Expression and Characterization of the ExtracellularCa2�-Sensing Receptor in Melanotrope Cells ofXenopus laevis
M. J. J. VAN DEN HURK, D. T. W. M. OUWENS, W. J. J. M. SCHEENEN, V. LIMBURG,H. GELLEKINK, M. BAI, E. W. ROUBOS, AND B. G. JENKS
Department of Cellular Animal Physiology (M.J.J.V.D.H., D.T.W.M.O., W.J.J.M.S., V.L., H.G., E.W.R., B.G.J.), Institute ofCellular Signalling, Nijmegen Institute for Neurosciences, University of Nijmegen, 6525 ED Nijmegen, The Netherlands;and Endocrine-Hypertension Division (M.B.), Brigham and Women’s Hospital, Boston, Massachusetts 02115
The extracellular Ca2�-sensing receptor (CaR) is expressed inmany different organs in various species, ranging from mam-mals to fish. In some of these organs, this G protein-coupledreceptor is involved in the control of systemic Ca2� homeosta-sis, whereas in other organs its role is unclear (e.g. in thepituitary gland). We have characterized the CaR in the neu-roendocrine melanotrope cell of the intermediate pituitarylobe of the South African clawed toad Xenopus laevis. First,the presence of CaR mRNA was demonstrated by RT-PCR andin situ hybridization. Then it was shown that activation of theCaR by an elevated extracellular Ca2� concentration and dif-
ferent CaR-activators, including L-phenylalanine and sperm-ine, stimulates both Ca2� oscillations and secretion from themelanotrope. Furthermore, it was revealed that activation ofthe receptor stimulates Ca2� oscillations through opening ofvoltage-operated Ca2� channels in the plasma membraneof the melanotropes. Finally, it was shown that the CaR acti-vator L-phenylalanine could induce the biosynthesis of pro-opiomelanocortin in the intermediate lobe. Thus, in this studyit is demonstrated that the CaR is present and functional in adefined cell type of the pituitary gland, the amphibian mela-notrope cell. (Endocrinology 144: 2524–2533, 2003)
THE EXTRACELLULAR Ca2�-SENSING receptor (CaR)is a G protein-coupled receptor, originally cloned from
bovine parathyroid cells (1), which plays an important rolein the maintenance of the systemic Ca2� homeostasis.Through this receptor the extracellular Ca2� concentration([Ca2�]e) can act as an extracellular first messenger that con-trols target organs that are involved in regulation of the[Ca2�]e, such as the parathyroid, thyroid, kidney, skeleton,and intestine (2). Interestingly, the CaR is also expressed incells that do not have well established roles in the control ofthe [Ca2�]e, such as cells of the pancreas, lens, brain, andpituitary gland (2). In many of these cell types, the physi-ological role of the CaR is unclear. In the adult rat, the CaRis present in numerous regions of the brain at variousdegrees of expression (3–5). The highest expression levelsare found in the subfornical organ, olfactory bulb, hippo-campus, hypothalamus, and cerebellum (4). Brain expres-sion of the CaR is not restricted to neurons because thereceptor also occurs in oligodendrocytes, microglia, andastrocytes (6 – 8).
In the pituitary gland, expression of the CaR has beenshown in nerve terminals of the pars nervosa (PN; Ref. 3),unidentified cells of the pars distalis (5, 9), and pituitary
tumor cell lines such as murine ACTH-secreting AtT-20 cellsand human GH-secreting pituitary adenomas (10–12). Re-cently it was reported that elevated [Ca2�]e has cell-specificeffects on intracellular Ca2� levels and hormone secretion insomatotropes, lactotropes, and gonadotropes (13), butwhether these effects are due to activation of the CaR isunclear. Thus, a definite identification and functional char-acterization of the CaR in an identified pituitary cell type hasnot yet been accomplished.
To investigate the presence and functioning of the CaR ina specific cell type of the pituitary gland, we studied themelanotrope cell of the pituitary pars intermedia of the SouthAfrican clawed toad Xenopus laevis. Xenopus melanotropesproduce and release �-melanophore-stimulating hormone(�-MSH), which enables this amphibian to adapt its skincolor to the gray intensity of its background (for review, see14). The secretion of �-MSH is driven by spontaneouslyoccurring Ca2� oscillations, which are generated at theplasma membrane by opening of voltage-operated Ca2�
channels (15, 16). Secretion from this neuroendocrine trans-ducer cell is regulated by various factors, both neuropeptidesand classical neurotransmitters (14). In addition, we foundthat the secretory activity of the melanotrope cell is partic-ularly sensitive to the concentration of extracellular Ca2�, anobservation that prompted us to examine whether the cellpossesses the CaR. In the present study, we first establishedwith RT-PCR, using primers designed on the Xenopus CaRgene sequence (M. Bai, unpublished observations), that cellsof the Xenopus neurointermediate lobe express the CaR. Us-ing in situ hybridization, we further showed that this ex-pression occurs in intermediate lobe melanotropes. Finally,
the actions of this receptor on Ca2� signaling dynamics andbiosynthetic and secretory processes in this cell were studied.
Materials and MethodsAnimals
Young adult (aged 6 months) X. laevis were bred and reared understandard conditions in the aquatic facility of our Department of AnimalPhysiology, University of Nijmegen. Before the experiments, the animalswere adapted to a white or black background for 3 wk, under constantillumination, at 22 C. All experiments were carried out under the guide-lines of the Dutch law concerning animal welfare.
RNA extraction and cDNA synthesis
Freshly dissected neurointermediate lobes (NILs) and pars distalis(PD) of the pituitary gland were individually collected in 500 �l ice-coldTrizol (Life Technologies, Inc., Paisley, UK) and homogenized by soni-fication. After chloroform extraction and isopropyl alcohol precipitation,RNA was dissolved in 30 �l RNase-free H2O. Total RNA was measuredwith a biophotometer (Vaudaux-Eppendorf AG, Basel, Switzerland).First-strand cDNA synthesis was performed with 1 �g RNA and 5mU/�l random primers (Roche, Mannheim, Germany) at 70 C for 10min, followed by double-strand synthesis in strand buffer (Life Tech-nologies, Inc.) with 10 mm dithiothreitol, 20 U Rnasin (Promega Corp.,Madison, WI), 0.5 mm deoxynucleotide triphosphates (dNTPs; Roche),and 100 U Superscript II reverse transcriptase (Life Technologies, Inc.)at 37 C for 75 min and 95 C for 10 min.
PCR
PCR was performed in a total volume of 25 �l in a buffer solutioncontaining 5 �l template cDNA, 3 mm MgCl2, 0.625 U FastStart Taq DNApolymerase (Roche), 0.25 mm dNTPs (Roche), and 0.3 mm of eachprimer. Primers for the CaR were designed on the basis of the X. laevissequence (Bai, M., unpublished observations). The following primer pair(Biolegio, Malden, The Netherlands) was used: forward primer 5�-AGAGCTCAGAAGAAGGGAGA-�3, reverse primer 5�-TTAG-GAGTCGGCTTGATGAG-�3 (product size: 450 bp). The optimum tem-perature cycling protocol was determined to be 95 C for 10 min followedby 40 reaction cycles of 95 C for 30 sec, 58 C for 30 sec, and 72 C for 2min, using a programmable thermal cycler (Mastercycler gradient, Ep-pendorf, Hamburg, Germany). After PCR, the reaction products wererun on a 2% agarose gel and visualized with ethidium bromide to checkthe length of the amplified DNA.
