Vol. 46, No. 2, October 1998 BIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL Pages 277-286

HIV-1 NEF PROTEIN CAUSES DEATH IN STRESSED YEAST CELLS DUE TO

DETERMINANTS NEAR THE N-TERMINUS AND ELSEWHERE IN NEF

I. Macreadie, S. Sankovich, P. Failla, M. Lowe, C. Curtain, L. Castelli, and A. Azad

Biomolecular Research Institute, 343 Royal Parade, Parkville, Victoria, Australia.

Received May 25, 1998

SUMMARY The Human Immunodeficiency Virus type 1 (HIV-1) Nef protein is essential for AIDS pathogenesis. In order to determine more about the effects of Nef on basic cellular functions Nef was produced in yeast under a variety of conditions and in multiple cell types. Production of Nef caused cell death in acutely copper- or heat-stressed diploid cells. The N-terminal melittin-like region of Nef was involved in toxicity since a Trp5-+Ala change within Nef change caused increased toxicity. However, another determinant was also involved in toxicity since production of Nef20-206 was also still toxic. In each of these Nef-producing cells there was coincident membrane permeabilisation. These results suggest the possibility of a novel yeast bioassay for Nef inhibitors and that cells producing high levels of Nef may be selectively killed by stress.

INTRODUCTION Considerable evidence from in vivo studies argues for a positive and essential role for Nef

in AIDS pathogenesis (1-10), however, Nef's role in disease progression is still unclear. In

certain conditions Nef has a profound effect on cell functions and/or viability. Studies with

transgenic mice show that Nef perturbs activation and development of T cells (11), and the

development of the eye lens (12), as well causing epidermal hyperplasia (13). Using severe

combined immunodeficiency mice, Nef was shown to cause depletion of CD4 + T lymphocytes

(14) and thymocytes (15). In cell culture fewer effects from Nef have been noted but Nef has

been reported to inhibit the growth of CD4 § T lymphocytes (16), and macrophages (17). In

addition, Nef is reported to stimulate B-cell activity (18), to cause abnormal hematopoiesis in

bone marrow progenitor cells (19), and externally-added Nef, or N-terminal fragments of Nef,

have the capacity to kill human cells (20-24). Despite these studies much remains to be learned

on the role of Nef in H1V-1 pathogenesis.

In view of its interactions with basic functions common to eukaryotes it is important to

consider the activities of Nef in a model eukaryotic system such as yeast. In yeast, we previously

showed that Nef was myristylated, perturbed membranes and was released from the cell during

stress conditions (25-27). Nef caused no profound growth defect in those studies, but we now

277

1039-9712/98/140277-10505.00/0 Copyright (~11998 by Academic Press Australia.

All rights t(reptv~duction in arty form reserved.

Vol. 46, No. 2, 1998 BIOCHEMISTRYond MOLECULAR BIOLOGY INTERNATIONAL

report that Nef affects yeast cell viability under conditions of more acute stress with copper or

heat. This allows us to gain new insights into Nef function and to screen inhibitors of this

activity that may be suitable for AIDS therapy.

METHODS

Expression of HIV-1 ne[ in yeast:. The source of the Nef gene was pNLA-3 (28). Saccharomyces cerevisiae transformants producing Nef under the control of copper-inducible, CUP1 promoter have been described in our previous work (25-27, 29). The yeast expression vector was pYEX-BX TM. Expression of nef using the constitutive PGK promoter employed the vector pYEX-S1TM and has been described previously (26), except for pYEX-S1.Nef25 which was constructed using the same strategy as that previously described for pYEX-S 1.Nef27 (26). The expression vectors pYEX-BX and pYEX-S 1 were identical except for the CUP1 and PGK transcriptional regulatory sequences for the expression of nef; sequences in pYEX-S 1 encoding a secretion signal were removed following EcoRI digestion. Host strains were DY150 MATa ura3-52 leu2-3,112 trpl-1 ade2-1 his3-11, DBY745 MATa ura3-52 leu2-3,112 adel-lO0, and DMY100, the diploid of DY150 and DBY745. Transformants were grown in minimal medium (0.67% Difco yeast nitrogen base without amino acids, 2% glucose) supplemented with 20 ].tg/ml adenine, histidine, and tryptophan where required. Media were solidified with 2% Phytagar TM.

