Development of Protoporphyrinogen Oxidase as anEfficient Selection Marker for Agrobacterium tumefaciens-Mediated Transformation of Maize
Xianggan Li*, Sandy L. Volrath1, David B.G. Nicholl, Charles E. Chilcott,Marie A. Johnson, Eric R. Ward1, and Marcus D. Law2
Syngenta Biotechnology, Inc., P.O. Box 12257, 3054 Cornwallis Road, Research Triangle Park, North Carolina27709–2257
In this article, we report the isolation of plant protoporphyrinogen oxidase (PPO) genes and the isolation of herbicide-tolerant mutants. Subsequently, an Arabidopsis double mutant (Y426M � S305L) was used to develop a selectable markersystem for Agrobacterium tumefaciens-mediated transformation of maize (Zea mays) and to obtain multiple events tolerant tothe PPO family of herbicides. Maize transformants were produced via butafenacil selection using a flexible light regime toincrease selection pressure. Butafenacil selection per se did not change transgene copy number distribution relative to otherselectable marker systems, but the most tolerant events identified in the greenhouse were more likely to contain multiplecopies of the introduced mutant PPO gene. To date, more than 2,500 independent transgenic maize events have beenproduced using butafenacil selection. The high frequency of A. tumefaciens-mediated transformation via PPO selectionenabled us to obtain single-copy transgenic maize lines tolerant to field levels of butafenacil.
In the last decade, two predominant methods weredeveloped to facilitate maize (Zea mays) transforma-tion. The first successful method was microparticlebombardment (Klein et al., 1988a, 1988b, 1989). Thebombardment method has been adopted widely bymany researchers for use on different maize tissuetypes and on other crops (Fromm et al., 1990;Gordon-Kamm et al., 1990; Armstrong, 1999). Morerecently, Agrobacterium tumefaciens-mediated trans-formation was developed for maize (Ishida et al.,1996). This approach has been increasingly incorpo-rated as the method of choice for reasons such as lowtransgene copy number, well-defined borders, andhigh frequency (Negrotto et al., 2000; Ingham et al.,2001; Frame et al., 2002; Miller et al., 2002). Concur-rent with gene delivery methods, selectable markerdevelopment has been integral in developing effi-cient maize transformation. Kanamycin (Fromm etal., 1986; Rhodes et al., 1988; Lyznik et al., 1989) andhygromycin (Walters et al., 1992) were two of theearliest antibiotics used as selection agents in corn.The first herbicide used as a selection agent for maizetransformation was the Glu analog phosphinothricinor, more commonly, the tripeptide bialaphos (l-phosphinothricyl-l-alanyl-l-ananine), which con-
tains phosphinothricin as the active ingredient(Fromm et al., 1990; Gordon-Kamm et al., 1990).Maize callus selection on bialaphos, mediated by ei-ther the bar (bialaphos resistance) gene or pat (phos-phinothricin acetyl transferase) gene, was found to bemore efficient than selection on kanamycin (Registeret al., 1994).
Although herbicide-based selectable marker sys-tems have proven to be quite effective, a significantamount of work has also been done to develop so-called “positive” selectable marker systems. Theseare systems that facilitate growth of transformed tis-sue rather than kill non-transformed tissue (Joersbo,2001). An example of this is the phospho-Man-isomerase (PMI) system, which enables the efficientrecovery of transgenic corn events on media contain-ing Man (Joersbo et al., 1998; Negrotto et al., 2000;Wang et al., 2000; Wright et al., 2001).
Although a variety of selectable marker systemsare available for maize, additional systems are desir-able for several reasons. First, new selectable markerscan be used for sequential corn transformations, thusfacilitating the stacking of multiple traits as valuablenew traits become available (Armstrong, 1999). Sec-ond, new systems that reduce selection time wouldbe advantageous for maximizing high-throughputproduction of transgenic events. The process of large-scale transformation could also benefit from flexibleapplications of selection pressures (i.e. light or tem-perature) that would allow for increased selectionlevels without labor-intensive tissue transfer. Finally,a new herbicide tolerance gene provides a uniqueadvantage in that non-transgenic plants can be re-moved from a segregating population by a simple
herbicide spray in the field (Gordon-Kamm et al.,1990; Spencer et al., 1990). This is particularly impor-tant when considering the scale involved in commer-cial corn hybrid seed production.
We have investigated a possible selectable markersystem consisting of the herbicidal compoundbutafenacil (Tomlin, 2000) and its molecular target,protoporphyrinogen oxidase (PPO). PPO is a keyenzyme in the chlorophyll/heme biosynthetic path-way, catalyzing the oxidation of protoporphyrinogenIX to protoporphyrin IX (Fig. 1; Smith et al., 1993).This is the last common step in the production ofheme and chlorophyll. Heme is an essential cofactorin cytochromes, hemoglobin, oxygenases, peroxi-dases, and catalases, and, therefore, is a necessaryproduct for all aerobic organisms. The production ofchlorophyll, a light-harvesting pigment, is an essen-tial process for all green photosynthetic organisms.This characteristic makes PPO an excellent gene tar-get for herbicide development (Jacobs et al., 1991;Nandihalli and Duke, 1993). When PPO is inhibitedby the PPO family of herbicides, protoporphyrin IXaccumulates and causes light-dependent membranedamage (Fig. 1; Lee et al., 1993).
PPO genes have been isolated from Escherichia coli(Sasarman et al., 1979, 1993), Bacillus subtilis (Daileyet al., 1994), and plants (Narita et al., 1996; Lermon-tova et al., 1997; Ward and Volrath, 1998; Volrath etal., 1999, 2000). Attempts have been made to improveplant tolerance to PPO inhibitory herbicides both byoverexpressing native PPO genes in plants and byselecting for resistant mutants. Expression of the nat-urally tolerant B. subtilis PPO in transgenic tobacco(Nicotiana tabacum) and rice (Oryza sativa) showedresistance to a diphenyl ether herbicide (Lee et al.,2000). No field trials were reported in this publica-
tion. In transgenic tobacco plants overexpressing thewild-type Arabidopsis PPO-1 enzyme, the enzymaticactivity increased about 5- to 7-fold, and tolerance tothe diphenyl-ether herbicide acifluorfen was in-creased about 5-fold in a seed germination assay(Lermontova and Grimm, 2000). Watanabe et al.(1998) reported a herbicide-resistant tobacco cell line(YZI-1S) that was selected via conventional tissueculture with a PPO herbicide. The level of plastidPPO mRNA in tobacco YZI-1S cells was the same asin wild type, whereas the level of mitochondria PPOmRNA was up to 10 times higher. Other resistant celllines of soybean (Glycine max) and tobacco have beenisolated and shown to overproduce mitochondrialPPO (Warabi et al., 2001; Watanabe et al., 2002). Inthe herbicide-selected Chlamydomonas reinhardtiigreen algae mutant rs-3, resistance to the porphyricherbicide S-23142 was due to a (GTG) Val to (ATG)Met mutation at Val-389 of the C. reinhardtii plastidicPPO gene (Randolph-Anderson et al., 1998).
Our research focused on using cloned plant PPOgenes to identify mutations that confer high levels oftolerance to the PPO inhibitor butafenacil (Tomlin,2000) and on the transfer of these herbicide-tolerantgenes back into plants. In this paper, we will describethe identification of PPO mutations, the developmentof a selectable marker system, and the production oftransgenic corn events tolerant to PPO inhibitors.
RESULTS
Isolation of Plant PPO Genes
Arabidopsis PPO cDNAs were isolated by func-tional complementation of the E. coli PPO mutantSASX38 (Sasarman et al., 1993). This bacterial strain
Figure 1. Mode of action of PPO. The porphyrinpathway was proposed by Jacobs et al. (1991).When chloroplastic PPO is inhibited, protopor-phyrinogen IX accumulates, leaks into the cy-tosol, and is oxidized to protoporphyrin IX. Pro-toporphyrin IX reacts with light to producesinglet oxygen, leading to lipid peroxidation,membrane disruption, and cell death.