Real-time quantitative PCR
Real-time quantitative PCR was performed in a total volume of 25 �lin a buffer solution containing 5 �l template cDNA, 1� SYBR Greenbuffer (Applied Biosystems, Foster City, CA), 3 mm MgCl2, 0.625 UAmpliTaq Gold (Applied Biosystems), 0.2 mm dNTPs (Applied Biosys-tems), and 0.6 �m of each primer. For the CaR the same primer set asfor RT-PCR was used. Primers for the housekeeping gene glyceralde-hyde-3-phosphate dehydrogenase (GAPDH) were designed using Vec-tor NTI Suite (InforMax, Bethesda, MD) and PrimerExpress (AppliedBiosystems) software based on the Xenopus cDNA sequence (accessionno. U41753) for GAPDH. The following primer pair (Biolegio) was used:5�-GCCGTGTATGTGGTGGAATCT-3� and 5�-AAGTTGTCGTTGAT-GACCTTTGC-3� (product size: 230 bp). The optimum temperature cy-cling protocol was determined to be 95 C for 10 min followed by 40reaction cycles of 95 C for 15 sec and 60 C for 1 min, using a 5700GeneAmp PCR system (Applied Biosystems). For each reaction, thecycle threshold (Ct) was determined, i.e. the cycle number at whichfluorescence was detected above an arbitrary threshold (0.8). At thisthreshold Ct values are within the exponential phase of the amplifica-tion. To compare the relative amounts of CaR mRNA in NILs from black-vs. white-adapted animals, Ct values were normalized to those forGAPDH by subtracting the Ct values for the CaR from the Ct values forGAPDH.
In situ hybridization
The 450-bp PCR fragment was subcloned in a pGEMT plasmid (Pro-mega Corp.) to generate mRNA probes. After linearization of the plas-mid with SalI or NcoI (Roche), digoxigenin (DIG)-uridine 5-triphos-phate-labeled antisense and sense probes were prepared as run-offtranscripts, using SP6 and T7 RNA polymerases (Roche), respectively.The sequence of the X. laevis CaR sense probe was the following:5�-AGAAGAAGGGAGACATTATACTGGGTGGGCTTTTCCCC-ATACAT TTCGGGGTGGCTTCCAAGGACGAG GATCTGGAAT-CAAGGCCTGAATC ACTTGAGTGTGTCCGATACAATT TCCGTG-GATTTCGCTGGTTGAAGG CAATGATCTTTGCTATAGA GGA-AATTAACAGC TCCCCTACACTCCTC CCCAACATCACTCTGGGCTACAGAATCTT TGACACGTGCAA CACAGTATCCAAGGCTCTAGAGGCCACCCTCAGCTTTG TAGCTCAGAATAAAATT-GACT CCCTAAATCTGGATGA GTTCTGTAATTGTTCAGAGCATATGCCCTCCACAATTGC CGTGGTAGGAGCCACAGGAT CCG-GCGTTTCCACTGCAGTGGCA AATCTGCTTGGACTCTTTC ACA-TTCCTCAGGTTAGTTACGCCT CATCAAGCCGCACTCCTAA-ACA-3�.
Brains and pituitary glands were dissected and fixed in Bouin’s fix-ative, dehydrated through a graded series of ethanol, treated with xy-lene, and embedded in paraplast. Tissue sections (7 �m) were mountedon poly-l-lysine-coated slides, deparaffinated in xylene, and rehydratedin isopropanol and ethanol. Tissue penetration was enhanced by incu-bation in 0.1% pepsin in 0.2 n HCl for 15 min at 37 C. After fixation in3.7% formaldehyde in PBS for 5 min and incubation in 1% hydroxylammonium chloride for 15 min, tissue sections were dehydrated in 100%ethanol and air dried. Hybridization was performed overnight at 55 Cin hybridization buffer containing 10% sodium dextran sulfate, 50%formamide, 4� sodium chloride citrate (SCC) buffer (1� SCC: 0.15 mNaCl, 15 mm sodium citrate; pH 7.0), 1� Denhardt’s, and 200 �g/mlyeast tRNA, with 450 ng/ml sense or antisense DIG-labeled CaR RNAprobe. After stringency washes in 2� SCC, 1� SCC, 0.5� SCC for 30 minand 0.1� SCC for 30 min at 37 C, the sections were rinsed for 10 min inTris-buffered saline (TBS) buffer (100 mm Tris, 150 mm NaCl, pH 7.5),blocked in blocking solution consisting of 2% normal goat serum (home-made), 1% BSA (Sigma, St. Louis, MO) in TBS for 30 min, and incubatedin alkaline phosphatase (AP)-conjugated sheep anti-DIG Fab fragments(1:500; Roche) in blocking solution for 16 h at 4 C. After three washes of10 min in TBS and one wash of 5 min in AP buffer (100 mm Tris, 100 mmNaCl, 50 mm MgCl2, pH 9.5), sections were stained in 350 �g/ml 4-nitroblue tetrazolium chloride (Roche) and 175 �g/ml X-phosphate (Roche)in AP buffer until color development was sufficient.
Cell preparation
Animals were anesthetized with a solution containing 1 g/literMS222 (Sigma) and 1.5 g/liter NaHCO3. Blood cells were removed byperfusion with Xenopus Ringer’s solution (112 mm NaCl, 2 mm KCl, 2 mmCaCl2, 15 mm Ultral-HEPES, 2 mg/ml glucose, pH 7.4) containing 0.25mg/ml MS222. NILs were dissected and collected in 1 ml X. laevisLeibovitz’s culture medium (XL15) [containing 67% Leibovitz’s culturemedium, (Life Technologies, Inc.), 10 mg/ml kanamycin (Life Technol-ogies, Inc.), 10 mg/ml antibiotic/antimitotic (Life Technologies, Inc.), 2mm CaCl2, 10 mm glucose, pH 7.4]. After washing four times with XL15,NILs were incubated for 45 min in 1 ml Ringer’s solution without CaCl2,containing 0.25% trypsin (Life Technologies, Inc.). For Ca2� oscillationstudies, trypsin action was stopped by adding 9 ml XL15 containing 10%fetal calf serum (FCS; Life Technologies, Inc.). For secretion studiestrypsin action was stopped by adding 9 ml lysine-free XL15 containing10% dialyzed FCS. Cells were dispersed by gentle trituration using asiliconized Pasteur’s pipette. The suspension was filtered through nylongauze (pore size 58 �m) to remove undissociated tissue, and cells werecollected by centrifugation (50 g, 10 min). For Ca2� oscillation studies,the pellet was resuspended in XL15, and the cells were pipetted onto themiddle of a LabTek chambered coverglass (Nalge Nunc International,Naperville, IL) coated with poly-l-lysine. For secretion studies, the pelletwas resuspended in lysine-free XL15 containing 250 �Ci 3H-lysine (Am-ersham, Buckinghamshire, UK), and the cells were pipetted onto a Ø15mm coverglass (Menzel-Glaser, Braunschweig, Germany) coated withpoly-l-lysine. After the cells had been allowed to attach for 1 h, they werecultured for 2 d at 22 C in a humidified atmosphere in XL15/10% FCS
Van den Hurk et al. • The Ca2�-Sensing Receptor in Melanotropes Endocrinology, June 2003, 144(6):2524–2533 2525
for Ca2� oscillation studies and in lysine-free XL15 containing 10%dialyzed FCS for secretion studies.
