Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=tnzm20 Download by: [JI Túnez] Date: 05 May 2016, At: 08:10 New Zealand Journal of Marine and Freshwater Research ISSN: 0028-8330 (Print) 1175-8805 (Online) Journal homepage: http://www.tandfonline.com/loi/tnzm20 Genetic diversity and population structure of the franciscana dolphin, Pontoporia blainvillei, in Southern Buenos Aires, Argentina MF Negri, HL Cappozzo & JI Túnez To cite this article: MF Negri, HL Cappozzo & JI Túnez (2016): Genetic diversity and population structure of the franciscana dolphin, Pontoporia blainvillei, in Southern Buenos Aires, Argentina, New Zealand Journal of Marine and Freshwater Research, DOI: 10.1080/00288330.2016.1146308 To link to this article: http://dx.doi.org/10.1080/00288330.2016.1146308 Published online: 04 May 2016. Submit your article to this journal View related articles View Crossmark data
Transcript
Full Terms & Conditions of access and use can be found athttp://www.tandfonline.com/action/journalInformation?journalCode=tnzm20
Download by: [ JI Túnez] Date: 05 May 2016, At: 08:10
New Zealand Journal of Marine and Freshwater Research
Genetic diversity and population structure of thefranciscana dolphin, Pontoporia blainvillei, inSouthern Buenos Aires, Argentina
MF Negri, HL Cappozzo & JI Túnez
To cite this article: MF Negri, HL Cappozzo & JI Túnez (2016): Genetic diversity andpopulation structure of the franciscana dolphin, Pontoporia blainvillei, in SouthernBuenos Aires, Argentina, New Zealand Journal of Marine and Freshwater Research, DOI:10.1080/00288330.2016.1146308
To link to this article: http://dx.doi.org/10.1080/00288330.2016.1146308
Genetic diversity and population structure of the franciscanadolphin, Pontoporia blainvillei, in Southern Buenos Aires,ArgentinaMF Negria,b, HL Cappozzoa,c and JI Túnezd
aLaboratorio de Ecología, Comportamiento y Mamíferos Marinos, Museo Argentino de Ciencias Naturales‘Bernardino Rivadavia’ (MACN–CONICET), Buenos Aires, Argentina; bLaboratorio de Ecología y Conservaciónde Vida Silvestre, Centro Austral de Investigaciones Científicas (CADIC–CONICET), Ushuaia, Tierra del Fuego,Argentina; cCentro de Estudios Biomédicos, Biotecnológicos, Ambientales y Diagnóstico (CEBBAD–CONICET),Fundación de Historia Natural Félix de Azara, Departamento de Ciencias Naturales y Antropología,Universidad Maimónides, Buenos Aires, Argentina; dGrupo de Estudios en Ecología de Mamíferos,Departamento de Ciencias Básicas, Universidad Nacional de Luján and CONICET, Luján, Provincia de BuenosAires, Argentina
ABSTRACTThe franciscana dolphin, Pontoporia blainvillei, is endemic to thecoastal waters of the southwestern Atlantic Ocean and the mostendangered dolphin in the area. Four Franciscana ManagementAreas (FMAs) are currently recognised; however, results of geneticstudies suggest the requirement for additional FMAs and highlightthe need for more detailed studies in the southern extreme of thespecies distribution. With this aim, we studied the genetic diversityand population structure of the species analysing an mtDNAcontrol region fragment (434 bp) in 44 individuals collected in foursampling sites located in Southern Buenos Aires. Haplotypediversity (H = 0.75 ± 0.05) was mostly higher than the observed inendangered or near threatened odontocetes. Population structureanalyses suggest that three different genetic populations should berecognised within FMA IV: Northern, Eastern and Southern BuenosAires. Altogether, these results should be taken into account infuture conservation plans for the species.
ARTICLE HISTORYReceived 23 April 2015Accepted 24 December 2015
Knowledge of the existence of discrete populations and of the genetic diversity withinthem is essential for the conservation and management of vulnerable species (Secchiet al. 1998). Proper definition of these populations is critical, because inadequate definitioncan lead to unnecessary regulations or inadequate management that would result in thedisappearance of populations (Wang 2002).
Genetic diversity is one of the most important attributes of a population, since thosespecies that exhibit greater variability can better respond to environmental changes andare less susceptible to extinction (Frankham et al. 2010; Allendorf et al. 2013). The reductionin population size can cause loss of genetic variabilitywithin populations and the emergence
of negative genetic effects. Small, isolated populations may suffer effects of inbreeding andloss of heterozygosity, leading to a decrease in reproductive success and an increase in theprobability of extinction (Luck et al. 2003; Freeland, 2005). This phenomenon has beenmentioned repeatedly as an impediment to the population growth of mammals found inlow densities (Mills & Smouse 1994; Lacy 1997; Avise 2004; O’Grady et al. 2006).