Protoporphyrinogen Oxidase and Maize Transformation
has a hemG (PPO) deletion and will not grow withoutthe addition of exogenous heme in the culture me-dium or an alternate source of PPO activity. Sequenceanalysis of complementing clones revealed twoclasses of Arabidopsis PPO genes. The first class wasdesignated “PPO-1” (Ward and Volrath, 1998) andcorresponded to the chloroplast-targeted enzyme(Che et al., 2000). This cDNA was 1,719 bp in lengthand encoded a protein with a molecular mass of 57.7kD. The N-terminal peptide sequence had featurescharacteristic of a chloroplast transit peptide of ap-proximately 35 to 50 amino acids. The sequence(GenBank accession no. AX084732) was described inU.S. patent 5,767,373 (Ward and Volrath, 1998) andby Narita et al. (1996). An Arabidopsis PPO-1 cDNAfragment was subsequently used as a hybridizationprobe to isolate full-length or partial cDNAs encod-ing the PPO-1 enzymes from maize, wheat (Triticumaestivum), rice, sorghum (Sorghum bicolor), soybean,cotton (Gossypium hirsutum), sugar beet (Beta vulgar-is), sugarcane (Saccharum officinarum), and oilseedrape (Brassica napus; Volrath et al., 2000).
The second class of clone was designated “PPO-2”and corresponded to the mitochondria-targeted en-zyme. The putative full-length cDNA was 1,738 bp inlength, encoded a protein with a molecular mass of55.6 kD, and possessed an amino-terminal extensionthat had some characteristics of a mitochondria tran-sit peptide. The sequence of PPO-2 exhibited limitedhomology to PPO-1 (53% similar, 28% identical). Thesequence of PPO-2 (GenBank accession no. AX084734)was also described in U.S. Patent 5,767,373 (Ward andVolrath, 1998).
Identification of Mutants Tolerant to PPO Inhibitors
Wild-type E. coli strains showed no sensitivity tobutafenacil at any concentration, consistent with thereported resistance of the native bacterial enzyme tosimilar herbicides (Sasarman et al., 1993). In contrast,the E. coli strain SASX38 complemented by eitherArabidopsis PPO-1 or PPO-2 was clearly sensitive tobutafenacil, with strong growth inhibition at concen-trations as low as 10 nm. This enabled us to use thebacterial system to screen large numbers of mutatedplant PPO genes for mutations that could conferherbicide tolerance.
We chose to use the mutator E. coli strain XL1-Red(Greener and Callahan, 1994) for random in vivomutagenesis of the Arabidopsis PPO-1 gene. Theclone that proved most useful for these experimentswas originally isolated from a plasmid library com-prising Arabidopsis cDNAs cloned bidirectionally inthe yeast (Saccharomyces cerevisiae) expression vectorpFL61 (Minet et al., 1992). This library also expressesin E. coli. The particular truncated PPO-1 clone cho-sen for mutagenesis/screening was missing the first40 amino acids of the gene, and translation appar-ently initiates at an ATG within the yeast PGK ter-
minator. This PPO-1 clone was randomly mutated,transformed into E. coli strain SASX38, and screenedfor the ability to grow on media containing butafe-nacil. In a pilot round of mutagenesis/screening, weidentified an amino acid change near the N terminusof this PPO-1 insert that confers herbicide “tolerance”only by increasing growth rate; this apparent in-crease in enzyme function appears to be an artifact ofthis particular truncated fusion protein. This modi-fied clone, designated pMut-1, was subjected to asecond round of random mutagenesis in XL1-Redand screened on herbicide concentrations lethal tothe unmutagenized pMut-1 PPO-1 plasmid. Morethan 90% of the resistant colonies recovered from thissecond screen contained PPO-1 coding sequenceswith single amino acid changes that conferred signif-icant tolerance to butafenacil. Three different mu-tants were identified. All amino acid numbers corre-spond to the full-length Arabidopsis PPO-1 cDNA.Plasmid Ala220Val had a GCT (Ala) to GTT (Val)mutation at amino acid 220. Plasmid Tyr-426-Cyshad a TAC (Tyr) to TGC (Cys) mutation at aminoacid 426. The third resistant clone, isolated at lowerfrequency, was pGly-221-Ser, with a GGT (Gly) toAGT (Ser) change at amino acid 221, adjacent to themutation in pAla-220-Val.
Because PPO herbicides are competitive inhibitorsof PPO, mutations that confer resistance to theseherbicides also tend to reduce enzymatic activity.SASX38 cells relying on the original mutants Ala-220-Val and Tyr-426-Cys for PPO activity had signifi-cantly reduced growth rates (relative to pMut-1) inthe absence of herbicide. In an effort to isolate “sec-ond site” changes that could mitigate or eliminatethis effect, these two mutant plasmids were indepen-dently mutagenized again and screened in SASX38on lethal herbicide concentrations. Several secondsite changes were identified that enhanced thegrowth rate of the herbicide-tolerant mutants both inthe presence and absence of herbicide. These muta-tions failed to confer any herbicide resistance wheninserted alone into wild-type PPO genes. The mostinteresting change arose several times in both screensand enhanced the growth rate of both mutants sig-nificantly. This mutation contained a TCA (Ser) toTTA (Leu) change at amino acid 305 and was desig-nated Ser-305-Leu.
Amino acids Ala-220 and Tyr-426 were also sub-jected to site-directed mutagenesis, with every pos-sible amino acid change assayed for both functionand tolerance by growth in the presence and absenceof herbicide. This led to the identification of addi-tional herbicide tolerance mutations, some of whichwere more resistant than the original isolates. Ala-220 could be changed to Val, Thr, Leu, Cys, or Ile toyield a functional and herbicide-resistant PPO en-zyme. Likewise, Tyr-426 could be changed to Cys, Ile,Leu, Thr, or Met to yield a functional and herbicide-resistant PPO enzyme.
Combinations of mutations identified in the site-directed studies and in the second site screens wereconstructed and assayed for growth � butafenacil.This led to the identification of multiple highly tol-erant, highly functional Arabidopsis PPO-1 mutantcombinations, such as the Y426M � S305L mutantused for gene targeting in Arabidopsis (Hanin et al.,2001). The Tyr-426-Met resistance mutation withoutany additional second site mutation confers high tol-erance to butafenacil as well. The transgenic con-structs pWCO38 and pWCO39, derived from thedouble mutant Y426M � S305L, were used in allexperiments reported below.
Production of Herbicide-Tolerant Plants byExpression of Mutant PPO
To evaluate an herbicide resistant PPO enzyme inplants, we needed an effective promoter to controlexpression of the transgene. For expression in Arabi-dopsis and potentially in other dicots, we isolated theendogenous Arabidopsis PPO-1 promoter (Johnsonet al., 2000). The promoter fragment as isolated com-prised 580 bp (GenBank accession no. AX084744) ofArabidopsis genomic DNA upstream from the initi-ating Met (ATG) of the PPO-1 coding sequence. This580-bp fragment was fused to the double mutantPPO (Y426M � S305L) and transformed into Arabi-dopsis by vacuum infiltration of A. tumefaciens (Bech-told and Pelletier, 1998). Seed from the infiltratedplants was collected and plated on a range of butafe-nacil concentrations (10.0 nm–10.0 �m). Transgenicseedlings expressing the altered enzyme were recov-ered at herbicide concentrations of up to 5 �m. Wild-type Arabidopsis germination was totally inhibitedby 100.0 nm butafenacil, indicating at least 50-foldhigher herbicide tolerance in the transgenic seed-lings. Multiple plants that germinated on butafenacilwere transplanted and taken to seed. Progeny fromthese plants were tested in a spray assay with variousconcentrations of the herbicide. When comparedwith control plants in the spray assay, some trans-genic lines were at least 500-fold more tolerant to theherbicide spray (Fig. 2). The herbicide tolerance traitappeared to be stably inherited through several gen-erations of the plants that were tested. Seed from someof the most tolerant lines was also tested in a germi-nation assay. In addition to butafenacil, Arabidopsisplants expressing the double mutant PPO (Y426M �S305L) were tested for cross-tolerance to a variety ofother PPO inhibitors. These tests showed that the genewas capable of conferring broad-range tolerance todifferent classes of PPO inhibitors, although the levelsvaried widely among different compounds (Table I).In the germination assay, tolerance to butafenacil wasat least 100-fold above wild type.
