8). Our results indicate that in GHR-overexpressing cells,GH elicited a robust (500–600%) increase in expression of c-fosmRNA and a modest (40–60%) increase in expression of myosinlight chain 2 and a-skeletal actin mRNA. In contrast, GH did notalter the expression of ANF mRNA in these cells.

GH’s Actions on Isolated Cardiomyocytes Are Independent ofIGF-1—At the cellular level, the actions of GH can be eitherattributed to direct effects of GH or due to indirect effects, sinceGH induces the synthesis of IGF-1 in many tissues and IGF-1has potent actions in these tissues (56). To determine if theeffects of GH observed in our model system were due to directeffects of GH or due to stimulation of IGF-1 synthesis, weestimated the levels of IGF-1 mRNA by ribonuclease protectionand fluorescent 59-nuclease (TaqMan) assays. The RPA analy-sis revealed that there was no change in IGF-1 levels in re-sponse to GH stimulation for 24 h (Fig. 9A). To exclude thepossibility that changes in IGF-1 could have preceded the ob-served effects of GH on the metabolic parameters and cell size,we used the fluorescent 59-nuclease (TaqMan) assay to inves-tigate the temporal profile of IGF-1 in our model system. Thesedata reveal that, in concert with the RPA data, there are nosignificant changes in IGF-1 mRNA levels in these cells inresponse to GH stimulation for 15 min, 60 min, or 4 h (Fig. 9B).

DISCUSSION

We demonstrate that GH has effects on the isolated neonatalcardiomyocyte expressing GHR. Our results indicate that GHcauses hypertrophy of the cardiomyocyte and alters its meta-bolic profile by decreasing glucose uptake while increasingfatty acid uptake and protein accretion rate. Both the morpho-

logical and metabolic effects are not temporally associated withchanges in IGF-1 gene expression in these cells.

It is claimed that IGF-1 has direct actions on cardiomyocytes,whereas GH does not (17, 20). In this report, we demonstratethat the process of isolation and culture of neonatal cardiom-yocytes results in loss of expression of GHR mRNA and aber-rant localization of the GHR protein. In contrast to this loss ofexpression of GHR mRNA, IGF-1 receptor mRNA is increasedduring the process of isolation and culture (17). Thus, theseexperimental artifacts could be responsible for the finding thatthese cells respond to IGF-1 but are unresponsive to GH (20).Our data indicate that the strategy of using recombinant ade-novirus-mediated overexpression of GHR can be used to estab-lish an in vitro model of isolated cardiomyocytes that respondto GH. It is noteworthy that in our model system we did observesome GH-dependent effects in cardiomyocytes transfected withthe b-galactosidase-overexpressing adenovirus. The only con-sistent response following GH stimulation of cardiomyocytesnot overexpressing GHR was an increase in phospho-STAT5.This effect possibly reflects signaling through GHR or prolactinreceptors that remained intact during the isolation and culture.Activation of phospho-Akt and c-fos was also detectable in theb-galactosidase-overexpressing cells. However, these effectswere minimal and inconsistent, possibly reflecting variationsin harvesting and culture of these cells.

Whereas the actions of GH to alter the metabolic parametersin various cell types are well established, the current report isthe first to demonstrate effects of GH on the metabolic param-eters of the isolated cardiomyocyte. In general, the effects ofGH on carbohydrate metabolism can be grouped into acute andchronic effects. The acute effects of GH, commonly referred toas insulin-like actions, include decrease in blood glucose con-centration as well as stimulation of glucose uptake by muscleand isolated adipocytes in vitro. In contrast, the chronic effectsof exposure to GH include increase in blood glucose concentra-tion, inhibition of glucose uptake, and insulin resistance (16).Our results parallel observations in fat (57) and skeletal mus-cle (58) that demonstrate that GH decreases basal glucosetransport via a decline in GH-induced Glut1 mRNA withoutaffecting total cellular content of Glut4 protein. However, sincewe only analyzed total cellular Glut4, the possibility that al-terations in subcellular localization of Glut4 could contribute

FIG. 7. GH stimulates FATP gene expression in GHR-overex-pressing rat neonatal cardiomyocytes. b-Galactosidase (open bar)or GHR (solid bar) overexpressing cardiomyocytes were exposed to rGH(500 ng/ml) for 4 h, and total RNA was extracted for analysis of FATPgene expression using a fluorescent 59-nuclease (TaqMan) assay andemploying the comparative CT method. Expression of the FATP genewas normalized for expression of the 18 S gene. Results representmean 6 S.E. of three separate experiments. ,, p , 0.05 (ANOVA)compared with b-galactosidase-overexpressing cardiomyocytes.