The franciscana dolphin, Pontoporia blainvillei (Gervais & d’Orbigny, 1844), isendemic to the coastal waters of the southwestern Atlantic Ocean and occurs fromItaúnas, Espírito Santo, Brazil (18°25′S, 30°42′W), to Chubut province, Argentina (42°35′S, 64°48′W) (Siciliano 1994; Crespo et al. 1998; Bastida et al. 2007) (Figure 1A). Dueto its coastal distribution, the species is regularly entangled in artisanal fishery nets(Crespo et al. 1994; Cappozzo et al. 2007; Negri et al. 2012). It is estimated that morethan 500 franciscana dolphins are caught in this way each year in Buenos Aires provincealone (Negri et al. 2012). The franciscana is also the most endangered dolphin in thesouthwestern Atlantic Ocean and since 2008 has been listed as Vulnerable by the Inter-national Union for Conservation of Nature (IUCN) (Reeves et al. 2012). Habitat loss,water contamination and resource competition with fisheries are considered the mostimportant threats (Cunha et al. 2014). In Southern Buenos Aires, the presence of heavymetals in franciscana tissues (Panebianco et al. 2011, 2012, 2013) and the overlapbetween franciscana prey and target species that are subject to overfishing couldenhance the vulnerability of franciscana in the area (Paso Viola et al. 2014).
Secchi et al. (2003), based on all the available information for the species at that time,proposed the creation of four Franciscana Management Areas (FMAs, Figure 1A) thatwould be incorporated in the site-specific fisheries management policies in order to con-serve franciscana dolphins. Much evidence to date supports the establishment of thesemanagement areas (Pinedo 1991; Aznar et al. 1995; Andrade et al. 1997; Higa et al.2002; Botta 2011; Negri 2011; Panebianco et al. 2011, 2012; Barbato et al. 2012; Denuncio2012; Polizzi et al. 2013; Negri et al. 2014; Paso Viola 2014). In addition, many geneticstudies (Secchi et al. 1998; Ott 2002; Lázaro et al. 2004; Méndez et al. 2008, 2010;Costa-Urrutia et al. 2012; Cunha et al. 2014) have analysed mitochondrial and nuclearmarkers to better understand the genetic structure of the franciscana dolphin populationsand/or to test if the genetic units identified correspond to those FMAs recognised bySecchi et al. (2003). Particularly for FMA IV, Mendez et al. (2010) suggested that this man-agement area should be divided into three subpopulations: Northern, Eastern andSouthern Buenos Aires (Figure 1A). However, genetic data from the southern populationdid not cover the entire distribution of the species in the area, since there is a gap of morethan 400 km of coastline between Claromecó and the southern areas sampled in thatstudy. Franciscana dolphins show restricted movement patterns between putative popu-lation areas (Bordino et al. 2008; Méndez et al. 2010) which necessitates a more detailedstudy in the southern areas of its distribution to better understand the population structureof the species, as proposed by Cunha et al. (2014) and Valsecchi & Zanelatto (2003). In thelatter study, the authors found that the northern portion of the species distribution showsthe lowest genetic variability and noted the need to test the occurrence of this phenom-enon in the southern extreme of the species distribution.
Thus, the aim of this study was to analyse the genetic diversity and population structureof the franciscana dolphin in the southern coast of Buenos Aires province. We also com-pared the results for the genetic diversity found in Southern Buenos Aires with those
2 MF NEGRI ET AL.
Dow
nloa
ded
by [
JI T
únez
] at
08:
10 0
5 M
ay 2
016
Figure 1. Study area. A, Pontoporia blainvillei distribution range showing the four Franciscana Management Areas (FMA I–IV) proposed by Secchi et al. (2003) andthe three different genetic populations proposed by Méndez et al. (2010) for the FMA IV. Key: ES, Espírito Santo; RJ, Rio de Janeiro; SP, São Paulo; PR, Paraná; SC,Santa Catarina; RG, Rio Grande do Sul; UY, Uruguay; RN, Río Negro; CH, Chubut; NBA, Northern Buenos Aires; EBA, Eastern Buenos Aires; SBA, Southern Buenos Aires.B, Southern Buenos Aires sampling sites analysed in this study. Key: NE, Necochea; CL, Claromecó; MH, Monte Hermoso; BB, Bahía Blanca.
NEW
ZEA
LANDJO
URN
ALOFMARIN
EANDFRESH
WATER
RESEARC
H3
Dow
nloa
ded
by [
JI T
únez
] at
08:
10 0
5 M
ay 2
016
previously published for other franciscana populations and some related odontocetespecies in order to analyse the conservation status of populations in the southern areaof the species distribution.
Materials and methods
Sample collection
Samples were collected from 44 franciscana dolphins in four sampling sites located alongthe southern coast of Buenos Aires province (Figure 1B). Samples were collected between1998 and 2010 from dead animals stranded (n = 4) or entangled (n = 40) in the coastalwaters of Necochea (NE, n = 18), Claromecó (CL, n = 14), Monte Hermoso (MH, n =10) and Bahía Blanca (BB, n = 2). Stranded franciscanas belonged to the decompositioncategory ‘recently deceased’ (Geraci & Lounsbury 1993), therefore it was assumed thatthe places where dead animals were found accurately reflected the correct locality. Skin,muscle and liver samples were taken and stored in 96% ethanol or preservation buffer con-taining 20% DMSO and EDTA 0.25 N (pH = 8.0) saturated with sodium chloride. Once inthe laboratory, samples were stored at −20 °C until DNA was extracted.
Mitochondrial DNA extraction, PCR amplification and sequencing
Samples were incubated overnight at 37 °C in extraction buffer (10 mMTrisHCl, pH = 8; 0.1M EDTA; SDS 1%) containing 10 µL of proteinase K, 10 mg/mL. After incubation, DNAwasisolated from the sample by phenol–chloroform extraction and alcohol precipitation (Sam-brook et al. 1989). Precipitated DNA was dried at room temperature, resuspended inbuffer TE, pH = 8.0, quantified in a spectrophotometer at 260/280 nm and stored at −20 °C.