Having validated the transgene in Arabidopsis, avector was constructed to test whether the doublemutated PPO enzyme (Y426M � S305L) could confer
similar herbicide tolerance in maize plants. For maizeexpression, the gene was fused to the maize Ubiq-uitin promoter (Christensen and Quail, 1996) andcloned into the co-integrating transformation vectorpSB12 (Komari et al., 1996) to create pWCO38. Forinitial experiments, the cassette was also cloned intoa pSB12 vector already containing a maize ubiquitin/PMI cassette (Negrotto et al., 2000) to create thevector pWCO39. This vector allowed cotransforma-tion of the validated PMI selectable marker and thePPO expression cassette on a single T-DNA.
The selection initially used for maize transforma-tion was the PMI system (Negrotto et al., 2000). Twodozen pWCO39 maize events were generated by A.tumefaciens-mediated transformation and Man selec-
Figure 2. Tolerance of transgenic Arabidopsis plants. Wild-type(WT, top) and transgenic plants (TP, bottom) were sprayed with 10,100, 500, 1,000, and 5,000 nM butafenacil solutions. Photos weretaken 1 week after the spray.
Table I. Cross-tolerance of transgenic Arabidopsis to PPOherbicides
Background tolerance of wild-type Arabidopsis to butafenacil was�100 nM. The degree of transgenic tolerance was expressed as foldsof background tolerance. A value of �100� indicated good germi-nation on 10 �M butafenacil. Aclonifen as negative control.
tion, with approximately 90% containing the doublemutated gene. Plants from primary events were eval-uated for tolerance to butafenacil by spray applica-tion. Twelve of the events were tolerant to butafe-nacil at a concentration of 1.0 to 2.5 �m, whereas theothers were tolerant to concentrations of 5 to 25 �m.Untransformed control plants exhibited injury at 500nm butafenacil. The herbicide damage was seen ini-tially as localized areas of chlorosis and culminatedin severe necrosis and collapse of the leaves (Fig. 3).
Development of the Mutated PPO as a SelectionMarker in Maize
It was clear that the double mutant was able toconfer tolerance to an entire maize plant. However,the question remained whether the gene/herbicidecombination could be used as a selectable markersystem. It was particularly unclear how effective theherbicide would be on maize callus tissue grown inthe dark because PPO herbicides require light for fullactivity (Sherman et al., 1991). The first step was todetermine the effect of the compound on maize callustissue. Kill curves of wild-type maize callus showedthat increasing butafenacil concentrations reducedthe amount of callus produced, even in the absence oflight. The average of three replicates gave 6.3, 6.2, 5.3,3.6, 2.1, and 2.0 g of wild-type callus, respectively, at0, 5, 50, 250, 500, and 750 nm butafenacil, after 1month of growth on selection medium. Based on thetoxicity of butafenacil on untransformed callus, se-
lection Scheme 1 was designed as follows: 250, 500,and 750 nm for the first, second, and third rounds ofselection, respectively, after initially culturing thecallus on 5 nm for 2 weeks. After 2 weeks on the 5 nmmedium, callus was white to yellowish and appearedhealthy and almost identical to callus lines without 5nm butafenacil, except with slight browning at thesurface contacting medium. Although we did notrefer to this step as the first selection step in theprocess, we believe it did impose selective pressureon the tissue and that it particularly inhibited callusproliferation from the embryo axis side, thus increas-ing the callus proportion from the scutellum. Ourobservation, consistent with the report from Frame etal. (2002), indicated that the scutellum-derived calluswas most likely the producer of transgenic events.
All tissue (embryo and emerging callus) was trans-ferred to the first round of selection. Each round ofselection spanned 2 weeks with all callus being trans-ferred, without any subjective dissection, until eventsemerged. During the initial stage of selection, thecallus turned brown during selection, although therewas some growth at the lower levels. Typically, afterabout 45 d on selection, transformed sectors emergedwith a distinguished phenotype: whitish to yellowishcolor on a brown background (see the emerging cal-lus at the far right of middle row of Fig. 4). Thetransformed sectors were isolated and grown sepa-rately on 750 nm without further browning. Thosetransformants appeared as small (1–2 mm) blondmasses with no browning tissue attached. The calluswas predominately type I callus if A188, A188xHiII,or HiIIxA188 was used. However, if pure HiII wasused for transformation, the predominate callus wastype II. In all genotypes above, the browning oc-curred in all callus lines during the first round ofselection. In contrast, butafenacil only killed the con-
Figure 3. Tolerance of transgenic maize plants. Wild-type maizeplants (left) and transgenic T0 plants (right) were sprayed with a 5 �M
solution of butafenacil. The photo was taken 10 d after spraying.
Figure 4. Transgenic callus emerging from the selection medium.The callus photo was taken 45 d after A. tumefaciens inoculation forexperiment AP89. A transgenic event in the far right side of themiddle row is emerging from the untransformed brown callus lines.The diameter of the Petri dish was 9 cm. IE, Immature embryos.
tacting portion of highly compact Type I callus de-rived from other genotypes we tested. In the laterexample, a more labor-intensive dissection of thesurviving tissue was required. This indicates that theefficacy of butafenacil selection is callus type inde-pendent, although highly compact Type I callus re-quired longer selections (one to two rounds more) athigher concentrations (up to 1,500 nm). The color ofthe PPO-transformed tissue allowed for accurateidentification of events at an early stage. This calluswas allowed to proliferate for an additional 2 to 4weeks before being transferred to regeneration me-dia, at which point no further herbicide selection wasnecessary. On the regeneration media, the callus dif-ferentiated into small plantlets, which were trans-ferred to soil after reaching a height of 3 to 4 inches.The plants were sprayed with butafenacil 1 weekafter transplantation to soil.
Additional work was done to optimize butafenacilconcentrations used for selection. Three selectionschemes were compared in their ability to producetransformants. One-third of the embryos from eachtransformation plate were transferred to one of threemedia containing different amounts of butafenacil.The selection Scheme 1 was as described above. Se-lection Scheme 2 was designed as 500, 750, and 750nm for the three rounds of selection. SelectionScheme 3 was at 750 nm for all three rounds. Becauselight enhances PPO inhibitor activity, all experimentswere kept in the dark during selection. Four replica-tions were done for each scheme with a total of 950embryos. The average transformation frequency (TF)was 14.9%, 16.5%, and 19.2% for selection Schemes 1,2, and 3, respectively. Although transformation vari-ability was high among experiments, the trend in allfour was that the TF tended to be higher with in-creased butafenacil levels (Table II). Maize ear qual-ity, including factors such as uniformity of the size ofimmature embryos, probably contributed to the largedifferences in TF among the four experiments, whichwere initiated during the transition from fall to win-ter. In addition to somewhat higher TF, selectionScheme 3 showed a significant reduction in the totalamount of callus material transferred in each round.This reduction was a result of early death of untrans-formed tissue.
Our normal practice minimized the tissue exposureto light by maintaining all cultures in a darkroomexcept during physical transfer to fresh media. Even
during this subculture process, the plates were keptunder cover. The only time the plates were exposedto light was during transfer in the laminar flow hood.Because PPO inhibitors are more active in the pres-ence of light (Wright et al., 1995), experiments wereperformed to determine the effect of light treatmentson selection. The light treatment was added to theoptimal selection scheme (Scheme 3, describedabove), by exposing cultures to a regular cool-whitefluorescent light at 75 �mol m�2 s�1 for 8 h, 1 d afterthe initial transfer. During the initial 750 nm butafe-nacil selection, exposure of callus material to lightreduced the amount of tissue by 70% and led toincreased TF (Fig. 5). At such light-enhanced strin-gency, only transformed calli continued to prolifer-ate. Therefore, it was not necessary to provide anadditional light treatment for the later transfers. Fur-ther, the time necessary to detect transformationevents decreased from 6 to 8 weeks to about 4 weeks.Increasing the concentration of butafenacil to 1,500
Figure 5. TF under different light treatments. e, TF for three inde-pendent experiments was compared between dark (green) and light(blue) treatments. Cultures were maintained in the growth chamberin the dark at all times except transfers in the hood. For the lighttreatment, the callus was exposed to regular fluorescent light at 75�mol m�2 s�1 for 8 h 1 d after the initial transfer to the fresh mediumfor Scheme 3. The effect of dark and light treatment on TF is notsignificant based on paired Student’s t test (t � 3.941, degrees offreedom �2, P value � 0.0588), maybe due to limited experiments.