Toxicity of HIV-1 Nef in yeast: Cells were suspended at 107 cells/ml and 50 gl aliquots were dropped onto solidified media. Growth was scored after 2 days incubation at 28~ or higher temperature. For quantitative testing of Nef toxicity, transformed diploid cells growing in log phase were induced with CuSO4 or temperature shifted for appropriate times and cells were plated onto YEPD (1% yeast extract, 2% peptone, 2% glucose) to determine cell viability.

Site directed mutagenesis of HIV-1 Nef: Tryptophan codons in the melittin-like motif of Nef were substituted with alanine codons. This was performed by replacing the unique BamHI-CellI fragment of nef in pYEX-BX.Nef27 with synthetic oligonucleotide duplexes containing the appropriate new codons. Replacements were confirmed by restriction enzyme digestion and nucleotide sequence analysis. The oligonucleotides employed are as follows. The nefstart codon is shown in italics and codon changes are shown in bold. For the Ala5 Alal3 construct a SacI site (underlined) was created: 5 ' GATCCATGGGTGGCAAGGCATCAAAAAGTAGTGTGATTGGAGCTCCTGCTGTAAGGGAAAGAATGAGACGAGC

G TA CCCACCGTTCCGTAGTTTTTCATCACAC TAAC CTCGAGGACGACATTC CCTTTC TTACTCTGC TCGACT

Additional oligonucleotide duplexes bearing each of the above codon changes were also produced to make single Trp---)Ala changes. Constructs produced by this method were denoted pNef27/A5.A 13, pNef27/A5, and pNef27/A 13.

Flow cytometric analysis: Cells were analysed for PI fluorescence using a Coulter EPICS | Elite flow cytometer. PI was added to 25 gg/ml and dye penetration was measured by the presence of fluorescence emission at 520 nm. Gating was adjusted such that approximately 5% of the control DMY100 [pYEX-BX] cell population were defined as "PI stained".

RESULTS

Cytotoxicity of Nef in yeast diploid cell. In order to assess the effects of Nef on cell growth,

the Nef gene was expressed in yeast under the control of the copper-inducible CUP1 promoter.

Consistent with our previous observations (30), the growth of haploid DY150 cells transformed

278

Vol. 46, No. 2, 1998 BIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL

with pYEX-BX and pYEX-BX.Nef27 appeared similar to each other on solidified growth media

regardless of the copper-induction level. That is, the growth of Nef producers was

indistinguishable from non-producers in the presence of 0.75 mM CuSO4, the highest level of

copper that permits DY150 cell growth. In the presence of 1.0 mM CuSO4 growth ceased in all

haploid transformants due to copper toxicity (data not shown).

Diploid (2n chromosome number) transformants, obtained from the genetic crossing of

the DYI50 transformants to DBY745 to produce strain DMY100, were similarly examined. The

various diploid transformant cells exhibited no difference in growth on copper levels up to 0.75

mM (Table 1). However, Nef had a profound effect on growth in the presence of 1.0 mM

CuSO4. In cells producing Nef, growth was totally inhibited, while in control transformants

producing no Nef, growth was not inhibited (Table 1). Because this effect may have arisen due

to some unforeseen peculiarity of the DBY745 parent, strain DBY745 itself was re-transformed

with the plasmids. In DBY745 transformants, there was no difference in the growth of

transformants that produced Nef and those that lacked Nef in the presence of copper

concentrations from 0 to 1.0 mM (data not shown). The possibility that toxicity is due to foreign

protein production p e r se is also excluded since DMY100 transformants producing a variety of

other proteins have not exhibited toxicity (data not shown). This suggested that the toxicity was

specific to the diploid cell type, a point that is addressed in further detail below.