Extracted DNA was used as a template in polymerase chain reaction (PCR) in order toamplify a 565 bp fragment of the mitochondrial DNA that included 57 bp of the 3′ end ofthe tRNA–Thr gene, 66 bp of the tRNA–Pro gene and the first 442 bp of the control region.Each PCR had a reaction volume of 15 µL and contained between 10 and 90 ng of DNA, 3µL of 5X Green GoTaq Reaction Buffer (7.5 mM MgCl2, pH = 8.5), 0.3 µL of 20 mM pre-mixed deoxynucleotide triphosphates, 1.25 units of GoTaq polymerase (Promega), 0.3 µLof 0.2 mM oligonucleotide primers, and water to reach the final reaction volume. Theprimer pair used was: THR L15926: 5′–TCAAAGCTTACACCAG TCTTGTAAACC–3′
(Kocher et al. 1989) and TDKD: 5′–CCTGAAGTAGGAACCAGATG–3′ (Kocher et al.1993), previously described for the species (Secchi et al. 1998; Lázaro et al. 2004; Méndezet al. 2008; Costa-Urrutia et al. 2012; Cunha et al. 2014). The PCR amplification protocolconsisted of one step of denaturation at 94 °C for 3 min; followed by 35 cycles, each oneinvolving denaturation at 94 °C for 1 min, annealing at 47 °C for 1 min and extension at72 °C for 1 min; and a final extension step at 72 °C for 5 min. Five microlitres of PCR pro-ducts were resolved in 1% agarose gel electrophoresis, visualised and photographed underUV light. The remaining 10 µL of the amplification products were purified using the EXO/SAP enzymatic methodology and sent to the Genomics Unit of the National AgriculturalTechnology Institute of Argentina where sequencing was performed in both directionswith the same oligonucleotide primers used in PCR reactions using an ABI 377 AutomatedDNA PrismTM Sequencer (Applied Biosystems Inc).
4 MF NEGRI ET AL.
Dow
nloa
ded
by [
JI T
únez
] at
08:
10 0
5 M
ay 2
016
Data analyses
Sequences were aligned and analysed for polymorphic sites using ClustalX 2.0.11. PHREDscores obtained for the DNA fragment finally analysed (434 bp) were always higher than20, indicating a base call accuracy higher than 99%. Aligned sequences were manuallyedited using Chromas, version 2.23. The haplotypes obtained were compared withthose previously published for the species (Secchi et al. 1998; Lázaro et al. 2004;Méndez et al. 2008; Costa-Urrutia et al. 2012; Cunha et al. 2014; GenBank accessionnumbers AF037593–94, AY644430–51, EF394099–4117, JN129291–96 and KF270687–92, respectively). The 31 sequences from the Claromecó sampling site obtained fromLázaro et al. (2004) were included in the analyses of genetic diversity in SouthernBuenos Aires. Thus, final sampling size for Claromecó was 45 individuals, for a total of75 used in this study. Haplotype and nucleotide diversities were estimated with DNAsp5.10.1 (Librado & Rozas 2009).
Phylogeographic structure
The median-joining network method (Bandelt et al. 1999) implemented in the Network4.5 program (Fluxus Technology Inc) was applied in order to estimate the phylogeo-graphic structure between haplotypes in FMA IV. This method, using a parsimony cri-terion, combines the minimum-spanning trees (MSTs) with a single network, allowingmore detailed population information than do strictly bifurcating trees (Posada & Cran-dall 1998). The analysis includes the new haplotypes obtained in the present study andthose obtained from Lázaro et al. (2004) and Méndez et al. (2008, 2010). Due to thelack of information in Méndez et al. (2008, 2010) about haplotype frequencies and geo-graphic location of each haplotype, we pooled these haplotypes in a single populationcalled ‘Northern and Eastern Buenos Aires’ (NEBA) and computed their frequencies as 1.
An analysis of molecular variance (AMOVA, Excoffier et al. 1992) including the newhaplotypes obtained in the present study and those obtained from Lázaro et al. (2004)for the Claromecó sampling site was performed in Arlequin 3.11 software (Excoffieret al. 2005) in order to estimate the partitioning of genetic variation in SouthernBuenos Aires. The significance of the observed F or Ф-statistics was tested using thenull distribution generated from 10,000 non-parametric random permutations of thedata matrix variables. The number of different alleles (FST-like) model was used tocompute distance matrix for ФST. Bahía Blanca was not included in this analysis due toits low sample size (n = 2). Population pairwise FST and ФST values were also calculatedin Arlequin 3.11 (Excoffier et al. 2005). Sequential Bonferroni corrections were appliedto adjust the statistical significance levels for multiple simultaneous comparisons (Rice1989). In addition, we carried out an exact test of population differentiation based in aMarkov-Chain procedure (Raymond & Rousset 1995).
Results
From the 44 samples analysed we found 11 haplotypes with a length of 434 bp and 21polymorphic sites (Table 1). When we compared our sequences with the haplotypes pre-viously reported for the distribution range of the species (Secchi et al. 1998; Lázaro et al.