FIG. 8. GH-induced alterations in genetic markers of hypertro-phy in GHR-overexpressing rat neonatal cardiomyocytes. GHR-overexpressing cardiomyocytes were exposed to rGH (500 ng/ml) for theindicated time periods, and total RNA was extracted for analysis ofc-fos, myosin light chain 2, skeletal a-actin, or ANF gene expressionusing fluorescent 59-nuclease (TaqMan) assays and employing the com-parative CT method. Expression of the specific mRNA was normalizedfor expression of the 18 S gene. Results represent the mean 6 S.E. ofthree independent experiments. ,, p , 0.05, not significant (ns) 5 p .0.05 (ANOVA) compared with cells exposed to vehicle only.

Cardiac Effects of Growth Hormone22898

by guest on August 31, 2016

http://ww

w.jbc.org/

Dow

nloaded from

toward GH-induced perturbations in insulin-responsive glu-cose transport cannot be excluded (59). Our results indicatethat GHR increases in the adult as compared with the neonatalheart and that GH can increase the fatty acid uptake by car-diomyocytes expressing GHR. In higher mammals, the abilityof cardiomyocytes to transport fatty acids increases with age,and there is an adaptive transition from glucose to fatty acidsas the preferred oxidative fuel for the mammalian heart duringmaturation from the fetus to the adult (24). Likewise, in therodent there is a 3-fold increase in fatty acid oxidative rates ofthe heart muscle during maturation from the neonate to theadult and a contemporaneous increase in expression of fattyacid transport proteins (54, 60). Since GHR expression in-creases postnatally, we postulate that this ontogenic profile ofexpression of GHR in the heart plays a role in the transition ofmetabolism of the mammalian heart, from dependence on glu-

cose in the fetus to preferential use of fatty acids postnatally.Cardiac hypertrophy is a hallmark of GH excess in both

animal models and humans (1). In contrast to prior studies thatconcluded that GH does not stimulate hypertrophy of cardiom-yocytes, our results indicate that GH does induce hypertrophyof isolated cardiomyocytes. Switches in isoform expression ofactin and myosin are observed with many forms of cardiachypertrophy, with each hypertrophic stimulus eliciting itscharacteristic profile of actin/myosin isoforms. In general, car-diac hypertrophy is associated with induction of fetal isoforms(i.e. skeletal a-actin, b-myosin heavy chain), expression of otherfetal proteins (i.e. ANF), and up-regulation of constitutivelyexpressed genes (i.e. myosin light chain 2, cardiac a-actin) (61).In the current model system, GH increased the expression ofc-fos, myosin light chain 2, and skeletal a-actin but did notalter the expression of ANF. It is of interest to note thatcombined administration of IGF-1 and GH in the intact animalfailed to alter expression of skeletal a-actin or ANF gene ex-pression (62). Similarly, IGF-1 decreased ANF gene expressionin isolated adult rat cardiomyocytes in culture (63). The differ-ential effects of GH on fetal gene expression with induction ofskeletal a-actin but not of ANF support the hypothesis thatactivation of the GH/IGF-1 axis induces a more physiological ornonpathological form of cardiac hypertrophy (62). However,further studies are needed to substantiate this hypothesis, andthe current experimental paradigm of adenovirus-mediatedGHR-overexpression will facilitate further analysis of the ef-fects of GH/IGF-1 in both neonatal and adult cardiomyocytes.