Table II. The effect of selection schemes on TF
TF is defined as the percentage of embryos producing events. One-third of cocultivated embryos from each experiment were transferred to oneof three selection media containing different concentrations of butafenacil (nanomolar). All selection steps were kept in the dark. The decreasein TF from Experiments 1 to 4 may be due to inferior embryo quality at the beginning of the winter season. Significant differences are detectedbetween selection schemes 1 and 2, 2 and 3, and 3 and 1 based on paired Student’s t test at P � 0.05.
Selections Experiment 1 Experiment 2 Experiment 3 Experiment 4 Average
nm also resulted in a comparable TF but did notdecrease the amount of time needed to detect trans-genic events.
The Effect of PPO Selection on TransgeneCopy Number
Selection based on herbicide tolerance could poten-tially lead to an increase in gene copy number as aresult of strong selection for high gene expression(Shyr et al., 1992). The stability of transgenes hasbeen shown to be related to the copy number ofinsertions (Sidorenko and Peterson, 2001). Simple in-sertions also facilitate the regulatory approval pro-cess for transgenic products. Thus, it was importantto determine if the PPO selectable marker systemresulted in plants with an increased transgene copynumber. Analysis of PPO events found the majority(71%) to be single-copy events (Table III), similar tothe results seen with PMI selection (70%) when usingthe same transformation method (Ingham et al.,2001).
Further analysis was done for a subset of 46 highlytolerant pWCO38 events (Table III) identified fromabout 2,500 transformants by a greenhouse sprayassay. About 57% of our highly tolerant events had asingle copy of the PPO gene, indicating that multiplecopies were not absolutely required for high toler-ance. Forty-four percent of these highly tolerantevents were found to have multiple copies, in con-trast to 29% of a random pool of transgenic eventsselected by the primary assay at 1 �m butafenacil.This indicates that multiple copies do tend to rendertransgenic plants more tolerant to the herbicide.
Development of Herbicide-Tolerant TransgenicMaize Plants
In addition to developing PPO/butafenacil as aselectable marker system, we also wanted to producemaize plants tolerant to field rates of butafenacil. Dueto the variable tolerance of transgenic events, a two-
step screen was used to identify the most highlytolerant events. Approximately 2,500 transgenic T0events were produced, and eight to 10 plants wereregenerated from each event. This primary screenidentified approximately 100 events that were toler-ant to greater than 50 �m butafenacil. The secondaryscreen, performed on T1 progeny from these events,consisted of a greenhouse screen using field rates ofbutafenacil. This resulted in the identification of 12events with field-effective levels of tolerance. Thoseevents passing the second screen were promoted forfield trials. The results of field trials were correlatedwith the greenhouse results, and several events wereidentified that exhibited acceptable levels of toler-ance (Fig. 6). The combination of the tolerant PPOgenes and the process of using these genes to pro-duce herbicide-tolerant plants was branded as Acu-ron Technology (Holmberg, 2000).
DISCUSSION
Isolation of Herbicide-Tolerant PPO Genes
Complementation of E. coli hemG mutants hasproved to be a routinely successful method for theisolation of eukaryotic PPO genes (Dailey et al., 1995;Nishimura et al., 1995; Narita et al., 1996; Lermon-tova et al., 1997) despite the fact that there is nosequence similarity between the hemG protein(Sasarman et al., 1993) and either plant or mamma-lian PPO enzymes. The ability to complement bacte-ria with plant enzymes also provides a method ofisolating herbicide-tolerant variants of these en-zymes. The PPO inhibitor butafenacil, in contrast tosome other PPO herbicides, appears to have no up-take problems in E. coli. The XL1-Red mutagenesisstrain enabled us to create huge pools of independentmutants with minimal effort, and the advertised1/2,000-bp mutation rate was ideal for the purpose ofmutagenizing a 1.7-kb PPO cDNA. Although transi-tions were strongly favored in our mutant popula-tions, the system generated all possible base changes.Subsequent mutagenesis using other methodology(data not shown) has failed to identify any additionalsingle base changes in the Arabidopsis PPO-1 genethat confer significant herbicide tolerance. With thisconservative method of mutagenesis, the probabilityof picking up amino acid changes requiring multiplebase changes is very low. We have addressed this bysaturation site-directed mutagenesis of identified re-sistance sites and by using other plant PPO cDNAsfor screening. The plant enzymes are quite conservedat the amino acid level, but different codon usagecreates enough sequence diversity (Table IV) togreatly increase the opportunities for identifying re-sistance sites from single base mutations.
There were two primary sources of background inthe mutant screening process. Many plasmid vectorscan mutate easily to give tolerance via higher expres-sion of the PPO gene product. Our choice of the
Table III. Transgene copy no. distribution (percentage of total)a
Category PMIb PPOc HT-PPOd
Total events 287 45 46One copy 201 (70%) 32 (71%) 26 (57%)Two copies 62 (21%) 7.0 (16%) 11 (24%)�Two copies 24 (8.0%) 6.0 (13%) 9.0 (20%)a No. of samples determined to have the indicated copy no.
among total events as determined by TaqMan assay. b PMI datacited from Ingham et al. (2001). c Events containing the pWCO38construct and tolerant to 1 �M butafenacil or above. d Highlytolerant (�25 �M) pWCO38 events identified from approximately2,500 events by greenhouse spray. Oligos used for PPO copy no.assay for all pWCO38 events were AtPPO63F, R, and P, respectively,as forward primer (GGACAGAATTCCGGTGTTTGTAG), reverseprimer (GCACCGCCCGGAAGA), and probe (CCCGCCAATCATGTTCAACAGCAAA).
pMut-1 plasmid as a screening vector greatly re-duced this problem. Despite the fact that SASX38 is ahemG deletion strain, the second problem was muta-tion to resistance by the E. coli strain. We believe thatSASX38 may adapt to the herbicide by overexpress-ing the coproporphyrinogen oxidase (hemF) enzyme,which is involved in the step of the porphyrin path-way immediately before PPO. The ability of this en-zyme to oxidize protoporphyrinogen IX was pub-lished by Narita et al. (1999), and the enzyme wouldbe unaffected by PPO inhibitors. This adaptation ofthe cells to the herbicide poses a particular problemwhen attempting to characterize herbicide-tolerantmutants by traditional growth curves in liquid cul-ture. This is the primary reason for performingscreens and assays of mutants on solid plates, wherethe appearance of an occasional large colony can beignored. A hemF knockout mutant of the SASX38could be constructed and might serve to eliminatethis problem.
PPO as a Selectable Marker
Identification of the PPO mutants has enabled thedevelopment of a new and effective selectablemarker system. Transgenic maize events were easily
detected using the PPO selection system for A. tume-faciens transformation, with the TF being comparablewith that reported for both the phosphinothricinAcetyl transferase (PAT) and PMI systems. For ourinitial experiments, the average TF was 10.4%, 12.2%,and 13.6% for PAT, PMI, and PPO, respectively. TheTF via PMI selection was similar to the earlier phaseof developing A. tumefaciens-mediated transforma-tion by our colleagues (Negrotto et al., 2000).
TF typically has been highly variable for maizetransformation. During their early stages of develop-ment, A. tumefaciens TF with PMI was reported torange from 0.7% to 32% (Negrotto et al., 2000),whereas the frequency with PAT varied from 0% to30.6% (Ishida et al., 1996). This variation has beenattributed to a number of factors that include overallhealth and vigor of donor plants, the quality and sizeof immature embryos, maize genotype, the timelyconduction of experiments, and the consistency ofprepared media. This type of variation can makecomparison of treatments during optimization oftransformation very difficult. To minimize the impactof this variation on the comparisons of the PPO, PAT,and PMI selection systems, our experiments wereconducted with embryos taken from the same earand were replicated over time. The results showed
Figure 6. Corn tolerance under field applicationconditions. Corn plants at the three-leaves stagewere sprayed with butafenacil at 400 g of activeingredient (AI) per hectare (3� effective fieldrate). Photos were taken 8 d after treatment(8DAT). Wild-type (left) versus transgenic (right)plants.
The cDNAs (not including the putative chloroplast transit peptide sequence) were aligned with the maize PPO-1 cDNA using the GAP programdescribed in Devereux et al., 1984. Sequences are described in US patent #5,939,602 (Volrath et al., 1999). Sugarcane, sorghum and ricesequences were only partial cDNAs.