NEW ZEALAND JOURNAL OF MARINE AND FRESHWATER RESEARCH 5
Dow
nloa
ded
by [
JI T
únez
] at
08:
10 0
5 M
ay 2
016
2004; Méndez et al. 2008; Costa-Urrutia et al. 2012; Cunha et al. 2014), we found two newhaplotypes in Necochea (N01 and N03) and also found that the sequences of another threehaplotypes (N02, N05 and N10) were coincident with haplotypes M3, C24 and M14 pre-viously described in Méndez et al. (2008) and Costa-Urrutia et al. (2012), but 27 nucleo-tides longer (Table 1). Thus, 58 haplotypes have been currently described in Pontoporiablainvillei.
Haplotype N08 was the most frequent, being found in 28 of the 44 individuals (63.64%)(Table 1). Only three other haplotypes were found in more than one individual. HaplotypeN06 was found in five individuals (11.36%), while haplotypes N04 and N05 were bothfound in two individuals (4.55%). Of the other seven haplotypes, four were unique inNecochea, two in Monte Hermoso and one in Claromecó (Table 1).
The analysis of intrapopulation genetic variability including samples from Lázaro et al.(2004) showed that haplotype diversity in Southern Buenos Aires was 0.75 ± 0.050 (Table 2).The highest values were found in Claromecó and Monte Hermoso sampling sites (H =0.78 ± 0.005 and 0.76 ± 0.13, respectively), while the lowest values were found for Neco-chea and Bahía Blanca (H = 0.63 ± 0.13 and 0.33 ± 0.22, respectively) (Table 2). Nucleotidediversity was similar for Southern Buenos Aires and most of the sampling sites (πn =0.012–0.013 ± 0.007–0.008) with the exception of Bahía Blanca, which showed thelowest value (πn = 0.007 ± 0.005) (Table 2). However, values of genetic diversity forBahía Blanca should be taken with caution due to its small sampling size.
The genealogical relationship between all available haplotypes for FMA IV is illustratedin Figure 2. It shows two main groups, composed of seven and 19 haplotypes, and fiveother haplotypes that are markedly different. Both main groups include individualsfrom the four sampling sites in Southern Buenos Aires and from Northern and EasternBuenos Aires. Haplotype N06, present in Necochea, Claromecó and Monte Hermoso, isconnected to many other haplotypes, showing a star-like topology suggestive of popu-lation expansion. N08, the most frequent haplotype, is the only one present in all samplingsites in Southern Buenos Aires. Only two of the haplotypes found in Northern and EasternBuenos Aires were also found in our sampling sites in Southern Buenos Aires (Table 1,Figure 2).
Results of the AMOVA analysis showed non-significant differences between sites inSouthern Buenos Aires when both the haplotype frequencies as well as molecular distanceswere considered (FST = 0.011, P = 0.26; ФST = 0.004, P = 0.42). The greatest source of vari-ation (for FST analysis = 98.93%, for ФST analysis = 99.6%) was found within populations.Pairwise comparisons of FST and ФST values indicated no genetic differences betweensampling sites (P > 0.27). Non-significant differences were confirmed by the exact testof population differentiation (P = 0.23) after 10,000 Markov steps done.
Discussion
Management units in Buenos Aires province
In the present study, we genetically characterised the franciscana dolphin population fromthe southern coast of Buenos Aires province including three sampling areas (Necochea,Monte Hermoso and Bahía Blanca) that had not been previously studied. When we com-pared our results with all the previously reported haplotypes along the species distribution
6 MF NEGRI ET AL.
Dow
nloa
ded
by [
JI T
únez
] at
08:
10 0
5 M
ay 2
016
Table 1. Relative position of variable nucleotides and haplotype frequencies in the mtDNA control region of franciscana dolphin, Pontoporia blainvillei, fromSouthern Buenos Aires.
Haplotype n
Relative position of variable nucleotide Distribution
N08 = L05 28 G A T C C C G C A A C T T C G T C G C T T 11 11 5 1N06 = SG = L10 5 . G . T T . . . . . T . . T . . . A T . C 1 2 2NO4 = L19 2 . G . T T . . . G . T . . T . . . A T . C 2N05* = C24 2 . G . T T . . . . . T . . T . . . A T C C 1 1N09 = L22 1 . . . . T . . . . G . C C T A . T A T . C 1N01 1 A G . T T . . . . . T . . T . . . A . . C 1N02*† =M03 1 . G . T T . A T . . T . . T . . . A T . C 1N03 1 . G . T T . . . G . T . . T A . . A T . C 1N07 = SK = L01 1 . . . . . . . . . . . . . T . . . A . . . 1N10*† =M14 1 . . . . T T . . . . . . . . A . . A T . C 1N11 = L06 1 . . C . . . . . . . . . . T . C . . . . . 1Total 44 18 14 10 2
Equivalences with previously reported haplotypes in the species are shown. References: N (01–11), this work; S, Secchi et al. (1998); L, Lázaro et al. (2004); M, Méndez et al. (2008); C, Costa-Urrutiaet al. (2012). New haplotypes and variable sites are marked in grey.
*These haplotypes are homologous to others previously described but 27 nucleotides longer.†Shared haplotypes between Northern/Eastern Buenos Aires and Southern Buenos Aires sampling sites.