Table 1. Copper toxicity related to p lasmids

Plasmid N-terminal sequences o f Nef produced in transformants

pYEX-BX No Nef pYEX-BX.Ne~7 ~GGKWSKSSVIGWPAVRERMRR pYEX-SI.Ne~7 ~GGKWSKSSVIGWPAVRERMRR pYEX-BX.Ne~5 MRR

pNe~7/A5.AI3* mGGKASKSSVIGAPAVRERMRR pNe~7/A5 ~GGKASKSSVIGWPAVRERMRR

mGGKWSKSSVIGAPAVRERMRR pNef27/A 13

Growth o f yeast transformants vs. [copper] m M

0 .25 .50 .75 1.0 1.5

++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ -

++ ++ ++ ++ -

++ ++ + ++ ++ + ++ ++ ++ ++ -

Diploids containing the above plasmids were assayed for growth from a monolayer of cells suspended on solidified minimal medium containing various amounts of CuSO4. Growth was scored after 2 days and is denoted as: ++ uninhibited growth, + reduced growth, - no growth. * produced the same toxicity in the DY150 haploid. Myristylation is represented as m.

279

Vol. 46, No. 2, 1998 BIOCHEMISTRYond MOLECULAR BIOLOGY INTERNATIONAL

Cytotoxicity of Nef is dependent on acute stress: Employing a yeast vector for constitutive

expression, pYEX-S1, Nef was produced without the requirement for copper induction. In

pYEX-S 1, the PGK promoter was utilised to obtain constitutive production of Nef, as previously

described (26). Once again diploid-specific toxicity was only observed with stress, such as in the

presence of copper ions (Table 1).

Using this constitutive expression system we also examined the effect of heat stress in the

absence of copper. We previously observed that the growth of DMYI00 [pYEX-S 1.Nef27] at

36~ was similar to the growth of the control DMY100 [pYEX-BX], but the growth at this

temperature or at 37~ led to the stress-dependent release of considerable amounts of Nef (26).

While the control strain, DMYI00 [pYEX-BX], grew at 38~ Nef-producing transformants

were completely unable to grow at 38~ (Table 1). These data indicate that Nef production

under conditions of extreme heat- and copper-stress leads to cytotoxicity in diploid cells.

Nef is cytocidal to copper- and heat-stressed cells: The effect of Nef production in diploid

transformants in liquid cultures was further examined by plating out cells to measure viability

after the addition of copper. In liquid culture, we found that copper toxicity was present at the

lower concentration of 0.75 mM CuSO4 (Fig. 1, Left panel). This is expected as copper is more

available in the liquid medium. In 0.50 mM CuSO4 the copper toxicity was absent and the cells

producing no Nef grew with little inhibition (Fig. 1, Left panel). However, of the transformants

producing Nef, about 95% were killed within three hours of induction in 0.5 mM CuSO4.

Nef cytocidal activity was also measured in the absence of copper using the constitutive

Nef producer, DMY100 [pYEX-S1.Nef27], that cannot maintain growth at 38~ After four

hours at 37~ Nef production killed two-thirds of the Nef-producing cells while there was no loss

of viability with a non-producer (Fig. 1, Right panel). A temperature shift to 40~ resulted in

90% killing of the Nef producers, although such high temperatures also contributed to 50% death

in the control DMY100 [pYEX-BX] transformants treated under the same culture conditions

(Fig. 1, Right panel). We conclude from these results that Nef exerts a cytocidal effect on Nef-

producing diploid yeast cells that are subjected to stress.

Multiple sequences affect the toxicity of Nef: Because of the melittin-like structure in the

amino-terminal region of Nef (30, 31), the effect of the bulky tryptophans near the N-terminus of

Nef was examined. By oligonucleotide substitution, the two tryptophans, Trp5 and Trpl3, were

changed to alanine. These mutations did not affect the consensus sequence that directs

280

Vol. 46, No. 2, 1998 BIOCHEMISTRYond MOLECULAR BIOLOGY INTERNATIONAL

% kill lOO

80

60

40

20

O o

l Protein produce~ DNone BNef j -

Figure 1.

0.5 0.75

[copper] mM, for induction

Cytotoxicity of Nef in yeast.