The somatomedin hypothesis states that the anabolic andgrowth-promoting effects of GH are principally mediated bystimulation of production of IGF-1 by the liver (endocrine ac-tion) and peripheral tissues (autocrine/paracrine action) (16).Contemporary studies using techniques such as targeted dis-ruption and conditional tissue-specific knockout of specific pro-teins involved in this pathway have begun to reexamine thishypothesis (23, 64). Most recently, Lupu et al. (23), using a totalknockout model of GHR, demonstrate that there must be inde-pendent and additive effects of GH and IGF-1 on overall andspecific tissue growth. Our results complement these findings,since observed changes in the size of cardiomyocytes and theirmetabolic profile in response to GH were not accompanied bychanges in IGF-1 gene expression. Furthermore, using radio-immunoassay, we were unable to detect changes in concentra-tion of IGF-1 in the conditioned medium (data not shown),suggesting that in this model system the effects of GH are, atleast in part, independent of IGF-1. It is also noteworthy thatcardiac hypertrophy has been observed in IGF-1 knockout mice(65). In these IGF-1 null mice, circulating levels of GH areelevated, and one of the mechanisms resulting in cardiac hy-pertrophy could be direct action of the elevated circulatinglevels of GH on the heart, consistent with our results in theisolated neonatal cardiomyocyte expressing GHR.

Lupu et al. (23) demonstrated that divergence of the growthpatterns of normal and GHR knockout animals occurs onlyafter 2 weeks of life. Our studies extend the observations ofLupu et al. (23) by demonstrating that the relative lack of GH’seffect on the neonatal heart is, at least in part, due to thepaucity of GHR in the neonatal heart and that expression ofGHR increases significantly in the adult heart. Our model ofneonatal cardiomyocytes transduced with the GHR-expressingadenovirus thus tends to recapitulate the scenario in the adultcardiomyocyte with respect to GHR expression. Hence, ourstudies support the hypothesis that when the heart exhibitssufficient GHR expression, as in the adult, it is a target ofdirect GH action. This report describes a model based on ratneonatal cardiomyocytes. Cardiomyocytes from immature ani-

FIG. 9. GH-induced IGF-1 gene expression in GHR-overex-pressing rat neonatal cardiomyocytes. A, ribonuclease protectionassay. RNA was isolated from neonatal cardiomyocytes (uninfected(lanes 2 and 3), infected with b-galactosidase-overexpressing adenovi-rus (lanes 4 and 5), or infected with GHR-overexpressing adenovirus(lanes 6 and 7)), and the cells were either exposed for 24 h to rGH (500ng/ml) (lanes 3, 5, and 7) or vehicle only (lanes 2, 4, and 6). Lane 1, sizemarkers; lanes 8 and 9, control RNA from adult rat heart (lane 8) orliver (lane 9). 18 S RNA was also assayed to ensure equality of RNAloading. Three protected bands are visible: a major band of 224 basesand a minor band of 100 bases of IGF-Ia mRNA (30), both being specificprotections to different regions of the probe, and an 80-base bandcorresponding to the 18 S rRNA. Densitometric analysis of the pro-tected bands confirmed the absence of effect of GH on IGF-1 mRNAexpression in GHR overexpressing cells (lane 6 compared with lane 7).A, fluorescent 59-nuclease assay. b-Galactosidase-overexpressing (openbars) or GHR-overexpressing (solid bars) cardiomyocytes were exposedto rGH (500 ng/ml) for the indicated time periods, and total RNA wasextracted for analysis of IGF-1 gene expression using a fluorescent59-nuclease (TaqMan) assay and employing the comparative CT method.Expression of the IGF-1 gene was normalized for expression of the 18 Sgene. Results represent mean 6 S.E. of three separate experiments. Notsignificant (ns) 5 p . 0.05 (ANOVA) compared with b-galactosidase-overexpressing cardiomyocytes.

Cardiac Effects of Growth Hormone 22899

by guest on August 31, 2016

http://ww

w.jbc.org/

Dow

nloaded from

mals (embryonic, fetal, and neonatal) are easier to isolate andculture and thus have been widely used in in vitro studies.Adult ventricular cardiomyocytes, however, differ from imma-ture cells. Thus, adult cells are morphologically different inthat they have a larger, more developed transverse tubularsystem, grow more slowly in culture, and have a restrictedpotential for differentiation (66). These differences should betaken into account when interpreting the results of the presentstudy obtained with neonatal cardiomyocytes, and future stud-ies carried out with adult cardiomyocytes will shed light on theeffects of GH on the adult heart. It is noteworthy that ourstrategy of using adenovirus-mediated overexpression of GHRwill be suitable for use with adult cardiomyocytes (67).