NEW
ZEA
LANDJO
URN
ALOFMARIN
EANDFRESH
WATER
RESEARC
H7
Dow
nloa
ded
by [
JI T
únez
] at
08:
10 0
5 M
ay 2
016
range (Secchi et al. 1998; Lázaro et al. 2004; Méndez et al. 2008; Costa-Urrutia et al. 2012;Cunha et al. 2014), we found that haplotype N08, the most frequent in our data set, wasexclusive to this management area and could be considered as a site-specific marker.AMOVA results showed that sampling sites in Southern Buenos Aires did not show differ-ences in haplotype frequencies. Regrettably, we could not test if our sampling sites weregenetically different from those from the Northern, Eastern and southernmost coast ofBuenos Aires province due to the lack of information in Méndez et al. (2008, 2010)about haplotype frequencies in these areas. However, our results suggest that geneticdifferences between Northern, Eastern and Southern Buenos Aires sites are very likely,because only two of the 19 haplotypes found by Méndez et al. (2008) in NorthernBuenos Aires sites were also found in our sampling sites in Southern Buenos Aires.Thus, our data, which include new sampling areas in Necochea, Monte Hermoso andBahía Blanca, would be in accordance with previous works (Méndez et al. 2010; Cunhaet al. 2014) giving support to the existence of at least three different franciscana genetic
Table 2. Genetic diversity in the mtDNA control region of franciscana dolphins and relatedodontocetes.
N n bp h (±SD)* π (±SD)* Reference
Franciscana dolphin, Pontoporia blainvilleiRio de Janeiro,Brazil
10 5 486 0.67 0.004 Secchi et al. (1998)
Northern SãoPaulo, Brazil
8 4 455 0.79 0.008 Cunha et al. (2014)
Central SãoPaulo, Brazil
19 5 455 0.74 0.011 Cunha et al. (2014)
Southern SãoPaulo, Brazil
7 2 455 0.48 0.001 Cunha et al. (2014)
Santa Catarina,Brazil
17 4 455 0.67 0.009 Cunha et al. (2014)
Rio Grande,Brazil
14 5 507 0.82 0.009 Secchi et al. (1998), Lázaro et al. (2004)
Uruguay 38 13 507 0.82 0.009 Lázaro et al. (2004)SBA, Argentina 75 18 434 0.75 (0.05) 0.012 (0.007) Lázaro et al. (2004), this workNecochea 18 7 434 0.63 (0.13) 0.012 (0.007) This workClaromecó 45 12 434 0.78 (0.05) 0.013 (0.007) Lázaro et al. (2004), this workMonte
Hermoso,10 5 434 0.76 (0.13) 0.013 (0.008) This work
Bahía Blanca 2 2 434 0.33 (0.22) 0.007 (0.005) This workHector’s dolphin, Cephalorhynchus hectori, New ZealandNorth Island(C. h. maui)
Beluga, Delphinapterus leucas, Alaska, USACook Inlet 37 5 410 0.524 0.002 O’Corry-Crowe et al. (1997)Bristol Bay 24 3 410 0.163 0.001 O’Corry-Crowe et al. (1997)Norton Sound 66 5 410 0.492 0.002 O’Corry-Crowe et al. (1997)
N, sample size; n, number of haplotypes; bp, base pairs sequenced; h, haplotype diversity; π, nucleotide diversity; SBA,Southern Buenos Aires.
*Values reported in Hamner et al. (2012) and those obtained in this study. SD values were not reported in the other studies.
8 MF NEGRI ET AL.
Dow
nloa
ded
by [
JI T
únez
] at
08:
10 0
5 M
ay 2
016
populations in Buenos Aires province: (1) Northern Buenos Aires (FMA IVa), includingsamples from Bahía Samborombón West and South (Méndez et al. 2010); (2) EasternBuenos Aires (FMA IVb), including samples from Cabo San Antonio and Buenos AiresEast (Méndez et al. 2010); and (3) Southern Buenos Aires (FMA IVc), includingsamples from Necochea, Claromecó, Monte Hermoso and southern areas (Méndezet al. 2010; this work). However, further analyses are needed to test for the existence ofgenetic differences between the new sampling areas (Necochea and Monte Hermoso)and populations in Northern and Eastern Buenos Aires, as well as between the formerand populations in the southern extreme of the franciscana dolphin’s distribution inRio Negro and Chubut provinces. In addition, our study presents only mtDNA data,which reflects only the pattern of female dispersal and does not discount male-biasedgene flow among the populations. New studies including other molecular markers asmicrosatellites would provide valuable information to clarify the pattern of the geneticdifferentiation in FMA IV.
Genetic diversity
The haplotype diversity value found in Southern Buenos Aires (H = 0.75 ± 0.05) is mostlyhigher than those reported for endangered or near threatened odontocetes such as theHector’s dolphin, Cephalorhynchus hectori (H = 0.00 to 0.75 ± 0.04; Hamner et al.2012), the humpback dolphin, Sousa chinensis (H = 0.65; Smith-Goodwin 1997) or thebeluga, Delphinapterus leucas (H = 0.16–0.52; O’Corry-Crowe et al. 1997) (Table 2).However, the comparison of our data with previously reported values of intrapopulationgenetic diversity at franciscana dolphin sampling sites showed that Necochea has the
Figure 2. Genealogical relationships between the franciscana dolphin haplotypes analysed. Circle areasare proportional to haplotype frequencies and length of the branches to the number of changes fromone haplotype to the following. Haplotype numbers correspond to those in Table 1, Lázaro et al. (2004)and Méndez et al. (2008). Colour key: black, Necochea; white, Claromecó; light grey, Monte Hermoso;vertical lines, Bahía Blanca; dark grey, Northern and Eastern Buenos Aires.