% kill 1:)0

30

60

40

20

0

Protein produce~ [-1None I N e l /- -

28~ 37% 40~

Temperature

Left panel. DMYI00 transformants containing pYEX- BX, and pYEX-BX.Nef27 were grown in liquid minimal synthetic media and various amounts of CuSO4 as indicated. After 3 hours cells were plated onto solidified medium without copper to determine the number of survivors. Right panel. DMY100 transformants containing pYEX-BX, and pYEX-S 1.Nef27 were grown in liquid minimal synthetic media at 28~ Aliquots of the pre- culture were cultured for a further 4 hours at 28~ 37~ and 40~ and then cells were plated onto solidified medium to determine the number of survivors.

myristylation of the N-terminal glycine (33) and did not abolish the stress-dependent release of

Nef from the cell (data not shown). Transformants producing the Nef/Ala5 and Nef/Ala5Alal3

changes showed increased Nef toxicity on copper plates, while the Alal3 change had no effect

(Table 1). Thus Trp5 appears to be a residue that reduces Nef toxicity. The effect of the

mutations was routinely examined in haploid cells and, for the first time, an effect of mutant Nef

in a haploid transformant was observed. Both the Ala5 and Ala5.Alal3 changes led to increased

and profound Nef toxicity in the haploid (Table 1). This observation is most noteworthy, since it

suggests that our previous observation on diploid 'specific' toxicity is a "diploid enhanced

toxicity". Although the above result indicates that the presence of tryptophan at residue 5

contributes to Nef toxicity, the production of Nef20-206 also led to toxicity (Table 1). Similar

results were obtained regarding the effect of Nef on heat sensitivity. Both Nef27/Ala5 and Nef20-

2o6 also led to toxicity (Table 2), indicating that at least two determinants are involved in Nef

toxicity. We cannot exclude the possibility that these determinants act in concert with each

other. Further experiments are required to resolve this complicated issue.

Cell permeabilisation caused by Nef: On the basis of its similarity to bee venom melittin, the

N-terminal portion of Nef was predicted to have membrane perturbing activities (31). Indeed,

281

Vol. 46, No. 2, 1998 BIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL

Table 2. Heat toxicity related to plasmids

Plasmid 28~ pYEX-BX ++ pYEX-S 1 .Nef27 ++ pYEX-S 1 .Nef25 ++ pNef27/A5 ++

Culture temperature 36~ 37~

++ ++ ++ + ++ + + +

38~ -H-

Diploids containing the above plasmids were assayed for growth from a monolayer of cells suspended on solidified minimal medium. Growth was scored after 2 days and is denoted as: ++ uninhibited growth, + reduced growth, - no growth. Further details of plasmids are in Table 1.

synthetic peptides corresponding to the N-terminus of Nef were shown to perturb membranes so

this effect was examined as a possible mechanism of Nef cytocidal activity (24, 31, 34).

Membranes of living or non-compromised cells normally exclude dyes such as PI, enabling

populations to be conveniently and rapidly analysed by flow cytometry (35). In a normal

population of DMYI00 [pYEX-BX] cells, just the few percent of cells that are dead or dying

stain with PI (Fig. 2). For cells constitutively producing Nef, however, the amount of stained

cells was approximately 20% even though they were all viable. It is tempting to think that this

staining might correspond to membrane permeabilisation that we have observed with synthetic

portions of the Nef N-terminus (24, 31, 34). Indeed, in support of this the Trp5Ala change

doubled the extent of permeabilisation (Fig. 2). On the other hand, however, when the N-

terminus was totally absent there was a similar degree of permeabilisation to native Nef (Fig. 2).

Like cell killing, these data support roles for Nef-induced permeabilisation through multiple

determinants. Since under the 28~ growth conditions used in these experiments Nef caused no

cell death, the observed permeabilisation must be due to some non-lethal perturbation of the cell

membrane.

DISCUSSION

This study demonstrates that in yeast there is cytotoxicity associated with the production

of Nef in copper- or heat-stressed diploid yeast cells. This results in cell killing at stress levels

that are extreme but normally tolerable. We previously showed that Nef was released during

stress (26, 27), but the stress conditions were not as great as those employed in this study and

growth was not blocked. Higher Nef production in diploids compared with haploids may be the

cause of the apparent increased toxicity in diploids (data not shown). Another explanation relates

to diploid gene expression or cell physiology: different sets of genes are expressed in diploids,

282

Vol, 46, No. 2, 1998 BIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL

40

35

30

25

20

15

10

5

0

% stained

None Nef N ef 2o.2o6 Nef/Ala5 Protein produced

Figure 2. Permeability of yeast cells producing Nef. DMY 100 transformants containing pYEX-BX and pYEX-S 1 .Nef27, pYEX- S1.Nef25, and pNef27/A5 were grown in liquid minimal media, stained with PI, and subjected to flow cytometry to measure the extent of cell permeabilisation.

possibly increasing their sensitivity to Nef. Also, as diploids are larger than haploids their

plasma membrane could be more sensitive to perturbation caused by Nef. In view of the result

that Nef/Ala5 elevates Nef toxicity such that the toxicity is apparent in haploid cells, it seems

appropriate to call the phenomenon "diploid enhanced toxicity".