Protoporphyrinogen Oxidase and Maize Transformation
that although the TF varied over time, the generaltrend within a side-by-side experiment was the samefor the three selection systems.
In addition to acceptable TF, the PPO selectionsystem offered other benefits. First, transformantsshowed a unique phenotype that facilitated the iden-tification and subculture of transformed callus tissue.Second, the time for whole callus selection was sig-nificantly reduced. Finally, and most importantly,selection pressure could be easily increased duringthe selection process by exposing the callus to light.An increase of selection stringency could be achievedby increasing light intensity, lengthening light expo-sure, or both. The light treatment resulted in a sig-nificant reduction in the amount of callus tissue pro-duced during selection and in increased TF. Thisincrease may be due to more rapid death of untrans-formed tissues caused by the formation of singletoxygen in the presence of the PPO inhibitor and light(Sherman et al., 1991). The combination of light withthe highly active PPO inhibitor chemistry signifi-cantly reduces the labor-intensive practice of tissuetransfer and the amount of untransformed tissue sur-viving selection. In fact, this PPO selection systemcould potentially provide a system where only asingle plate is required to carry out selection beforeregeneration. Thus, the properties of PPO selectioncome close to fulfilling the requirements of an opti-mal maize selection system: one characterized by ashort selection period and minimal proliferation ofviable callus. Additional flexibility exists because thecross-tolerance of PPO mutants to other compoundsprovides a large palette of potential selection agentsto choose from. Extension to other crops should alsobe possible, although the concentration spectrum fordicot transformation might be more stringent as aresult of increased plant sensitivity.
PPO as a Mechanism for Crop Tolerance
Herbicides targeted to PPO characteristically havea very rapid contact action causing leaf burning,desiccation, and growth inhibition. Inhibition of thenormal enzymatic reaction leads to the accumulationof protoporphyrinogen IX in the chloroplast, whichthen leaks out to the cytoplasm and is oxidized byperoxidases. Exposure to light causes formation ofsinglet oxygen and other oxidative species resultingin membrane disruption and subsequent cell death(Smith et al., 1993). Natural crop tolerance to com-pounds from this class of herbicide is often limitedcompared with other types of herbicides (Gressel,2000; Owen, 2000). Although it is known that thePPO herbicides are more active on broadleaved spe-cies (Witkowski and Halling, 1989), the enzyme tar-get appears to be equally sensitive to the herbicides.To date, natural occurrence of weed tolerance to PPOinhibitors has not been reported, although this typeof herbicide was developed 40 years ago. Our obser-
vation that resistance mutations tend to reduce en-zymatic function may help to explain the lack ofnaturally occurring resistant enzymes.
Multiple chemical families have been classified asPPO inhibitors. These herbicidal compounds includediphenylethers, oxidiazoles, cyclic imides, phenylpyrazoles, pyridine derivatives, and phenopylates.All of these compounds are thought to act as sub-strate analogs; therefore, cross-resistance of muta-tions selected using a given inhibitor is expected. Ourcross-tolerance assays using the SASX38/plant PPOsystem have shown that all of the mutations testedcan confer tolerance to a variety of PPO-inhibitingcompounds, both commercial and experimental(Ward and Volrath, 1998). An Arabidopsis germina-tion assay also showed the cross-tolerance of mutantPPO transgenic plants to various commercial PPOinhibitors such as acifluorfen, fomesafen, fluorogly-cofen, bifenox, oxyfluorfen, lactofen, fluthiacet-methyl, sulfentrazone, and flupropazil (Table I). Sim-ilar tests were conducted for transgenic corn, andwide cross-tolerance was also observed (data notshown). Multiple mutations, individually or in com-bination, can confer tolerance to a wide range ofinhibitors. Therefore, Acuron technology is not de-pendent on any single herbicide or any single mutantPPO gene. In our work, we have concentrated onbutafenacil as a selection agent with mutant PPOgenes. We expect that other compounds could workeither as selective agents or as PPO-inhibitory herbi-cides for the field application to transgenic corn lines,although further optimization may be required forany particular compound (Theodoridis et al., 2000).
Acuron technology could be useful in the develop-ment of a variety of PPO herbicide-tolerant crops. Wehave isolated complete PPO-1 cDNA sequences frommaize, wheat, sugar beet, cotton, and soybean. TableIV shows the significant homology of the maize PPOcDNA to other species. Corresponding herbicide-tolerant mutants for many of these cDNAs have beendescribed (Volrath et al., 1999; de Marco et al., 2000).We have tested many mutations isolated in one geneat the homologous position in other genes. Althoughmost mutations occur at sites where gene homologyis very high, a given mutation frequently does notbehave identically when inserted into a differentplant enzyme. The strong correlation of resistant mu-tations with compromised enzyme activity tends tomake many mutation/gene combinations poor can-didates for engineering crop tolerance. Fortunately,the availability of multiple resistance mutations andmultiple plant PPO genes should serve to easily over-come this potential limitation on the use of this tech-nology. Although PPO is an efficient selectablemarker, the frequency of transgenic plants with fieldlevel tolerance was low. This issue could be ad-dressed by further optimization of transgene expres-sion, such as by alteration of the Arabidopsis doublemutant gene to maize codon usage.
An Arabidopsis (Landsberg) cDNA library in the plasmid vector pFL61(Minet et al., 1992) was kindly supplied by Dr. Michele Minet (Centre deGenetique Moleculaire, Gif sur Yvette, France) and amplified as colonies onsolid media to maximize clone representation. A second Arabidopsis (Co-lumbia) cDNA library in the Lambda UniZap vector was purchased fromStratagene (La Jolla, CA) and amplified as pBluescript plasmids by mass invivo excision of the phage library according to the manual. The Escherichiacoli hemG mutant SASX38 (Sasarman et al., 1979) was kindly provided by Dr.Alex Sasarman (Department of Microbiology and Immunology, Universitede Montreal, Quebec, Canada) and maintained on Luria-Bertani mediacontaining 20 �g mL�1 hematin (United States Biochemicals, USB Corpo-ration, Cleveland OH). Plasmid libraries were transformed into SASX38 byelectroporation. Electrocompetent cells were prepared according to theGene Pulser (Bio-Rad Laboratories, Hercules, CA) manual with the additionof 20 �g mL�1 hematin to all solutions, including storage buffer. Trans-formed cells were plated on L agar containing 100 �g mL�1 ampicillin at adensity of approximately 500,000 transformants per 10-cm plate. The cellswere incubated at 37°C for 40 h in low light and selected for the ability togrow without the addition of exogenous heme. Plasmid DNA was isolatedfrom heme prototrophs and transformed back into SASX38 to verify comple-mentation before sequence analysis.
The Arabidopsis PPO-1 clone initially chosen for mutagenesis was des-ignated SLV17. This truncated PPO gene was inserted in reverse orientationin the pFL61 vector (relative to the yeast [Saccharomyces cerevisiae] PGKpromoter). Translation of PPO-1 apparently initiates at an ATG within theyeast PGK terminator to create a fusion protein. The coding sequence afterthe first round of mutagenesis/screening contained two changes, a silentAGT (Ser) to AGC (Ser) change at amino acid 343 and an ACG (Thr) to AAG(Lys) change at amino acid 56, which leads to higher enzyme activity and/orexpression. An example of the pMut-1 construct, containing the Tyr-426-Cysresistance mutation, was deposited with the Agricultural Research Center,Patent Culture Collection, Northern Regional Research Center (NRRL; Pe-oria, IL) on November 14, 1994 as pWDC-7 with the deposit designationNRRL 21339N.
PPO plasmids were transformed into the E. coli strain XL1-Red (Strat-agene) for random in vivo mutagenesis during growth. Plasmid DNA wasextracted from XL1-Red colonies that had been incubated on plates at highdensity (100,000 colony forming units [cfu] per 15-cm plate) for approxi-mately 24 h. The mutated DNA was electroporated into SASX38. Thetransformations were grown out in Luria-Bertani broth (no hematin) for 1 hand then plated onto L media containing sufficient PPO-inhibiting herbicideto completely kill cells containing the wild-type pMut-1 clone. Plates wereincubated at 37°C for up to 48 h in low light. Plasmid DNA was isolatedfrom colonies that grew on herbicide, transformed back into SASX38, andscreened to verify that the resistance was plasmid borne before sequenceanalysis. Subsequent rounds of selection on existing mutants were per-formed identically, using herbicide concentrations sufficient to completelyinhibit the original mutant. In vitro mutagenesis to create site-specificchanges was carried out using the Quik-Change kit (Stratagene). All mu-tants and mutant combinations were characterized by screening on solidmedia. Isolated clones were transformed into SASX38 and plated at medi-um/high density (several thousand cfu per 10-cm plate) in the presence andabsence of herbicide. Plates were scored visually for the appearance ofcolonies/lawns over a period of 6 to 48 h post-plating.