NEW ZEALAND JOURNAL OF MARINE AND FRESHWATER RESEARCH 9
Dow
nloa
ded
by [
JI T
únez
] at
08:
10 0
5 M
ay 2
016
second-lowest haplotype diversity (H = 0.63 ± 0.13) after southern São Paulo (H = 0.48;Cunha et al. 2014), followed by Río de Janeiro (H = 0.67) (Secchi et al. 1998) and SantaCatarina (H = 0.67; Cunha et al. 2014) (Table 2). Claromecó and Monte Hermososhowed intermediate values (0.78 ± 0.05 and 0.76 ± 0.13, respectively), while the highestones were found in Rio Grande and Uruguay (H = 0.82) (Lázaro et al. 2004) (Table 2).One possibility to explain the low level of genetic diversity found in Necochea is thelow sampling size (n = 18). Mendez et al. (2010) found that in franciscana dolphins, hap-lotype diversity is significantly correlated to sample size among locations. However, othersampling locations along the franciscana distribution, such as Northern São Paulo, RioGrande and Monte Hermoso, show higher values of genetic diversity and lower samplingsizes (Table 2). Another possibility to explain the low level of genetic diversity in Necocheais the high impact suffered by the population from incidental mortality in gillnets of theartisanal fleet during the 1980s and 1990s. In those years, tope sharks, Galeorhinus galeus,were harvested with 140 mm mesh-size gillnets resulting in more than 400 franciscanadolphins killed in Necochea alone (Corcuera 1994). Whatever the cause of the lowgenetic diversity found in Necochea, it has to be taken into account in future conservationplans for the population, since loss of genetic diversity can lead to a decrease in reproduc-tive success (Luck et al. 2003; Freeland 2005). Increased removal of dolphins from stockswith lower genetic diversity, those in the southern and northern extremes of the speciesdistribution, would increase the adverse effects from the incidental mortality that thespecies currently suffers throughout its range.
Acknowledgements
This study would not have been possible without the unconditional collaboration of the artisanalfishing communities of Southern Buenos Aires; we are indebted to all of them. We wish tothank M.V. Panebianco, M.N. Paso Viola, M. Negri, F. Pérez, R. Gutiérrez, D. del Castillo andV. Di Martino for fieldwork assistance. We also thank the park rangers and personnel of the pro-tected areas of the region, M. Sotelo, M.V. Massola and A. Areco; and the technicians of the Esta-ción Hidrobiológica de Puerto Quequén, K. Arias and L. Nogueira. We are grateful to DiegoRodríguez and Pablo Denuncio for the five tissue samples of franciscana dolphins from Claromecó.Researchers of the ‘Laboratorio de Herramientas Moleculares del MACN’ were of great help duringthe procedures: P. Mirol, V. Raimondi, A. Fameli, J. Fernández, J. Pereira and J. Rojo. Thanks aredue to A. Holzer from the Zoology Department of Cavanilles Institute, University of Valencia,Spain, for her training and advice. We are grateful to D. Golombek (University of Quilmes), andP. Schwarzbaum and R. Bernabeu (Univeristy of Buenos Aires) for their support.
Associate Editor: Dr Richard Taylor.
Disclosure statement
No potential conflict of interest was reported by the authors.
Funding
This work was supported by the University of Valencia, Yaqu Pacha, Fundación de Historia NaturalFélix de Azara, Cetacean Society International and Society for Marine Mammalogy. A postgraduatefellowship was provided by the Consejo Nacional de Investigaciones Científicas y Técnicas to MFNegri.
10 MF NEGRI ET AL.
Dow
nloa
ded
by [
JI T
únez
] at
08:
10 0
5 M
ay 2
016
References
Allendorf FW, Luikart GH, Aitken SN. 2013. Conservation and the genetics of populations. 2nd ed.Oxford: Wiley-Blackwell.
Andrade A, Pinedo MC, Pereira Jr J. 1997. Franciscanas from southern Brazil, Uruguay and NorthArgentina coasts: are one or more ecological stocks? Report of the International WhalingCommission. 47:669–673.
Aznar FJ, Raga JA, Corcuera J, Monzón F. 1995. Helminths as biological tags for franciscana(Pontoporia blainvillei) (Cetacea, Pontoporiidae) in Argentinian and Uruguayan waters.Mammalia. 59:427–435.
Bandelt HJ, Forster P, Rohl A. 1999. Median-joining networks for inferring intraspecific phyloge-nies. Mol Biol Evol. 16:37–48.
Barbato BHA, Secchi ER, Di Beneditto APM, Ramos RMA, Bertozzi C, Marigo J, Bordino P, KinasPG. 2012. Geographical variation in franciscana (Pontoporia blainvillei) external morphology. JMar Biol Assoc UK. 92:1645–1656.
Bastida R, Rodríguez D, Secchi E, Da Silva V. 2007. Mamíferos Acuáticos de Sudamérica yAntártida. Buenos Aires: Vázquez Mazzini.
Bordino P, Wells RS, Stamper MA. 2008. Satellite tracking of Franciscana dolphins Pontoporiablainvillei in Argentina: preliminary information on ranging and social patterns. Libro deResúmenes XIII Reunión de Trabajo de Especialistas en Mamíferos Acuáticos de América delSur y 7° Congreso SOLAMAC. Montevideo, Uruguay, 13–17 October 2008.
Botta S. 2011. Uso do habitat e identificação de unidades populacionais de pequenos cetáceos doAtlântico Sul–Ocidental através de isótopos estáveis e elementos traço [Unpublished PhDthesis]. Rio Grande, Brazil: Universidade Federal do Rio Grande.