Secretion studies
Following 2 d of incubation, 3H-lysine-labeled cells were rinsed fourtimes in Ringer’s solution containing 2 mg/ml glucose, 0.3 mg/ml BSA,and 1 �g/ml ascorbic acid. The coverslips were transferred to 4-wellculture dishes (Nunclon, Roskilde, Denmark) and superfused with Ring-er’s solution for at least 1.5 h before measurements. Ringer’s solution waspumped over the cells at a rate of 0.5 ml/h. At specific time points,l-phenylalanine (Merck, Darmstadt, Germany), d-phenylalanine (Sig-ma), spermine (Sigma), and nickel chloride (Acros Organics, Geel, Bel-gium) were added to the superfusion medium, following the protocolgiven in Results. Fractions of 2 min were collected, 160 �l scintillationfluid (Optiphase Supermix, Wallac, Inc., Loughborough, UK) wasadded, and the amount of scintillation was measured with a 1450 Mi-croBeta liquid scintillation �-counter (Wallac, Inc.). Data were collectedwith MicroBeta software (Wallac, Inc.) and further processed in Excel(Microsoft Corp., Redmond, WA). The average amount of radioactivityin the first 20 fractions was set at 100%, and the amount of radioactivityof all other fractions was expressed relative to this value. The values ofthe separate experiments were averaged and plotted against time. Thearea under the peak was integrated with Origin 6.0 (Microcal SoftwareInc., Northampton, MA). It has previously been shown that about 30–50% of the radioactivity in the superfusate is unincorporated 3H-lysine,and approximately 50–70% reflects the secretion of radiolabeled pro-opiomelanocortin (POMC)-derived peptides (17).
Ca2� oscillation studies
Following 3 d of incubation, cells were washed with Ringer’s solutionand subsequently loaded for 30 min with 20 �m fura-2 AM (MolecularProbes, Inc., Eugene, OR) and 1 �m Pluronic F127 (Molecular Probes,Inc.) in Ringer’s solution. After loading, the cells were again washedwith Ringer’s solution, placed under an inverted microscope (Axiovert135 TV, Zeiss, Gottingen, Germany), and connected to a superfusionsystem. Ringer’s solution was pumped over the cells at a rate of 0.6ml/min. At specific time points, l-phenylalanine, d-phenylalanine,spermine, and nickel chloride were added to the superfusion medium,following the protocol given in Results. The cells were magnified usingan �40 oil-immersion objective (Fluar, Zeiss) and areas of interest wereselected. For Ca2� measurements, every 6 sec the fura-2 probe wasalternately excited with light of 340 and 380 nm during 50 msec. Theexcitation light (340/380 nm) was generated by a 150-W Xenon lamp(UXL S150, Ushio, Cypress, CA) connected to a monochromator (Poly-chrome IV, Till Photonics, Martinred, Germany). The emission light wasfiltered (Photonics LP440 filter) and collected with a monochrome digitalcamera (Coolsnap fx, Roper Scientific, Tucson, AZ). Data were collectedwith Metafluor imaging software (Universal Imaging Corp., Downing-town, PA) and further processed in Origin 6.0 (Microcal Software Inc.).Changes in intracellular Ca2� concentrations were measured as changesin the ratio of 340/380 nm fluorescence intensity.
POMC biosynthesis studies
After dissection, NILs were collected in XL15 culture medium, rinsedseveral times, and then incubated in 4-well culture dishes (Nunclon),each containing 0.5 ml incubation medium, for 3 d at 22 C. For the controllobes, incubation medium consisted of XL15 with 10% FCS. For theexperimental groups, 1 �m neuropeptide Y (NPY; Bachem, Basel, Swit-zerland) was added to the incubation medium. Media were refreshedevery day. On the second day, 5 mm l-phenylalanine was added to theincubation medium of one experimental group. After 24 h, all lobes werepulse labeled in 10 �l Ringer’s solution containing 10 �Ci 3H-lysine ina 72-well plate (Nunclon) for 15 min. NILs were washed and lysed byboiling in sample buffer for 10 min. Proteins were separated on a 12%SDS-polyacrylamide gel using 20% of each lobe extract. Gels were fixedin 40% methanol and 10% acetic acid, saturated in 100% dimethylsulf-oxide, and treated with 2% 2,5-diphenyloxazol in dimethylsulfoxide forvisualization of radioactivity, followed by exposure to x-ray film (East-man Kodak Co., Rochester, NY). Signals were quantified with a GS-700
Quantitative data were analyzed by a t test (� � 5%) using Excelsoftware (Microsoft Corp.).
ResultsExpression of CaR mRNA in melanotrope cells of thepars intermedia
RT-PCR and in situ hybridization were used to assess thespecific expression of CaR mRNA in the pituitary gland of X.laevis. RT-PCR with a primer set specific for the Xenopus CaRyielded a product with the expected size of 450 bp in both theNIL and PD (Fig. 1). The sequence given in Materials andMethods confirmed that this product indeed represented theCaR. In situ hybridization with the antisense CaR mRNAprobe showed staining in most of the melanotrope cells of thepars intermedia, whereas no staining was found in the PN(Fig. 2, C and E). In the PD some endocrine cells showedstrong staining, whereas others showed moderate or nostaining (Fig. 2D). Furthermore, neurons of the preoptic nu-cleus of the diencephalon were strongly stained (Fig. 2, A andB). With the sense CaR mRNA probe, no staining was found.
To investigate whether the degree of expression of the CaRcan be affected during physiological adaptations of X. laevis,we used real-time quantitative RT-PCR to determinewhether there is a difference in mRNA levels of the CaRbetween NILs from white- and black-adapted animals. TheCt values for the CaR were normalized to the Ct values forthe housekeeping protein GAPDH. No significant differencewas found between the normalized Ct values for the CaR inNILs of white-adapted animals (�Ct � 8.08 � 0.20; n � 3),compared with black-adapted ones (�Ct � 8.14 � 0.24; n � 3).