In summary, we have established a model suitable for exam-ining the effects of GH on cardiomyocytes expressing GHR. Ourresults indicate that GH induces hypertrophy of these cells andcauses alterations in their metabolic profile independently ofIGF-1. These studies add to evidence that the effects of GH andIGF-1 on somatic growth may be additive yet independentlymediated and provide the first direct proof of independentactions of GH on the heart.

Acknowledgments—We thank Dr. Derek LeRoith (National Insti-tutes of Health) for the IGF-1 probe, Dr. Frank Talamantes for theGHR-2 antibody, Dr. David E. Kelley for hexokinase measurements,and the National Hormone and Pituitary Program (NIDDK, NationalInstitutes of Health) for reagents.

REFERENCES

1. Sacca, L., Cittadini, A., and Fazio, S. (1994) Endocr. Rev. 15, 555–5732. Morvan, D., Komajda, M., Grimaldi, A., Turpin, G., and Grosgogeat, Y. (1991)

Eur. Heart J. 12, 666–6723. Frustaci, A., Perrone, G. A., Gentiloni, N., and Russo, M. A. (1992) Am. J. Clin.

Pathol. 97, 503–5114. Merola, B., Cittadini, A., Colao, A., Longobardi, S., Fazio, S., Sabatini, D.,

Sacca, L., and Lombardi, G. (1993) J. Clin. Endocrinol. Metab. 77,1658–1661

5. Amato, G., Carella, C., Fazio, S., La Montagna, G., Cittadini, A., Sabatini, D.,Marciano-Mone, C., Sacca, L., and Bellastella, A. (1993) J. Clin. Endocrinol.Metab. 77, 1671–1676

6. Fazio, S., Sabatini, D., Capaldo, B., Vigorito, C., Giordano, A., Guida, R.,Pardo, F., Biondi, B., and Sacca, L. (1996) N. Engl. J. Med. 334, 809–814

7. O’Driscoll, J. G., Green, D. J., Ireland, M., Kerr, D., and Larbalestier, R. I.(1997) Lancet 349, 1068

8. Osterziel, K. J., Strohm, O., Schuler, J., Friedrich, M., Hanlein, D.,Willenbrock, R., Anker, S. D., Poole-Wilson, P. A., Ranke, M. B., and Dietz,R. (1998) Lancet 351, 1233–1237

9. Cittadini, A., Stromer, H., Katz, S. E., Clark, R., Moses, A. C., Morgan, J. P.,and Douglas, P. S. (1996) Circulation 93, 800–809

10. Isgaard, J., Kujacic, V., Jennische, E., Holmang, A., Sun, X. Y., Hedner, T.,Hjalmarson, A., and Bengtsson, B. A. (1997) Eur. J. Clin. Invest. 27,517–525

11. Duerr, R. L., McKirnan, M. D., Gim, R. D., Clark, R. G., Chien, K. R., and Ross,J., Jr. (1996) Circulation 93, 2188–2196

12. Cittadini, A., Grossman, J. D., Napoli, R., Katz, S. E., Stromer, H., Smith, R. J.,Clark, R., Morgan, J. P., and Douglas, P. S. (1997) J. Am. Coll. Cardiol. 29,1109–1116

13. Yang, R., Bunting, S., Gillett, N., Clark, R., and Jin, H. (1995) Circulation 92,262–267

14. Cittadini, A., Stromer, H., Vatner D. E., Grossman, J. D., Katz, S. E., Clark, R.,Morgan, J. P., and Douglas, P. S. (1997) Endocrinology 138, 5161–5169

15. Shen, Y. T., Wiedmann, R. T., Lynch, J. J., Grossman, W., and Johnson, R. G.(1996) Am. J. Physiol. 271, H1721–H1727

16. Harvey, S., Scanes, C. G., and Daughaday, W. H. (1995) Growth Hormone,CRC Press, Inc., Boca Raton, FL

17. Donath, M., Zapf, J., Eppenberger-Eberhardt, M., Froesch, E., andEppenberger, H. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 1686–1690

18. Foncea, R., Andersson, M., Ketterman, A., Blakesley, V., Sapag-Hagar, M.,Sugden, P. H., LeRoith, D., and Lavandero, S. (1997) J. Biol. Chem. 272,19115–19124