Cappozzo HL, Negri MF, Pérez FH, Albareda D, Monzón F, Corcuera JF. 2007. Incidental mortality offranciscana dolphin, (Pontoporia blainvillei), in Argentina. Lat Am J Aquat Mammals. 6:127–137.
Corcuera J. 1994. Incidental mortality of franciscanas in Argentine waters: the threat of smallfishing camps. Report of the International Whaling Commission, Special Issue. 15:29–294.
Costa-Urrutia P, Abud C, Secchi ER, Lessa EP. 2012. Population genetic structure and social kinassociations of franciscana dolphin, Pontoporia blainvillei. J Hered. 103:92–102.
Crespo EA, Corcuera JF, López Cazorla A. 1994. Interactions between marine mammals and fish-eries in some coastal fishing areas of Argentina. Report of the International WhalingCommission, Special Issue. 15:269–281.
Crespo EA, Harris G, González R. 1998. Group size and distributional range of the franciscanaPontoporia blainvillei. Mar Mammal Sci. 14:845–849.
Cunha HA, Medeiros BV, Barbosa LA, Cremer MJ, Marigo J, Lailson-Brito J, Azevedo AF, Solé-Cava AM. 2014. Population structure of the endangered franciscana dolphin (Pontoporia blain-villei): reassessing management units. PLoS ONE. 9:e85633.
Denuncio P. 2012. Biología y conservación del delfín del Plata (Pontoporia blainvillei) en el sectorcostero bonaerense [Unpublished PhD thesis]. Mar del Plata, Argentina: Universidad Nacionalde Mar del Plata.
Excoffier L, Laval G, Schneider S. 2005. Arlequin ver. 3.0: an integrated software package for popu-lation genetics data analysis. Evol Bioinform Online. 1:47–50.
Excoffier L, Smouse P, Quattro J. 1992. Analysis of molecular variance inferred from metric dis-tances among DNA haplotypes: application to human mitochondrial DNA restriction data.Genetics. 131:479–491.
Frankham R, Ballou JD, Briscoe DA. 2010. Introduction to conservation genetics. 2nd ed.Cambridge: Cambridge University Press.
Freeland JR. 2005. Molecular ecology. Chichester: John Wiley & Sons, Ltd.Geraci JR, Lounsbury VJ. 1993. Marine mammals ashore. A field guide for strandings. Galveston:
A&M University Sea Grant College Program Publication.
NEW ZEALAND JOURNAL OF MARINE AND FRESHWATER RESEARCH 11
Dow
nloa
ded
by [
JI T
únez
] at
08:
10 0
5 M
ay 2
016
Hamner BM, Pichler FB, Heimeier D, Constantine R, Baker CS. 2012. Genetic differentiation andlimited gene flow among fragmented populations of New Zealand endemic Hector’s and Maui’sdolphins. Conserv Genet. 13:987–1002.
Higa A, Hingst–Zaher E, de Vivo M. 2002. Size and shape variability in the skull of Pontoporiablainvillei (Cetacea: Pontoporiidae) from the Brazilian coast. Lat Am J Aquat Mammals.1:145–152.
Kocher TD, Conroy JA, McKaye KR, Stauffer JR. 1993. Similar morphologies of cichlid fish in LakesTanganyika and Malawi are due to convergence. Mol Phylogenet Evol. 2:158–165.
Kocher TD, Thomas WK, Meyers A, Edwards SV, Paabo S, Villablanca FX, Wilson AC. 1989.Dynamics of mitochondrial DNA evolution in animals: Amplification and sequencing with con-served primers. P Natl Acad Sci USA. 86:6196–6200.
Lacy RC. 1997. Importance of genetic variation to the viability of mammalian populations. JMammal. 78:320–335.
Lázaro M, Lessa EP, Hamilton H. 2004. Geographic genetic structure in the franciscana dolphin(Pontoporia blainvillei). Mar Mammal Sci. 20:201–214.
Librado P, Rozas J. 2009. DnaSP v5: a software for comprehensive analysis of DNA polymorphismdata. Bioinformatics. 25:1451–1452.
Luck GW, Daily GC, Ehrlich PR. 2003. Population diversity and ecosystem services. Trends EcolEvol. 18:331–336.
Méndez M, Rosenbaum HC, Bordino P. 2008. Conservation genetics of the franciscana dolphin inNorthern Argentina: population structure, by-catch impacts, and management implications.Conserv Genet. 9:419–435.
Méndez M, Rosenbaum HC, Subramaniam A, Yackulic C, Bordino P. 2010. Isolation by environ-mental distance in mobile marine species: molecular ecology of franciscana dolphins at theirsouthern range. Mol Ecol. 19:2212–2228.
Mills LS, Smouse PE. 1994. Demographic consequences of inbreeding in remnant populations. AmNaturalist. 144:412–431.
Negri MF. 2011. Estudio de la biología y ecología del delfín franciscana, Pontoporia blainvillei, y suinteracción con la pesquería costera de la Provincia de Buenos Aires [Unpublished PhD thesis].Buenos Aires, Argentina: Universidad de Buenos Aires.
Negri MF, Denuncio P, Panebianco MV, Cappozzo HL. 2012. Bycatch of franciscana dolphinsPontoporia blainvillei and the dynamic of artisanal fisheries in the species’ southernmost areaof distribution. Braz J Oceanogr. 60:149–158.