Effect of changes in the [Ca2�]e on secretion andCa2� oscillations
Because Xenopus melanotropes express the CaR (seeabove), it was determined whether changes in the [Ca2�]e,which is 1–2 mm in the blood of amphibians (18), affect thelevel of hormone secretion by these cells. The control level ofsecretion (average value of the first 20 fractions) was set at100%. Elevating the [Ca2�]e from 2 mm to 3 mm or 5 mm
FIG. 1. Expression of CaR mRNA in the pituitary gland of black-adapted X. laevis. Agarose gel electrophoresis shows the reactionproducts of RT-PCR performed on total RNA from two NILs (lane 1and 2) and two PDs (lane 3 and 4), with primers specific for theXenopus CaR.
2526 Endocrinology, June 2003, 144(6):2524–2533 Van den Hurk et al. • The Ca2�-Sensing Receptor in Melanotropes
stimulated secretion, as appeared from integrating the areaunder the peak and expressing this release as a percentageper sampling fraction (Fig. 3). Compared with control level,the stimulatory effect by 5 mm Ca2� (�84.0% � 12.1%) washigher than that of 3 mm Ca2� (�50.3% � 3.6%; P � 0.05; n �4). In contrast, when the [Ca2�]e was lowered from 2 mm to1 mm or 0.5 mm, secretion was inhibited (Fig. 3). The inhib-itory effect of 0.5 mm Ca2� (�60.4% � 2.2%) was strongerthan that of 1 mm Ca2� (�33.1% � 3.1%; P � 0.01; n � 4).Similarly, compared with control level, the maximal stimu-lation of secretion under 5 mm Ca2� (�125.7% � 36.6%) washigher than that of 3 mm Ca2� (�34.2% � 3.6%; P � 0.05; n �4), and the maximal inhibition by 0.5 mm Ca2� (�37.6% �0.6%) was stronger than that by 1 mm Ca2� (�25.0% � 1.5%;P � 0.01; n � 4).
Also, the effects of changes in the [Ca2�]e on intracellularCa2� oscillations were studied. The melanotrope cellsshowed considerable heterogeneity in their responses to thechanges in the [Ca2�]e. Elevating the [Ca2�]e from 2 mm to3 mm strongly stimulated the frequency of the oscillations in89% of the cells, with an average increase of �69.3% � 13.6%(P � 0.01; n � 17; Fig. 4), whereas in two cells broaderoscillations were induced. When the [Ca2�]e was elevatedfrom 2 mm to 5 mm, an initial transient increase followed bya plateau of elevated Ca2� signaling or broader oscillationswas induced in 92% of the cells (n � 35; Fig. 4), whereas in8% of the cells, the frequency of the oscillations was stimu-lated, with an average increase of �63.6% � 16.0% (P � 0.01,n � 3). Lowering the [Ca2�]e from 2 mm to 1 mm, decreasedthe frequency of the oscillations in 67% of the cells, with an
average decrease of �21.6% � 5.1% (P � 0.01; n � 12; Fig.4). In addition, in two cells the amplitude of the oscillationswas lowered, in two other cells oscillations were narrower,and in two cells no effect was observed. When the [Ca2�]ewas lowered from 2 mm to 0.5 mm, oscillations were com-pletely or nearly completely abolished in nine cells (Fig. 4).In these cells, only changes in the basal Ca2� levels were seen.In two other cells, the frequency of the oscillations wasdecreased.
CaR activators stimulate secretion and Ca2� oscillations
To further test the specific involvement of the CaR inregulating secretion and Ca2� dynamics of the melanotropes,
FIG. 2. In situ hybridization of CaR mRNA in the brain (A and B) andin the pituitary gland; PI, pars intermedia (C and E), and PD (D) ofX. laevis. Bars: A, C, and D, 50 �m; B, 30 �m; and E, 20 �m.
FIG. 3. Effects of changing the [Ca2�]e from 2 mM to 5 mM, 3 mM, 1mM, or 0.5 mM on the release of radioactivity from 3H-lysine-labeledmelanotropes of black-adapted X. laevis. The average amount of ra-dioactivity in the first 20 fractions was set at 100%, and the amountof radioactivity of all other fractions was expressed relative to thisvalue. The values of the separate experiments were averaged andplotted against time. Mean values � SEM of separate superfusionexperiments are shown (n � 4).
Van den Hurk et al. • The Ca2�-Sensing Receptor in Melanotropes Endocrinology, June 2003, 144(6):2524–2533 2527
the action of different activators of the CaR was examined.The CaR can be activated allosterically by calcimimetics (R-467, NPS Pharmaceuticals, Inc., Salt Lake City, UT) and l-phenylalanine, in the presence of extracellular Ca2� at mil-limolar levels (19, 20). Furthermore, other CaR activators arepolyamines, such as spermine and neomycin (21). Differentconcentrations of l-phenylalanine and spermine were addedto melanotropes in the presence of 2 mm CaCl2. l-Phenyl-alanine had no effect on radiolabeled peptide secretion at aconcentration of 5 � 10�6 m, but increasing the concentrationto 5 � 10�5 m and 5 � 10�4 m stimulated secretion in adose-dependent way by 13.6% � 0.6% and 25.7% � 2.2%,
respectively (Fig. 5A). Further increasing the concentration to5 � 10�3 m and 5 � 10�2 m had no additional stimulatoryeffect on secretion, indicating that 5 � 10�4 m l-phenylala-nine was evoking a maximal response. Furthermore, it hasbeen shown that the amino acids have a stereo selective effecton the CaR in which the l-form is more effective in activatingthe CaR than the d-form (19). Indeed, in the presence of 2 mm,Ca2� addition of 0.5 mm l-phenylalanine to melanotropeshad a stronger maximal stimulatory effect on peptide secre-tion (40.4% � 2.6%) than addition of 0.5 mm d-phenylalanine(17.8% � 0.6%; P � 0.01; n � 4; Fig. 5B). Also spermine hada dose-dependent stimulatory effect on peptide secretion(Fig. 5C). The minimum effective concentration of spermine
FIG. 5. Effects of CaR activators on the release of radioactivity from3H-lysine-labeled melanotropes of black-adapted X. laevis. A, Effectof different concentrations of L-phenylalanine. B, Effects of 0.5 mM L-and D-phenylalanine. C, Effect of different concentrations of sperm-ine. The average amount of radioactivity in the first 20 fractions wasset at 100%, and the amount of radioactivity of all other fractions wasexpressed relative to this value. Mean values � SEM of separatesuperfusion experiments are shown (n � 4).
FIG. 4. Effect of changing the [Ca2�]e from 2 mM to 5 mM, 3 mM, 1 mM,or 0.5 mM on the Ca2� oscillations of dispersed melanotropes ofblack-adapted X. laevis. For each treatment the result of a represen-tative cell is shown. Changes in intracellular Ca2� concentrationswere measured as changes in the ratio of 340/380 nm fluorescenceintensity.
2528 Endocrinology, June 2003, 144(6):2524–2533 Van den Hurk et al. • The Ca2�-Sensing Receptor in Melanotropes
was 5 � 10�6 m and led to a stimulation of 21.2% � 2.9%.Further increasing the concentration to 5 � 10�5 m and 5 �10�4 m stimulated secretion by 42.6% � 2.7% and 110.7% �24.3%, respectively. Increasing the concentration further to5 � 10�3 m resulted in an extremely high response (900%;not shown). Immediately after administration of the higherconcentrations of l-phenylalanine or spermine to the mela-notropes secretion was decreased and did not fully returnafterward to basal level (Fig. 5).