19. Li, O., Li, B., Wang, X., Leri, A., Jana, K., Liu, Y., Kajstura, J., Baserga, R., andAnversa, P. (1997) J. Clin. Invest. 100, 1991–1999

20. Ito, H., Hiroe, M., Hirata, Y., Tsujino, M., Adachi, S., Shichiri, M., Koike, A.,Nogami, A., and Marumo, F. (1993) Circulation 87, 1715–1721

21. Hjalmarson, A., Isaksson, O., and Ahren, K. (1969) Am. J. Physiol. 217,1795–1802

22. Ross, J., Jr. (1999) Circulation 99, 15–1723. Lupu, F., Terwilliger, J. D., Lee, K., Segre, G. V., and Efstratiadis, A. (2001)

Dev. Biol. 229, 141–16224. Vick, G. W., III, and Fisher, D. J. (1998) The Science and Practice of Pediatric

Cardiology (Garson, A., Jr., Bricker, J. T., Fisher, D. J., and Neish, S. R.,eds) pp. 155–169, Williams and Wilkins, Baltimore

25. Long, C. S., Henrich, C. J., and Simpson, P. C. (1991) Cell Regul. 2, 1081–109526. Simpson, P., and Savion, S. (1982) Circ. Res. 50, 101–11627. Hardy, S., Kitamura, M., Harris-Stansil, T., DaI, Y., and Phipps, L. (1997)

J. Virol. 71, 1842–184928. Camarillo, I. G., Thordarson, G., Ilkbahar, Y. N., and Talamantes, F. (1998)

Endocrinology 139, 3585–358929. Werner, H., Woloschak, M., Adamo, M., Shen-orr, Z., Roberts, C. T., Jr., and

LeRoith, D. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 7451–745530. Lowe, W. L., Jr., Lasky, S. R., LeRoith, D., and Roberts, C. T., Jr. (1988) Mol.

Endocrinol. 2, 528–53531. Winer, J., Jung, C. K., Shackel, I., and Williams, P. M. (1999) Anal. Biochem.

270, 41–4932. Gibson, U., Heid, C., and Williams, P. (1996) Genome Res. 6, 995–100133. Heid, C. A., Stevens, J., Livak, K. J., and Williams, P. M. (1996) Genome Res.

6, 986–99434. PerkinElmer Applied Biosystems (1997) User Bulletin 2: ABI Prism 7700

Sequence Detection System, Relative Quantitation of Gene Expression, Ap-plied Biosystems, Foster City, CA

35. PerkinElmer Applied Biosystems (1998) User Bulletin 5: ABI Prism 7700Sequence Detection System, Multiplex PCR with TaqMan Probes, AppliedBiosystems, Foster City, CA

36. Kim, S. O., Jiang, J., Yi, W., Feng, G. S., and Frank, S. J. (1998) J Biol Chem.273, 2344–2354

37. Liang, L., Zhou, T., Jiang, J., Pierce, J. H., Gustafson, T. A., and Frank, S. J.(1999) Endocrinology 140, 1972–1983

38. Zhang, Y., Jiang, J., Kopchick, J. J., and Frank, S. J. (1999) J. Biol. Chem. 274,33072–33084

39. Das, U. G., Schroeder, R. E., Hay, W. W., Jr., and Devaskar, S. U. (1999) Am. J.Physiol. 276, R809–R817

40. Jiang, J., Liang, L., Kim, S.O., Zhang, Y., Mandler, R., and Frank, S.J. (1998)Biochem. Biophys. Res. Commun. 253, 774–779

41. Leung, D. W., Spencer, S. A., Cachianes, G., Hammonds, R. G., Collins, C.,Henzel, W. J., Barnard, R., Waters, M. J., and Wood, W. I. (1987) Nature330, 537–543

42. Frank, S. J., Gilliland, G., and Van Epps, C. (1994) Endocrinology 135,148–156

43. Argetsinger, L. S. and Carter-Su, C. (1996) Physiol. Rev. 76, 1089–110744. Carter-Su, C., and Smit, L. (1998) Recent Prog. Horm. Res. 53, 61–8245. Verma, I. M., and Somia, N. (1997) Nature 389, 239–24246. Kirshenbaum, L., MacLellan, W., Mazur, W., French, B., and Schneider, M.