Arabidopsis Transformation and Characterization
The protocols for transformation and plant manipulation for Arabidopsisare described by Molina et al. (1999) and Hanin et al. (2001). To isolate thenative PPO promoter, the Arabidopsis PPO-1 cDNA was used to probe anArabidopsis (Columbia, whole plant) Lambda Zap II genomic library pur-chased from Stratagene. Details are described by Johnson et al. (2000). Oneclone, ArabPT1Pro, was determined to contain 580 bp of Arabidopsis se-quence upstream from the initiating Met (ATG) of the PPO-1 coding se-quence in addition to coding sequence (plus introns) extending to bp 1,241of the cDNA. This pBluescript clone was excised from the lambda vectorand was deposited with the NRRL (see above) as pWDC-11, NRRL B-21515.
A full length cDNA of the wild-type Arabidopsis PPO-1 gene was iso-lated by complementation from the UniZap lambda library described above.
This pBluescript clone was subjected to site-directed mutagenesis using theQuik-Change kit (Stratagene) to create mutant PPO genes. An EcoRI-XhoIpartial digest fragment was excised from this construct and ligated into theplant expression vector pCGN1761ENX (see Example 9 of InternationalApplication No. PCT/IB95/00452 filed June 8, 1995 and published Dec. 21,1995 as WO 95/34659). This plasmid was digested with NcoI and BamHI toproduce a fragment comprised of the complete PPO-1 cDNA plus a tran-scription terminator from the 3�-untranslated sequence of the tml gene ofAgrobacterium tumefaciens. The AraPT1Pro plasmid was digested with NcoIand BamHI to produce a fragment comprised of pBluescript and the 580-bpputative Arabidopsis PPO-1 promoter. Ligation of these two fragmentsproduced a fusion of a full-length altered PPO cDNA to the native promoter.The expression cassette containing the PPO-1 promoter/mutant PPO/tmlterminator fusion was excised by digestion with KpnI and cloned into abinary T-DNA vector that also contained a nos/kanamycin plant selectablemarker. The binary plasmid was transformed by electroporation into A.tumefaciens and then into Arabidopsis using vacuum infiltration as in Bech-told and Pelletier, 1998. Transformants expressing altered PPO genes couldbe selected either on kanamycin or on various concentrations of PPO-inhibiting herbicide or on both. For butafenacil, background tolerance ofwild-type Arabidopsis was �100 nm. The degree of transgenic tolerance wasexpressed as folds of background tolerance. A value of �100� indicatedgood germination on 10 �m butafenacil.
Maize (Zea mays) Transformation and Selection
A. tumefaciens strain LBA4404 (pAL4404, pSBI) was used for maize trans-formation and selection development. Detailed information about the dis-armed helper plasmid and the virulence region is described by Ishida et al.(1996) and Negrotto et al. (2000). The cointegrate vector pSB12 is describedby Komari et al. (1996). Plasmid constructs pWCO38 and pWCO39 wereused in experiments reported in this paper. Plasmid WCO38 consisted of acassette containing the Arabidopsis mutant PPO gene, Y426M � S305L,flanked by the maize ubiquitin promoter (Christensen et al., 1996) and the35S terminator, and cloned into the HindIII site of vector pSB12. PlasmidpWCO39 has the same PPO cassette adjacent to a maize ubiquitin/PMI/noscassette (Wright et al., 2001) between the same T-DNA borders in vectorpSB12.
A. tumefaciens strains were plated from glycerol stocks onto YPC/Spec100/Tet10 plates (5.0 g L�1 yeast extract, 10.0 g L�1 peptone, 5.0 g L�1
NaCl, 1.0 g L�1 CaCl2, 15.0 g L�1 bactoagar, 100 mg L�1 spectinomycin, and10 mg L�1 tetracycline [ pH 6.8]) 1–2 d before the experiment. Plates wereincubated at 28°C. A. tumefaciens suspensions were made by adding 1 loopof bacteria mL�1 LSinf�As (see below) liquid. The suspension was dilutedto an optical density of 0.5 to 1.0 � 109 cfu mL�1.
For maize transformation, genotypes A188, Hi-II and the crosses (A188 �Hi-II and Hi-II � A188) were used as starting material. Dr. Ronald Phillipsand the National Institute of Agribiological Resource of Japan (Tsukuba305–8602) kindly provided the A188 material. Hi-II and its parental lines(Hi-II Parent A and B, Armstrong et al., 1991) were obtained from the MaizeGenetics Cooperation Stock Center (Urbana, IL). Plants were grown in agreenhouse, and ears were pollinated several days after silks had emerged.Eight to 10 d after pollination, the ears were picked, dehusked, placed in a20% (v/v) commercial bleach, and shaken at 150 rpm for 15 min on a VWRorbital shaker. Ears were then rinsed in 6 volumes of sterile water. Immatureembryos (0.5–1.5 mm) were aseptically isolated from the ears.
Immature embryos were placed in LSinf�As (Linsmaier and Skoog, 1965;Linsmaier and Skoog [LS] major salts, LS minor salts, 0.5 mg L�1 nicotinicacid, 0.5 mg L�1 pyridoxine HCl, 1.0 mg L�1 thiamine HCl, 100 mg L�1
myo-inositol, 1.0 g L�1 casamino acids [Difco Bacto 0230-01, DIFCO Labo-ratories, Detroit], 1.5 mg L�1 2,4-dichlorophenoxyacetic acid, 68.5 g L�1 Suc,36.0 g L�1 Glc [pH 5.2], and 100 �m acetosyringone) liquid in microfugetubes (see Ishida et al., 1996; Negrotto et al., 2000). Embryos were vortexedfor 10 s, followed by removal of the LSinf�As liquid with a sterile thin-tippipette. The A. tumefaciens suspension was added. Embryos were vortexedfor 30 s and allowed to stand for 5 min. Microfuge tubes were shaken tosuspend the embryos, and the contents were decanted onto LSAs plates (LSmajor salts, LS minor salts, 0.5 mg L�1 nicotinic acid, 0.5 mg L�1 pyridoxineHCl, 1.0 mg L�1 thiamine HCl, 100 mg L�1 myo-inositol, 700 mg L�1 l-Pro,1.5 mg L�1 2,4-dichlorophenoxyacetic acid, 20.0 g L�1 Suc, 10.0 g L�1 Glc,500 mg L�1 MES, 100 �m acetosyringone [pH 5.8], and 8 g L�1 purified agar[Sigma, St. Louis]). Excess liquid was removed with a sterile pipette. Plates
Protoporphyrinogen Oxidase and Maize Transformation
were allowed to dry in a laminar flow hood for 15 to 20 min. All embryoswere oriented so that the embryo axis contacted the media. Immatureembryos were cultured in the dark for 2 to 3 d at room temperature(22°C–23°C).
Regeneration and Analysis of Maize Transformants
After cocultivation, embryos were transferred to LS5Dc media containing5 nm butafenacil and incubated for 2 weeks. LS5Dc contains LS majorsalts, LS minor salts, 700 mg L�1 Pro, 20 g L�1 Suc, 500 mg L�1 MES, 5mg L�1 dicamba, 0.5 mg L�1 nicotinic acid, 0.5 mg L�1 pyridoxine HCl, 1.0 mgL�1 thiamine HCl, 100 mg L�1 myo-inositol, 100 mg L�1 carbenicillin, 1 mg L�1
AgNO3, and 8 g L�1 purified agar (pH 5.8; Ishida et al., 1996; see Negrotto etal., 2000).