In Ca2� imaging studies, the addition of 0.5 mm l-phenylalanine to the melanotropes induced an initial Ca2�
transient followed by a plateau of elevated Ca2� signaling orbroader oscillations in the 15 cells that were studied (Fig. 6A).Similarly, 0.5 mm spermine induced an initial Ca2� transientfollowed by a plateau of elevated Ca2� signaling or broader
oscillations in 15 cells (Fig. 6C), whereas in two cells thefrequency of the oscillations was stimulated. Returning tonormal Ringer’s solution reintroduced Ca2� oscillations aftera delay of about 5 min. At a concentration of 0.5 mm d-phenylalanine had no effect on Ca2� oscillations (Fig. 6B).
CaR activators stimulate secretion and Ca2� oscillationsthrough VOCCs
To investigate whether activation of the CaR stimulatesCa2� oscillations by stimulating the opening of voltage-operated Ca2� channels (VOCCs) in the plasma membrane,the effects of elevating [Ca2�]e and administering the CaRactivators l-phenylalanine and spermine were studied in thepresence of the nonselective VOCC-blocker Ni2�. This anal-ysis included the effects on both melanotrope cell secretionand Ca2� oscillations. On adding Ni2� to melanotropes, se-cretion was immediately inhibited by about 60% (Fig. 7,A–C). This in fact represents a complete inhibition of regu-lated secretion because it has been shown that the absence ofCa2� influx by blocking VOCC leads to a complete elimina-tion of regulated exocytosis in Xenopus melanotropes (22).Under Ni2� inhibition, treatment of melanotropes with ele-vated [Ca2�]e or l-phenylalanine had no effect on secretion,whereas both treatments had strong stimulatory effects inmatched control experiments (Fig. 7, A and B). In contrast,the stimulatory action of spermine seen in control experi-ments was not completely reduced under Ni2� inhibition(Fig. 7C). Ca2� oscillations immediately disappeared uponaddition of Ni2� to melanotropes and treatment of melano-tropes with elevated [Ca2�]e, l-phenylalanine, or sperminedid not restore the Ca2� oscillations (Fig. 8).
The CaR activator L-phenylalanine stimulatesPOMC biosynthesis
We investigated whether the CaR is able to stimulate thebiosynthesis of POMC, the precursor protein of �-MSH.Melanotrope cells of black-adapted animals are synthesizingPOMC at a maximal high rate. To be able to show a possiblestimulatory effect of l-phenylalanine on POMC biosynthesis,NILs of black-adapted animals were first inhibited byNPY (23). Subsequently, NILs were incubated with 5 mml-phenylalanine for 24 h. Following 3H-lysine incorporationand SDS-PAGE, two protein bands with molecular masses of38.2 and 37.3 kDa were observed (Fig. 9A) that represent theprotein products of the two POMC genes, POMC-A andPOMC-B (24). Incubation of NILs with 1 �m NPY resulted ina 7-fold decrease in POMC biosynthesis, compared withcontrol lobes (Fig. 9B). Incubation of NPY-treated NILs with5 mm l-phenylalanine for 24 h slightly stimulated POMCbiosynthesis (Fig. 9B). Statistical analysis showed that theamount of 3H-lysine-labeled POMC in the l-phenylalanineand NPY-treated NILs (5.6 � 0.6) was significantly higherthan in the NPY-treated NILs (3.2 � 0.5; P � 0.01; n � 6).
Discussion
Changes in [Ca2�]e alter the secretory activity of numerousendocrine cells. Several of these endocrine cells are able tosense changes in the [Ca2�]e by expressing a cell-surface CaR
FIG. 6. Effects of 0.5 mM L-phenylalanine (A), 0.5 mM D-phenylala-nine (B), and 0.5 mM spermine (C) on the Ca2� oscillations of dispersedXenopus melanotropes. For each treatment the result of a represen-tative cell is shown. Changes in intracellular Ca2� concentrationswere measured as changes in the ratio of 340/380-nm fluorescenceintensity.
Van den Hurk et al. • The Ca2�-Sensing Receptor in Melanotropes Endocrinology, June 2003, 144(6):2524–2533 2529
that links the changes in the [Ca2�]e to changes in hormonesecretion (2). A number of studies have demonstrated a widedistribution of the CaR in various types of endocrine cells,such as cells of the parathyroid, C cells of the thyroid, �- and�-cells of the pancreas, G cells of the stomach, and unspec-ified cells of the anterior pituitary (for review see Ref. 2).However, the presence of a CaR in melanotrope cells of thepituitary gland has not been established so far. In this studywe show by RT-PCR and in situ hybridization that the CaRis also expressed in melanotrope cells of the pars intermediaand in some as-yet-unidentified cells of the PD as well as inthe brain of the amphibian X. laevis.
The melanotrope cells of the pars intermedia of X. laevisdiffer morphologically and physiologically among differentstates of background adaptation. Melanotropes of black-adapted animals are highly active cells that produce andsecrete �-MSH and therefore contain a well developed bio-synthetic apparatus. In contrast, melanotrope cells of white-
FIG. 7. Effects of 5 mM calcium (A), 0.5 mM L-phenylalanine (L-phe;B), and 0.5 mM spermine (C) on the release of radioactivity from3H-lysine-labeled melanotropes of black-adapted X. laevis inhibitedby 5 mM nickel. The average amount of radioactivity in the first 20fractions was set at 100%, and the amount of radioactivity of all otherfractions was expressed relative to this value. The values of theseparate experiments were averaged and plotted against time. Meanvalues � SEM of separate superfusion experiments are shown (n � 4).
FIG. 8. Effects of 5 mM calcium (A), 0.5 mM L-phenylalanine (L-phe;B), and 0.5 mM spermine (C) on the Ca2� oscillations of dispersedXenopus melanotropes inhibited by 5 mM nickel. For each treatment,the result of a representative cell is shown. Changes in intracellularCa2� concentrations were measured as changes in the ratio of 340/380-nm fluorescence intensity.
2530 Endocrinology, June 2003, 144(6):2524–2533 Van den Hurk et al. • The Ca2�-Sensing Receptor in Melanotropes
adapted animals are inactive and produce only low levels of�-MSH (14). Several studies already demonstrated that theexpression levels of certain proteins differ between thesestates of background adaptation. Several genes are up-regulated in melanotropes in black-adapted animals, com-pared with white-adapted animals, such as the POMC genesA and B (25) and genes involved in the biosynthesis andregulated release of POMC-derived peptides, such as thePOMC cleavage enzyme prohormone convertase 2 (26) andthe synaptosomal-associated protein of 25 kDa (27). In con-trast, mRNA of the NPY1 receptor has been shown to be moreabundant in melanotropes in white-adapted than in black-adapted animals (28). In the present study, we found nosignificant difference in the amounts of CaR mRNA betweenNILs from black- and white-adapted animals. This suggeststhat the expression of this receptor is not under control of thebackground adaptation process. Whether there is also nodifference in the expression of the CaR at the protein levelbetween the different adaptation states needs investigation.