(1993) J. Clin. Invest. 92, 381–38747. Cunningham, B. C., Ultsch, M., de Vos, A. M., Mulkerrin, M. G., Clauser, K. R.,

and Wells, J. A. (1991) Science 254, 821–82548. Argetsinger, L. S., Campbell, G. S., Yang, X., Witthuhn, B. A., Silvennoinen,

O., Ihle, J. N., and Carter-Su, C. (1993) Cell 74, 237–24449. Carter-Su, C., Schwartz, J., and Smit, L. S. (1996) Annu. Rev. Physiol. 58,

187–20750. Frank, S. J., and O’Shea, J. J. (1998) Advances in Molecular and Cellular

Endocrinology (LeRoith, D., ed) Vol. 3, pp. 1–42, JAI Press, Greenwich, CT51. Billestrup, N., Bouchelouche, P., Allevato, G., Illondo, M., and Nielsen, J. H.

(1995) Proc. Natl. Acad. Sci. U. S. A. 92, 2725–272952. Yi, W., Kim, S. O., Jiang, J., Park, S. H., Kraft, A. S., Waxman, D. J., and

Frank, S. J. (1996) Mol. Endocrinol. 10, 1425–144353. Hamlin, G., and Kamp, F. (1999) Diabetes 48, 2255–226954. Nieuwenhoven, F. A. V., Willemsen, P. H. M., Van der Vusse, G. J., and Glatz,

J. F. C. (1999) Int. J. Biochem. Cell Biol. 31, 489–49855. Schaap, F. G., Hamers, G. J., Vusse, V. D., and Glatz, J. F. C. (1997) Biochim.

Biophys. Acta. 1354, 29–3456. Jones, J. I., and Clemmons, D. R. (1995) Endocr. Rev. 16, 3–3457. Tai, P. K., Liao, J-F., Chen, E. H., Dietz, J., Schwartz, J., and Carter-Su, C.

(1990) J. Biol. Chem. 265, 21828–2183458. Napoli, R., Cittadini, A., Chow, J. C., Hirshman M. F., Smith, R. J., Douglas,

P. S., and Horton, E. S. (1996) Biochem. J. 315, 959–96359. Kilgour, E., Baldwin, S. A., and Flint, D. J. (1995) J. Endocrinol. 145, 27–3360. Glatz, J. F. C., and Veerkamp, J. H. (1982) Biochim. Biophys. Acta. 711,

327–33561. Glennon, P. E., Sugden, P. H., and Poole-Wilson, P. A. (1995) Br. Heart J. 73,

496–49962. Tanaka, N., Ryoke, T., Hongo, M., Mao, L., Rockman, H. A., Clark, R. G., and

Ross, J., Jr. (1998) Am. J. Physiol. 275, H393–H39963. Schaub, M. C., Hefti, M. A., Harder, B. A., and Eppenberger, H. M. (1997) J.

Mol. Med. 75, 901–92064. LeRoith, D., Bondy, C., Yakar, S., Liu, J-L., and Butler, A. (2001) Endocr. Rev.

22, 53–7465. Wang, J., Zhou, J., Powell-Braxton, L., and Bondy, C. (1999) Endocrinology

140, 3391–339466. Claycomb, W. C. (1983) Adv. Exp. Med. Biol. 161, 249–26567. Kirshenbaum, L. (1997) Mol. Cell Biochem. 172, 13–21

Cardiac Effects of Growth Hormone22900

by guest on August 31, 2016

http://ww

w.jbc.org/

Dow

nloaded from

Frank and Ram K. MenonThamotharan, Paul D. Robbins, Charles F. McTiernan, Jun-Li Liu, Jiang Jiang, Stuart J.

Chunxia Lu, Gary Schwartzbauer, Mark A. Sperling, Sherin U. Devaskar, ShanthieDemonstration of Direct Effects of Growth Hormone on Neonatal Cardiomyocytes

doi: 10.1074/jbc.M011647200 originally published online April 12, 20012001, 276:22892-22900.J. Biol. Chem. 

  10.1074/jbc.M011647200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/276/25/22892.full.html#ref-list-1

This article cites 63 references, 23 of which can be accessed free at

by guest on August 31, 2016

http://ww

w.jbc.org/

Dow

nloaded from