The cytotoxicity results from determinants within the first twenty residues of Nef, since

the Nef/Ala5 mutation elevates Nef toxicity. However, because Nef20-2o6 is toxic there must be a

second determinant for toxicity. There is the possibility that extracellular Nef may itself be

cytotoxic, as previously reported (20-23). However, some of the observed toxicity in

transformants must come from intracellular Nef because, for example, DMYI00 [pYEX-

BX.Nef25] cells do not release Nef (26), yet toxicity is still observed.

Are these findings relevant to AIDS pathogenesis? Only a few studies of Nef in

mammalian cells have commented on Nef toxicity although none conclusively demonstrate that

Nef is cytocidal. Some have speculated that Nef toxicity led to a lower than expected recovery of

283

Vol. 46, No. 2, 1998 BIOCHEMISTRYend MOLECULAR BIOLOGY INTERNATIONAL

nefexpression clones (17, 36), or that Nef caused cytostatic effects to macrophages (17) or CD4 +

T-lymphocytes (16). Numerous other studies have already been mentioned, but the majority of

reports on Nef make no comment on toxicity or state that Nef is not toxic. How do we reconcile

these different observations? One explanation for the cytotoxicity relates to the level of stress:

our studies indicate that only under conditions of stress does the presence of Nef cause toxicity

and the same could apply in mammalian cells. Another factor is the localisation of Nef: in T

cells Nef can cause inhibition or activation, depending on its localisation (37). Localisation can

be affected by expression levels, stress, phosphorylation status of the protein and the cell cycle.

It therefore follows that the yeast model may be a valid one and that Nef may exert its

cytotoxicity by a fundamental cellular mechanism. In fact, it may be the high-level expression of

Nef that depletes the T-cell subsets that leads to the catastrophic decline in the immune system.

These data may also have some relevance to the treatment of those infected with HIV. Possibly,

HI-V-1 infected cells expressing Nef could be selectively killed by certain stresses.

What is the role of the amino-terminal region of Nef? Peptides corresponding to the N-

terminus of Nef have been shown to have sequence and structural similarity to mellitin (24, 32),

and are membrane perturbing and have fusogenic activity (24, 31, 34). Could the cell killing

noted here be related to such an effect? The release of Nef from yeast was dependent on the

amino terminus of Nef (26) and a melittin-like action could be involved in both of these

activities, especially since we see that Trp5--)Ala change increases toxicity while making the N-

terminus of Nef more like melittin. Alternately, intracellular interactions between the proline-

rich region of Nef and the SH3 domains of signal transducing proteins have been noted (reviewed

in 38), and in yeast these could also affect viability, especially if Nef levels interfered with vital

signalling. The amino terminus clearly modulates the toxicity when it is present. Work on Nef

structure is required to establish the links between the N-terminus and other parts of Nef involved

in Nef functions. On the assumption that yeast is a relevant model, we have commenced

screening for inhibitors that abrogate Nef toxicity in yeast.

ACKNOWLEDGMENTS We thank Drs. Greg Cola and Paul Vaughan for their critical reading of this manuscript.

REFERENCES 1. Kestler, H. W. 1II., Ringler, D. J., Mori, K., Panicali, D. L., Sehgal, P. K., Daniel, M. D., and

Desrosiers R. C. (1991) Cell 65,651-662. 2. Blumberg, B. M., Epstein, L. G., Saito, Y., Chen, D., Sharer, L. R., and Anand, R. (1992) J.

Virol. 66, 5256-5264.

284

Vol. 46, No. 2, 1998 BIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL

3. de Ronde, A., Klaver, B., Keulen, W., Smit, L., and Goudsmit, J. (1992) Virology 188, 391- 395.