The CaR is known to modulate hormone secretion fromvarious types of endocrine cells. In some of these cells, theCaR inhibits secretion of hormones, such as PTH in para-thyroid chief cells (1). In other endocrine cell types, the CaRstimulates hormone release, such as calcitonin in the thyroidC cells (29), gastrin in G cells of the stomach (30), and insulinin pancreatic �-cells (31). In the pituitary gland, the CaRmight potentially regulate hormone secretion becausechanges in [Ca2�]e are known to alter GH and prolactinrelease in somatotropes and lactotropes, respectively (13), a
phenomenon also demonstrated for pituitary tumor cell linessecreting GH and ACTH (10–12). In the present study, it wasinvestigated whether changes in the [Ca2�]e have an effect onthe secretion of radiolabeled peptides from Xenopus mela-notropes. Indeed, elevated [Ca2�]e appears to stimulate thesecretory process and lower the [Ca2�]e inhibits secretion, ina dose-dependent way.
In Xenopus melanotropes intracellular Ca2� signaling is inthe form of Ca2� oscillations, which are generated at theplasma membrane through influx of Ca2� via �-conotoxin-sensitive VOCCs (32, 33). These oscillations drive the secre-tion of POMC-derived peptides (15, 16). Therefore, it wasinvestigated whether changes in the [Ca2�]e have an effect onthe Ca2� oscillations in Xenopus melanotropes. In line withthe effects on secretion, we showed that in Xenopus mela-notropes elevated [Ca2�]e stimulates and lowered [Ca2�]einhibits Ca2� oscillations in a dose-dependent way. It is in-teresting to note that in recent studies with HEK cells trans-fected with the CaR, elevated [Ca2�]e stimulates and lowered[Ca2�]e inhibits Ca2� oscillations (34, 35).
The effects of an elevated [Ca2�]e on secretion and Ca2�
oscillations of Xenopus melanotropes can be due to activationof the CaR but could also involve other mechanisms. Onepossibility is that an elevated [Ca2�]e gives an increaseddriving force of extracellular Ca2� across the plasma mem-brane. As a result, the increased Ca2� influx might stimulateexocytosis of an increased number of secretory granules.Furthermore, an increased Ca2� influx might affect Ca2�
oscillations and/or secretion by influencing intracellular en-zymes that are sensitive to changes of the intracellular [Ca2�],such as Ca2�/calmodulin protein kinase II (36), adenylylcyclase (37), and guanylyl cyclase (38). Another possibility isthat elevated [Ca2�]e exerts its effect on secretion and Ca2�
oscillations by affecting channels in the plasma membranethat respond to changes in the [Ca2�]e, such as cyclic nucle-otide-gated channels (39), Na� channels (40), and ether-a-go-go-related gene K� channels (41). To confirm the involvementof the CaR in Ca2�-dependent melanotrope secretion, westudied the effect of two different, specific CaR activators, viz.l-phenylalanine (19, 20) and the polyamine spermine (21). Itwas demonstrated that both receptor activators stimulatesecretion and Ca2� oscillations, suggesting the presence of afunctional CaR in the membrane of these cells and its in-volvement in the control of Ca2� oscillation-mediatedsecretion.
Previous studies have shown that the intracellular Ca2�
oscillations drive the secretion from melanotropes (15, 16).Therefore, it is expected that stimulation of the Ca2� oscil-lations would result in a corresponding stimulation of se-cretion. However, we found that a 20-min administration of5 mm calcium or the CaR activators l-phenylalanine andspermine to melanotropes induced a stimulatory effect onpeptide secretion that is transitory, and the stimulatory effecton the Ca2� oscillations remains steady during this period.This phenomenon could be due to depletion of a readilyreleasable pool of secretory granules. We also found thatimmediately after administration of the CaR activators l-phenylalanine and spermine to melanotropes, secretion wasdecreased. This phenomenon may be due to desensitizationof the CaR as a result of stimulation with a CaR activator.
FIG. 9. Effect of L-phenylalanine (L-phe) on POMC biosynthesis ofNILs inhibited by NPY. The autoradiography (A) and correspondingOD (B) of 3H-lysine incorporation in POMC in extracts of NILs fromblack-adapted animals (control) after incubation with 1 �M NPY or 1�M NPY � 5 mM L-phe (NPY�L-phe) are shown. Bars represent meanvalue of OD after background subtraction � SEM of 3H-lysine-labeledprotein bands exposed to a film. OD is expressed as arbitrary units(a.u.) and represents the amount of POMC biosynthesis. Asteriskindicates statistically significant difference (P � 0.01; n � 6).
Van den Hurk et al. • The Ca2�-Sensing Receptor in Melanotropes Endocrinology, June 2003, 144(6):2524–2533 2531
Figure 7 shows that the stimulatory effect on secretion duringthe second pulse with 5 mm calcium, l-phenylalanine, orspermine is lower than that of the first pulse. Therefore, it ispossible that after multiple pulses with a CaR activator, theCaR becomes less sensitive to the [Ca2�]e in the medium,resulting in a lower level of secretion.
We also investigated the mechanism that underlies theactivation of Ca2� oscillations in Xenopus melanotropes byelevated [Ca2�]e and the CaR activators l-phenylalanine andspermine. In theory, the intracellular [Ca2�] can be increasedby two mechanisms (42). First, extracellular Ca2� can flowinto the cytosol by opening of Ca2� channels in the plasmamembrane. Second, Ca2� can be released into the cytosolfrom intracellular Ca2� stores like the endoplasmic reticulumor mitochondria. Previous studies have shown that, in Xe-nopus melanotropes, Ca2� oscillations are generated by in-flux of Ca2� through opening of �-conotoxin-sensitiveVOCCs in the plasma membrane (33). Elevated [Ca2�]e andl-phenylalanine appear to be unable to stimulate Ca2� influxor secretion when VOCCs have been blocked with Ni2�. Thisfinding indicates that in Xenopus melanotropes the CaR stim-ulates secretion and Ca2� oscillations by increasing the influxof extracellular Ca2� into the cytosol through VOCCs.
It is well established that secretion from melanotropesdepends on the presence of Ca2� oscillations (15, 16). Theobservation that the CaR activator spermine is still able tostimulate secretion under Ni2� inhibitions, in the absence ofany effect on Ca2� oscillations, suggests that the stimulatoryeffect of spermine on secretion under Ni2�-inhibited condi-tions is a nonphysiological effect, probably not involving theCaR. In contrast, the fact that l-phenylalanine did not stim-ulate secretion nor Ca2� oscillations under Ni2� inhibition,together with the finding that d-phenylalanine had only littleeffect on secretion and Ca2� oscillations, indicates that l-phenylalanine is a suitable activator of the CaR in Xenopusmelanotropes. This study indicates that l-phenylalanine,besides stimulating secretion, may also promote the bio-synthesis of POMC. It is interesting to note that, in mousepituitary AtT-20PL cells, POMC mRNA expression is up-regulated by polyamine CaR agonists (43).