For this herbicide selection, butafenacil was always added to mediumpost-autoclave. Three schemes were designed for butafenacil selection. Eachscheme consisted of three rounds of selections. Each round spanned 2weeks. These schemes were 250-500-750 nm for Scheme 1, 500-500-750 nmfor Scheme 2, and 750-750-750 nm for Scheme 3. After 6 weeks on selection,subcultures onto 750 nm were done every 2 weeks until events were largeenough to be transferred onto regeneration media. Most of the events wereidentified between 6 and 10 weeks. Optionally, a light treatment at anintensity of 75 �mol m�2 s�1 for 8 h was applied 1 d after the initial transferto the fresh medium for Scheme 3. The selection time was reduced to 4weeks because a light treatment allowed quicker identification of transfor-mants and less growth of untransformed tissues due to increased potency ofPPO herbicides.
For shoot regeneration, Type I and/or Type II callus tissue was trans-ferred to LS3S.AK�50 nm butafenacil (LS major salts, LS minor salts, 30 gL�1 Suc, 0.5 mg L�1 Ancimidol [Se-Pro Corporation, Carmel, IN], 1 mg L�1
Kinetin, 50 nm butafenacil, and 2.4 g L�1 Gelrite [pH 5.8]) and placed in thedark for 2 weeks. Callus was then transferred to LS3S.AK without butafe-nacil and placed in the light for about 2 weeks. Plantlets were transferred toLS3S (LS major salts, LS minor salts, 30 g L�1 Suc, and 6.0 g L�1 phytagar[pH 5.8]) to allow for better root formation and plant growth (Wright et al.,2001). After 1 to 2 weeks, plants were transferred to soil and placed in thegreenhouse for the butafenacil spray assay and seed production. TF wasdefined as the percentage of immature embryos producing transgenicevents (see Table II and Fig. 5). Usually, only one event was picked from oneembryo-derived callus line even if there appeared to be multiple events. Fortransgene copy number determination, the Taqman assay was as describedby our colleagues Ingham et al. (2001).
Greenhouse Spray Assays and TolerantPlant Production
For greenhouse testing, butafenacil was diluted into sterile water, and thesurfactant Silwet was added to 0.01% (v/v). Greenhouse sprays were doneusing Preval Sprayers (Precision Valve Corporation, Yonkers, NY). Themore stringent spray was done at 50 or 100 �m. For tolerant event produc-tion, only events that were completely undamaged at 50 �m or higher weresaved and transferred to the greenhouse to produce seeds. In many cases,the plants could be successfully self-fertilized; events were also recoveredby outcross or backcross.
ACKNOWLEDGMENTS
We thank many Syngenta colleagues for assistance during the course ofthese experiments. Particularly, we thank David Negrotto, Erik Dunder,John Dawson, Janet Suttie, and Allan Wenck for sharing their expertise inmaize transformation; Chong Vang, Jacqueline Holmann, Olguitza Guzman,Cathy Tomanny, and Bernadette Cooney for tissue culture work; the plantanalysis group, the media lab, and the greenhouse staff for their services;and the Crop Protection Sector and Seeds Sector (Moez Meghji and RakeshJain) for chemical sprays and field trials.
Received May 15, 2003; returned for revision July 1, 2003; accepted July 19,2003.
LITERATURE CITED
Armstrong CL, Green CE, Phillips RL (1991) Development and availabilityof germplasm with high Type II culture formation response. Maize GenetCoop Newslett 65: 92–93
Armstrong CL (1999) The first decade of maize transformation: a review andfuture perspective. Maydica 44: 101–109
Bechtold N, Pelletier G (1998) In planta Agrobacterium-mediated transfor-mation of adult Arabidopsis thaliana plants by vacuum infiltration. Meth-ods Mol Biol 82: 259–266
Che F, Watanabe N, Iwano M, Inokuchi H, Takayama S, Yoshida S, IsogaiAK (2000) Molecular characterization and subcellular localization ofprotoporphyrinogen oxidase in spinach chloroplasts. Plant Physiol 124:59–70
Dailey TA, Dailey HA, Meissner P, Prasad ARK (1995) Cloning, sequence,and expression of mouse protoporphyrinogen oxidase. Arch BiochemBiophys 324: 379–384
Dailey TA, Meissner P, Dailey HA (1994) Expression of a cloned protopor-phyrinogen oxidase. J Biol Chem 269: 813–815
de Marco A, Volrath S, Bruyere T, Law M, Fonne-Pfister (2000) Recombi-nant maize protoporphyrinogen IX oxidase expressed in Escherichia coliforms complexes with GroEL and DnaK chaperones. Protein Expr Purif20: 81–86
Devereux J, Haeberli P, Smithies O (1984) A comprehensive set of sequenceanalysis programs for the VAX. Nucleic Acids Res 12: 387–395
Frame BR, Shou H, Chikwamba RK, Zhang Z, Xiang C, Fonger TM, PeggSE, Li B, Nettleton DS, Pei D et al. (2002) Agrobacterium tumefaciens-mediated transformation of maize embryos using a standard binaryvector system. Plant Physiol 129: 13–22
Fromm ME, Morrish F, Armstrong C, Williams R, Thomas J, Klein TM(1990) Inheritance and expression of chimeric genes in the progeny oftransgenic maize plants. Biotechnology 8: 833–839
Fromm ME, Taylor LP, Walbot V (1986) Stable transformation of maizeafter gene transfer by electroporation. Nature 319: 791–793
Gordon-Kamm WJ, Spencer TM, Mangano ML, Adams TR, Daines RJ,Start WG, O’Brien JV, Chambers SA, Adams Jr WR, Willetts NG et al.(1990) Transformation of maize cells and regeneration of fertile trans-genic plants. Plant Cell 2: 603–618
Greener A, Callahan M (1994) XL1-Red: a highly efficient random mutagen-esis strain. Strategies 7: 32–34
Gressel J (2000) Molecular biology of weed control. Transgenic Res 9:355–382
Hanin M, Volrath S, Bogucki A, Briker M, Ward E, Paszkowski J (2001)Gene targeting in Arabidopsis. Plant J 28: 671–677
Holmberg M (2000) A fine line. Successful Farming 3: 25–26Ingham DJ, Beer S, Money S, Hansen G (2001) Quantitative real-time PCR
assay for determining transgene copy number in transformed plants.Biotechniques 31: 132–140
Ishida Y, Saito H, Ohta S, Hiei Y, Komari T, Kumashiro T (1996) Highefficiency transformation of maize (Zea mays L.) mediated by Agrobacte-rium tumefaciens. Nat Biotechnol 14: 745–750
Jacobs JM, Jacobs NJ, Sherman TD, Duke SO (1991) Effect of diphenylether herbicide on oxidation of protoporphyrinogen to protoporphyrin inorganellar and plasma membrane enriched fractions of barley. PlantPhysiol 97: 197–203
Joersbo M, Donaldson I, Kreiberg J, Peterson S, Brunstedt J, Okkels F(1998) Analysis of mannose selection used for transformation of sugarbeet. Mol Breed 4: 111–117
Joersbo M (2001) Advances in the selection of transgenic plants usingnon-antibiotic marker genes. Physiol Plant 111: 269–272
Johnson MA, Volrath SL, Ward ER, inventors. January 25, 2000. Promotersfrom plant protoporphyrinogen oxidase genes. U.S. Patent ApplicationNo. 6,018,105
Klein TM, Fromm M, Weissinger A, Tomes D, Schaaf S, Sletten M,Sanford JC (1988a) Transfer of foreign genes into intact maize cells withhigh-velocity microprojectiles. Proc Natl Acad Sci USA 85: 4305–4309
Klein TM, Gradziel T, Fromm ME, Sanford JC (1988b) Factors influencinggene delivery into Zea mays cells by high-velocity microprojectiles. Bio/Technology 6: 559–563
Klein TM, Kornstein L, Sanford JC, Fromm ME (1989) Genetic transfor-mation of maize cells by particle bombardment. Plant Physiol 91: 440–444