Negri MF, PanebiancoMV, Denuncio P, Paso ViolaMN, Rodríguez D, CappozzoHL. 2014. Biologicalparameters of franciscana dolphins, Pontoporia blainvillei, by–caught in artisanal fisheries offsouthern Buenos Aires, Argentina. J Mar Biol Assoc UK. doi:10.1017/S0025315414000393.
O’Corry-Crowe GM, Suydam RS, Rosenberg A, Frost KJ, Dizon AE. 1997. Phylogeography, popu-lation structure and dispersal patterns of the beluga whale Delphinapterus leucas in the WesternNearctic revealed by mitochondrial DNA. Mol Ecol. 6:955–970.
O’Grady JJ, BrookBW,ReedDH,Ballou JD,TonkynDW,FrankhamR.2006.Realistic levels of inbreed-ing depression strongly affect extinction risk in wild populations. Biol Conserv. 133:42–51.
Ott PH. 2002. Diversidade genética e estrutura populacional de duas espécies de cetáceos doAtlântico Sul Ocidental: Pontoporia blainvillei e Eubalaena australis [Unpublished PhDthesis]. Rio Grande, Brazil: Universidade Federal do Rio Grande do Sul.
Panebianco MV, Botte SE, Negri MF, Marcovecchio JE, Cappozzo HL. 2012. Heavy Metals in Liverof the Franciscana Dolphin, Pontoporia blainvillei, from the Southern Coast of Buenos AiresProvince, Argentina. J Braz Soc Ecotox. 7:33–41.
Panebianco MV, Negri MF, Botte SE, Marcovecchio JE, Cappozzo HL. 2011. Metales pesados en elriñón del delfín franciscana, Pontoporia blainvillei (Cetacea: Pontoporiidae) y su relación conparámetros biológicos. Lat Am J Aquat Res. 39:526–533.
Panebianco MV, Negri MF, Botte SE, Marcovecchio JE, Cappozzo HL. 2013. Essential and non-essential heavy metals determination in skin and muscle tissues in franciscana dolphins(Pontoporia blainvillei) from Argentina southern coast. Chem Ecol. 29:511–518.
Paso Viola MN. 2014. Ecología trófica del delfín franciscana Pontoporia blainvillei, en el sur de laprovincia de Buenos Aires, Argentina [Unpublished PhD thesis]. Buenos Aires, Argentina:Universidad de Buenos Aires.
Paso Viola MN, Denuncio P, Negri MF, Rodríguez D, Bastida R, Cappozzo HL. 2014. Diet compo-sition of franciscana dolphin Pontoporia blainvillei from southern Buenos Aires, Argentina andits interaction with fisheries. Revista de Biología Marina y Oceanografía. 49:393–400.
Pinedo MC. 1991. Development and variation of the franciscana (Pontoporia blainvillei)[Unpublished PhD thesis]. Santa Cruz, CA: University of California.
Polizzi PS, Chiodi-Boudet LN, Romero MB, Denuncio PE, Rodriguez DH, Gerpe MS. 2013. Finescale distribution constrains cadmium accumulation rates in two geographical groups of francis-cana dolphin from Argentina. Mar Pollut Bull. 72:41–46.
Posada D, Crandall KA. 1998. MODELTEST: testing the model of DNA substitution.Bioinformatics. 14:817–818.
Raymond M, Rousset F. 1995. An exact test for population differentiation. Evolution. 49:1280–1283.Reeves RR, Dalebout M, Jefferson TA, et al. 2012. Pontoporia blainvillei. In: IUCN 2013, editor.
IUCN red list of threatened species, Version 2013.2 [Internet]. [cited 2015 Apr 10]. Availablefrom http://www.iucnredlist.org
Rice WW. 1989. Analysing tables of statistical tests. Evolution. 43:223–225.Sambrook J, Fritsch EF, Maniatis T. 1989. DNA extraction from mammalian cells. In: Sambrook J,
Fritsch EF, Maniatis T, editors. Molecular cloning. A laboratory manual, 2nd ed. New York: ColdSpring Harbor Laboratory Press; p. 9–16.
Secchi ER, Danilewicz D, Ott PH. 2003. Applying the phylogeographic concept to identify francis-cana dolphin stocks: implications to meet management objectives. Journal of Cetacean Researchand Management. 5:61–68.
Secchi ER, Wang JY, Murray BW, Rocha–Campos C, White BN. 1998. Population differentiation inthe franciscana (Pontoporia blainvillei) from two geographic locations in Brazil as determinedfrommitochondrial DNA control region sequences. Canadian Journal of Zoology. 76:1622–1627.
Siciliano S. 1994. Review of small cetaceans and fishery interactions in coastal waters of Brazil.Report of the International Whaling Commission. 15:241–250.
Smith-Goodwin JA. 1997. A molecular genetic assessment of the population structure and variationin two inshore coastal dolphin genera on the east coast of South Africa [Unpublished PhDthesis], Grahamstown, South Africa: Rhodes University.
Valsecchi E, Zanelatto RC. 2003.Molecular analysis of the social and population structure of the fran-ciscana (Pontoporia blainvillei): conservation implications. J Cetacean Res Manag. 5:69–75.
Wang JY. 2002. Stock identity. In: Perrin WF, Wursig B, Thewissen JGM, editors. Encyclopaedia ofmarine mammals. San Diego, CA: Academic Press; p. 1189–1192.
NEW ZEALAND JOURNAL OF MARINE AND FRESHWATER RESEARCH 13