The question arises as to the physiological significance ofthe CaR in melanotrope cells of the pars intermedia of X.laevis. Melanotropes and various other cell types that expressthe CaR, such as �-cells of the pancreas (31), keratinocytes ofthe skin (44), epithelial cells of the lens (45), and certainneurons in the brain (3), are seemingly uninvolved in thecontrol of systemic Ca2� homeostasis. Therefore, melano-trope cells may respond to local changes in the [Ca2�]e ratherthan to changes in the systemic [Ca2�]. In the pars interme-dia, the extracellular space between melanotropes is poorlyvascularized and consists of a system of intercellular spacesfilled with extracellular fluid (46). Melanotrope cells releasetheir peptidergic secretory material into this extracellularspace and because the space is relatively small, it is possiblethat transient, local increases in the [Ca2�]e have an effect onthe cells. Two mechanisms to promote such an increase of thelocal [Ca2�]e nearby the melanotrope cell can be envisaged.First, Ca2�-ATPases in the plasma membrane may pumplarge amounts of Ca2� into the extracellular space (47). Sec-ond, during secretion by exocytosis, secretory granules,
which contain high concentrations of Ca2� (up to 125 mm;Ref. 48), release Ca2� together with peptide hormones intothe extracellular space. In either case, the local increase in[Ca2�]e may activate the CaR of the melanotrope cell tofurther increase its secretory activity. It has recently beenshown that agonist-evoked elevation of the [Ca2�]e throughsuch a mechanism activates the CaR of neighboring cells (49).In this way, the CaR may mediate a universal form of in-tercellular communication that allows cells to be informedabout Ca2� signaling and/or secretory status among neigh-boring cells. This mechanism might be helpful to let a pop-ulation of individual endocrine cells act as one integrativeunit.
In conclusion, it has been demonstrated that melanotropecells of X. laevis express mRNA encoding for the CaR andactivation of this receptor by elevated [Ca2�]e or CaR acti-vators stimulates secretion and Ca2� oscillations throughopening of VOCCs in the plasma membrane. To our knowl-edge, this is the first study that identifies and characterizesthe action of the CaR in an identified cell type of the pituitarygland, the melanotrope. Therefore, it contributes to the un-derstanding of the functional significance of the presence ofthe CaR in endocrine cells.
Acknowledgments
The authors are grateful to Ron J. C. Engels for animal care and PeterM. J. M. Cruijsen and Frouwke Kuijpers for technical assistance.
Received January 6, 2003. Accepted February 21, 2003.Address all correspondence and requests for reprints to: M. J. J. van
den Hurk, Department of Cellular Animal Physiology, University ofNijmegen, Toernooiveld 1, 6525 ED Nijmegen, The Netherlands. E-mail:[email protected].
References
1. Brown EM, Gamba G, Riccardi D, Lombardi M, Butters R, Kifor O, Sun A,Hediger MA, Lytton J, Hebert SC 1993 Cloning and characterization of anextracellular Ca2�-sensing receptor from bovine parathyroid. Nature 366:575–580
2. Brown EM, MacLeod RJ 2001 Extracellular calcium sensing and extracellularcalcium signaling. Physiol Rev 81:239–297
3. Ruat M, Molliver ME, Snowman AM, Snyder SH 1995 Calcium sensingreceptor: molecular cloning in rat and localization to nerve terminals. Proc NatlAcad Sci USA 92:3161–3165
4. Rogers KV, Dunn CK, Hebert SC, Brown EM 1997 Localization of calciumreceptor mRNA in the adult rat central nervous system by in situ hybridization.Brain Res 744:47–56
5. Mitsuma T, Rhue N, Kayama M, Mori Y, Adachi K, Yokoi Y, Ping J, NogimoriT, Hirooka Y 1999 Distribution of calcium sensing receptor in rats: an immu-nohistochemical study. Endocr Regul 33:55–59
6. Chattopadhyay N, Ye CP, Yamaguchi T, Kifor O, Vassilev PM, NishimuraRN, Brown EM 1998 Extracellular calcium-sensing receptor in rat oligoden-drocytes: expression and potential role in regulation of cellular proliferationand an outward K� channel. Glia 24:449–458
7. Chattopadhyay N, Ye CP, Yamaguchi T, Nakai M, Kifor O, Vassilev PM,Nishimura RN, Brown EM 1999 The extracellular calcium-sensing receptor isexpressed in rat microglia and modulates an outward K� channel. J Neuro-chem 72:1915–1922
8. Chattopadhyay N, Evliyaoglu C, Heese O, Carroll R, Sanders J, Black P,Brown EM 2000 Regulation of secretion of PTHrP by Ca2�-sensing receptorin human astrocytes, astrocytomas, and meningiomas. Am J Physiol CellPhysiol 279:C691–C699
9. Shorte SL, Schofield JG 1996 The effect of extracellular polyvalent cations onbovine anterior pituitary cells. Evidence for a Ca2�-sensing receptor coupledto release of intracellular calcium stores. Cell Calcium 19:43–57
10. Emanuel RL, Adler GK, Kifor O, Quinn SJ, Fuller F, Krapcho K, Brown EM1996 Calcium-sensing receptor expression and regulation by extracellular cal-cium in the AtT-20 pituitary cell line. Mol Endocrinol 10:555–565
11. Romoli R, Lania A, Mantovani G, Corbetta S, Persani L, Spada A 1999
2532 Endocrinology, June 2003, 144(6):2524–2533 Van den Hurk et al. • The Ca2�-Sensing Receptor in Melanotropes
Expression of calcium-sensing receptor and characterization of intracellularsignaling in human pituitary adenomas. J Clin Endocrinol Metab 84:2848–2853
12. Ferry S, Chatel B, Dodd RH, Lair C, Gully D, Maffr JP, Ruat M 1997 Effectsof divalent cations and of a calcimimetic on adrenocorticotropic hormonerelease in pituitary tumor cells. Biochem Biophys Res Commun 238:866–873
13. Zivadinovic D, Tomic M, Yuan D, Stojilkovic SS 2002 Cell-type specificmessenger functions of extracellular calcium in the anterior pituitary. Endo-crinology 143:445–455
14. Kolk SM, Kramer BRM, Cornelisse LN, Scheenen WJJM, Jenks BG, RoubosEW 2002 Multiple control and dynamic response of the Xenopus melanotropecell. Comp Biochem Physiol B Biochem Mol Biol 132:257–268