Komari T, Hiei Y, Saito Y, Murai N, Kumashiro T (1996) Vectors carryingtwo separate T-DNAs for co-transformation of higher plants mediated byAgrobacterium tumefaciens and segregation of transformants free fromselection markers. Plant J 10:165–74
Lee HJ, Duke MV, Duke SO (1993) Cellular localization ofprotoporphyrinogen-oxidizing activities of etiolated barley (Hordeum vul-gare L.) leaves (Relationship to mechanism of action of protoporphyrino-gen oxidase-inhibiting herbicides). Plant Physiol 102: 881–889
Lee HJ, Lee SB, Chung JS, Han SU, Han O, Guh JO, Jeon JS, An G, BackK (2000) Transgenic rice plants expressing a Bacillus subtilis protoporphy-rinogen oxidase gene are resistant to diphenyl ether herbicide oxyfluor-fen. Plant Cell Physiol 41: 743–749
Lermontova I, Grimm B (2000) Overexpression of plastidic protoporphy-rinogen IX oxidase leads to resistance to the diphenyl-ether herbicideacifluorfen. Plant Physiol 122: 75–83
Lermontova I, Kruse E, Mock HP, Grimm B (1997) Cloning and character-ization of a plastidal and a mitochondrial isoform of tobacco protopor-phyrinogen IX oxidase. Proc Natl Acad Sci USA 94: 8895–8900
Lyznik LA, Ryan RD, Ritchie SW, Hodges TK (1989) Stable co-transformation of maize protoplasts with gusA and neo genes. Plant MolBiol 13: 151–161
Miller M, Tagliani L, Wang N, Berka B, Bidney D, Zhao ZY (2002) Highefficiency transgene segregation in co-transformed maize plants using anAgrobacterium tumefaciens 2 T-DNA binary system. Transgenic Res 11:381–396
Minet M, Dufour ME, Lacroute F (1992) Complementation of Saccharomycescerevisiae auxotrophic mutants by Arabidopsis thaliana cDNAs. Plant J 2:417–422
Molina A, Volrath S, Guyer D, Maleck K, Ryals J, Ward E (1999) Inhibitionof protoporphyrinogen oxidase expression in Arabidopsis causes a lesion-mimic phenotype that induces systemic acquired resistance. Plant J 17:667–678
Nandihalli UB, Duke SO (1993) The porphyrin pathway as a herbicidetarget site. In SO Duke, JJ Menn, JR Plimmer, eds, Pest Control withEnhanced Environmental Safety: American Chemical Society SymposiumSeries 524. American Chemical Society, Washington DC, pp 62–78
Narita S, Taketani S, Inokuchi H (1999) Oxidation of protoporphyrinogenIX in Escherichia coli is mediated by the aerobic coproporphyrinogenoxidase. Mol Gen Genet 261: 1012–1020
Narita S, Tanaka R, Ito T, Okada K, Taketani S, Inokuchi H (1996)Molecular cloning and characterization of a cDNA that encodes proto-porphyrinogen oxidase of Arabidopsis thaliana. Gene, 182: 169–175
Negrotto D, Jolley M, Beer S, Wenck AR, Hansen G (2000) The use ofphosphomannose-isomerase as a selectable marker to recover transgenicmaize plants (Zea mays L.) via Agrobacterium transformation. Plant CellRep 19: 798–803
Nishimura K, Taketani S, Inokuchi H (1995) Cloning of a human cDNA forprotoporphyrinogen oxidase by complementation in vivo of a hemG mu-tant of Escherichia coli. J Biol Chem 270: 8076–8080
Owen MK (2000) Current use of transgenic herbicide-resistant soybean andcorn in the USA. Crop Protect 19: 765–771
Randolph-Anderson BL, Sato R, Johnson AM, Harris EH, Hauser CR,Oeda K, Ishige F, Nishio S, Gillham NW, Boynton E (1998) Isolation andcharacterization of a mutant protoporphyrinogen oxidase gene fromChlamydomonas reinhardtii conferring resistance to porphyric herbicides.Plant Mol Biol 38: 839–859
Register JC, Peterson DJ, Bell PJ, Bullock WP, Evans IJ, Frame B, Green-land AJ, Higgs NS, Jepson I, Jiao S (1994) Structure and function ofselectable and non-selectable transgenes in maize after introduction byparticle bombardment. Plant Mol Biol 25: 951–961
Rhodes CA, Pierce DA, Mettler IJ, Mascarenhas D, Detmer JJ (1988)Genetically transformed maize plants from protoplasts. Science 240:204–207
Sasarman A, Chartrand P, Lavoie M, Tardif D, Proschek R, Lapointe C(1979) Mapping of a new heme gene in Escherichia coli K12. J GenMicrobiol 113: 297–303
Sasarman A, Letowski J, Czaika G, Ramirez V, Nead MA, Jacobs JM,Morais R (1993) Nucleotide sequence of the hemG gene involved in theprotoporphyrinogen oxidase activity of Escherichia coli K12 Can J Micro-biol 39: 1155–1161
Sidorenko LV, Peterson T (2001) Transgene-induced silencing identifiessequences involved in the establishment of paramutation of the maize P1gene. Plant Cell 13: 319–335
Sherman TD, Becerril JM, Matsmoto H, Duke MV, Jacobs JM, Jacobs NJ,Duke SO (1991) Physiological basis for differential sensitivities of plantspecies to protoporphyrinogen oxidase inhibitory herbicides. PlantPhysiol 97: 280–287
Shyr YYJ, Hepburn AG, Windholm JM (1992) Glyphosate selected ampli-fication of the 5-enolpyruvylshikimate-3-phosphate synthase gene in cul-tured carrot cells. Mol Gen Genet 232: 377–382
Smith AG, Marsh O, Elder GH (1993) Investigation of the subcellularlocation of the tetrapyrrole-biosynthesis enzyme coproporphyrinogenoxidase in higher plants. Biochem J 292: 503–508
Tomlin C (2000) The Pesticide Manual, Ed 12. The British Crop ProtectionCouncil, Alton, Hampshire, GU34, 2QD, UK
Volrath SL, Johnson MA, Potter SL, Ward ER, Heifetz PB, inventors.February 8, 2000. DNA molecules encoding plant protoporphyrinogenoxidase. U.S. Patent Application No. 6,023,012
Volrath SL, Johnson MA, Ward ER, Heifetz PB, inventors. August 17, 1999.DNA molecules encoding plant protoporphyrinogen oxidase andinhibitor-resistant mutants thereof. U.S. Patent Application No. 5,939,602
Walters DA, Vetsch CS, Potts DE, Lundquist RC (1992) Transformationand inheritance of a hygromycin phosphotransferase gene in maizeplants. Plant Mol Biol 18: 189–200
Wang AS, Evans RA, Altendorf PR, Hanten JA, Doyle MC, Rosichan JL(2000) A mannose selection system for production of fertile transgenicmaize plants from protoplasts. Plant Cell Rep 19: 654–660
Warabi E, Usui K, Tanaka Y, Matsumoto H (2001) Resistance of a soybeancell line to oxyfluorfen by overproduction of mitochondrial protoporphy-rinogen oxidase. Pest Manag Sci 57: 743–748
Ward ER, Volrath SL, inventors. June 16, 1998. Manipulation of protopor-phyrinogen oxidase enzyme activity in eukaryotic organisms. U.S. PatentApplication No. 5,767,373
Watanabe N, Che F, Iwano M, Takayama S, Nakano T, Yoshida S, IsogaiA (1998) Molecular characterization of photomixotrophic tobacco cellsresistant to protoporphyrinogen oxidase-inhibiting herbicides. PlantPhysiol 118: 751–758
Watanabe N, Takayama S, Yoshida S, Isogai A, Che FS (2002) Resistance toprotoporphyrinogen oxidase-inhibiting compound S23142 from overpro-duction of mitochondrial protoporphyrinogen oxidase by gene amplifi-cation in photomixotrophic tobacco cells. Biosci Biotechnol Biochem 66:1799–1805
Witkowski DA, Halling BP (1989) Inhibition of plant protoporphyrinogenoxidase by the herbicide acifluorfen-methyl. Plant Physiol 90: 1239–1242
Wright M, Dawson J, Dunder E, Suttie J, Reed J, Kramer C, Chang Y,Novitzky R, Wang H, Artim-Moore L (2001) Efficient biolistic transfor-mation of maize (Zea mays L.) and wheat (Triticum aestivum L.) using thephosphomannose isomerase gene, pmi, as the selectable marker. PlantCell Rep 20: 429–436
Wright TR, Fuerst EP, Ogg AG, Handihall UB, Lee HJ (1995) Herbicideactivity of UCC-C4243 and acifluorfen is due to inhibition of protopor-phyrinogen oxidase. Weed Sci 43: 47–54
Protoporphyrinogen Oxidase and Maize Transformation