15. Douglas WW, Shibuya I 1993 Calcium signals in melanotrophs and theirrelation to autonomous secretion and its modification by inhibitory and stim-ulatory ligands. Ann N Y Acad Sci 680:229–245
16. Scheenen WJJM, de-Koning HP, Jenks BG, Vaudry H, Roubos EW 1994 Thesecretion of �-MSH from Xenopus melanotropes involves calcium influxthrough omega-conotoxin-sensitive voltage-operated calcium channels. J Neu-roendocrinol 6:457–464
17. Martens GJM, Jenks BG, van-Overbeeke AP 1981 Microsuperfusion of neu-rointermediate lobes of Xenopus laevis: concomitant and coordinately con-trolled release of newly synthesized peptides. Comp Biochem Physiol C 69:75–81
18. Stiffler DF 1993 Amphibian calcium metabolism. J Exp Biol 184:47–6119. Conigrave AD, Quinn SJ, Brown EM 2000 l-amino acid sensing by the
extracellular Ca2�-sensing receptor. Proc Natl Acad Sci USA 97:4814–481920. Zhang Z, Jiang Y, Quinn SJ, Krapcho K, Nemeth EF, Bai M 2002 l-phenyl-
alanine and NPS R-467 synergistically potentiate the function of the extracel-lular calcium-sensing receptor through distinct sites. J Biol Chem 277:33736–33741
21. Quinn SJ, Ye CP, Diaz R, Kifor O, Bai M, Vassilev PM, Brown EM 1997 TheCa2�-sensing receptor: a target for polyamines. Am J Physiol 273:C1315–C1323
22. Scheenen WJJM, Dernison MM, Lieste JR, Jenks BG, Roubos EW 2003Electrical membrane activity and regulators of intracellular calcium controlexocytosis efficiency of the Xenopus melanotrope cells. Neuroendocrinol 77:153–161
23. Kramer BMR, Cruijsen PJMJ, Ouwens DTWM, Coolen MW, Martens GJM,Roubos EW, Jenks BG 2002 Evidence that brain-derived neurotrophic factoracts as an autocrine factor on pituitary melanotrope cells of Xenopus laevis.Endocrinology 143:1337–1345
24. Martens GJM 1986 Expression of two proopiomelanocortin genes in the pi-tuitary gland of Xenopus laevis: complete structures of the two preprohor-mones. Nucleic Acids Res 14:3791–3798
25. Martens GJM, Weterings KA, van-Zoest ID, Jenks BG 1987 Physiologicallyinduced changes in proopiomelanocortin mRNA levels in the pituitary glandof the amphibian Xenopus laevis. Biochem Biophys Res Commun 143:678–684
27. Kolk SM, Nordquist R, Tuinhof R, Gagliardini L, Thompson B, Cools AR,Roubos EW 2000 Localization and physiological regulation of the exocytosisprotein SNAP-25 in the brain and pituitary gland of Xenopus laevis. J Neu-roendocrinol 12:694–706
28. Jenks BG, Ouwens DTWM, Coolen MW, Roubos EW, Martens GJM 2002Demonstration of postsynaptic receptor plasticity in an amphibian neuroen-docrine interface. J Neuroendocrinol 14:843–845
29. McGehee DS, Aldersberg M, Liu KP, Hsuing S, Heath MJ, Tamir H 1997Mechanism of extracellular Ca2� receptor-stimulated hormone release fromsheep thyroid parafollicular cells. J Physiol 502:31–44
30. Ray JM, Squires PE, Curtis SB, Meloche MR, Buchan AMJ 1997 Expressionof the calcium-sensing receptor on human antral gastrin cells in culture. J ClinInvest 99:2328–2333
31. Kato M, Doi R, Imamura M, Furutani M, Hosotani R, Shimada Y 1997Calcium-evoked insulin release from insulinoma cells is mediated via calcium-sensing receptor. Surgery 122:1203–1211
32. Shibuya I, Douglas WW 1993 Spontaneous cytosolic calcium pulses in Xenopusmelanotrophs are due to calcium influx during phasic increases in the calciumpermeability of the cell membrane. Endocrinology 132:2176–2183
34. Breitwieser GE, Gama L 2001 Calcium-sensing receptor activation inducesintracellular calcium oscillations. Am J Physiol Cell Physiol 280:C1412–C1421
35. Young SH, Rozengurt E 2002 Amino acids and Ca2� stimulate differentpatterns of Ca2� oscillations through the Ca2�-sensing receptor. Am J PhysiolCell Physiol 282:C1414–C1422
36. Soderling TR, Chang B, Brickey D 2001 Cellular signaling through multi-functional Ca2�/calmodulin-dependent protein kinase II. J Biol Chem 276:3719–3722
37. Mons N, Decorte L, Jaffard R, Cooper DMF 1998 Ca2�-sensitive adenylylcyclases, key integrators of cellular signalling. Life Sci 62:1647–1652
38. Andric SA, Kostic TS, Tomic M, Koshimizu T, Stojilkovic SS 2001 Depen-dence of soluble guanylyl cyclase activity on calcium signaling in pituitarycells. J Biol Chem 276:844–849
39. Zagotta WN, Siegelbaum SA 1996 Structure and function of cyclic nucleotide-gated channels. Annu Rev Neurosci 19:235–263
40. Su H, Alroy G, Kirson ED, Yaari Y 2001 Extracellular calcium modulatespersistent sodium current-dependent burst-firing in hippocampal pyramidalneurons. J Neurosci 21:4173–4182
41. Johnson J-PJ, Balser JR, Bennett PB 2001 A novel extracellular calcium sensingmechanism in voltage-gated potassium ion channels. J Neurosci 21:4143–4153
42. Clapham DE 1995 Calcium signaling. Cell 80:259–26843. Yamamori E, Iwasaki Y, Aoki Y, Nomura A, Tachikawa K, Ariyoshi Y,
Mutsuga N, Morishita M, Yoshida M, Asai M, Oiso Y, Saito H 2001 Poly-amine regulation of the rat pro-opiomelanocortin gene expression in AtT-20cells. J Neuroendocrinol 13:774–778
44. Oda Y, Tu CL, Pillai S, Bikle DD 1998 The calcium sensing receptor and itsalternatively spliced form in keratinocyte differentiation. J Biol Chem 273:23344–23352
45. Chattopadhyay N, Ye C, Singh DP, Kifor O, Vassilev PM, Shinohara T,Chylack Jr L-T, Brown EM 1997 Expression of extracellular calcium-sensingreceptor by human lens epithelial cells. Biochem Biophys Res Commun 233:801–805
46. De-Bold AJ, de-Bold ML, Kraicer J 1980 Structural relationships betweenparenchymal and stromal elements in the pars intermedia of the rat adeno-hypophysis as demonstrated by extracellular space markers. Cell Tissue Res207:347–359
47. Belan P, Gardner J, Gerasimenko O, Gerasimenko J, Mills CL, Petersen OH,Tepikin AV 1998 Isoproterenol evokes extracellular Ca2� spikes due to se-cretory events in salivary gland cells. J Biol Chem 273:4106–4111
![A DNA [deoxyribonucleic acid] binding protein from Xenopus laevis oocyte mitochondria](https://static.documents.pub/doc/80x56/6345431d596bdb97a908d95c/a-dna-deoxyribonucleic-acid-binding-protein-from-xenopus-laevis-oocyte-mitochondria.jpg)