4. Shugars, D. C., Smith, M. S., Glueck, D. H., Nantermet, P. V., Seillier-Moiseiwitsch, F., and Swanstrom, R. (1993) J. Virol. 67, 4639-4650.

5. Chowers, M. Y., Spina, C. A., Kwoh, T. J., Fitch, N. J. S., Richman, D. D., and Guatelli, J. (1994) J. Virol. 68, 2906-2914.

6. Jamieson B. D., Aldrovandri, G. M., Planeltes, V., Jowett, J. B. M., Gao, L., Bloch, M., Chen, I. S. Y., and Zack, J. A. (1994) J. Virol. 68, 3478-3485.

7. Lindemann, D., Wilhelm, R., Renard, P., Althage, A., Zinkernagel, R., and Mous, J. (1994) J. Exp. Med. 179, 797-807.

8. Miller, M. D., Warmerdam, M. T., Gaston, I., Greene, W. C., and Feinberg, M. B. (1994) J. Exp. Med. 179, 101-113.

9. Kirchoff, F., Greenough, T.C., Brettler, D.B., Sullivan, J.L., and Desrosiers, R.C. (1995) N. E. J. Med. 332, 228-232.

10. Deacon, N. J., Tsykin, A., Solomon, A., Smith, K., Ludford-Menting, M., Hooker, D. J., McPhee, A., Greenway, A. L., Ellett, A., Chatfield, C., Lawson, V.A., Crowe, S., Maerz, A., Sonza, S., Learmont, J., Sullivan, J. S., Cunningham, A., Dwyer, D., Dowton, D., and Mills, J. (1995) Science 270, 988-991.

11. Skowronski, J., Parks, D., and Mariani, R. (1993) EMBO J. 12, 703-713. 12. Dickie, P. (1996) AIDS Res. Human Retrovimses 12, 177-189. 13. Dickie, P., Ramsdell, F., Notkins, A. L., and Venkatesan, S. (1993) Virology 197, 431-438. 14. Gulizia, R. J., Collman, R. G., Levy, J. A., Trono, D., and Mosier, D. E. (1997) J. Virol. 71,

4161-4614. 15. Bonyhadi, M. L., Rabin, L., Salimi, S., Brown, D. A., Kosek, J., McCune, J. M., and

Kaneshima, H. (1993) Nature 363, 728-735. 16. Fujii, Y., Ito, M., and Ikuta, K. (1993) Vaccine 11,837-847. 17. Murphy, K. M., Sweet, M. J., Ross, I. L., and Hume, D.A. (1993) J. Virol. 67, 6956-6964. 18. Chirmule, N., Oyaizu, N., Saxinger, C., and Pahwa, S. (1994) AIDS 8,733-739. 19. Calenda, V., Graber, P., Delmarter, J-F., and Chermann, J-C. (1994) Eur. J. Hematol. 52,

103-107. 20. Fujii, Y., Otake, K., Tashiro, M., and Adachi, A. (1996) FEBS Letts. 393, 93-96. 21. Fujii, Y., Otake, K., Tashiro, M., and Adachi, A. (1996) FEBS Letts. 393, 105-108. 22. Fujii, Y., Otake, K., Tashiro, M., and Adachi, A. (1996) J. Gen. Virol. 77, 2943-2951. 23. Okada, H., Takei, R., and Tashiro, M. (1997) FEBS Letts. 417, 61-64. 24. Curtain, C. C., Lowe, M. G., Arunagiri, C. K., Mobley, P. W., Macreadie, I. G., and Azad, A.

A. (1997) AIDS Res. Human Retroviruses 14, 1213-1220. 25. Macreadie, I. G., Ward, A. C., Failla, P., Grgacic, E., McPhee, D., and Azad, A. A. (1993)

Yeast 9, 565-573. 26. Macreadie, I. G., Castelli, L. A., Lucantoni, A., and Azad, A. A. (1995) Gene 162, 239-243. 27. Macreadie, I. G., Fernley, R., Castelli, L. A., Lucantoni, A., White, J., and Azad, A. A. (1998)

J. Biomed. Sci. 5, in press. 28. Adachi, A., Gendelman, H.E., Koenig, S., Folks, T., Willey, R., Rabson, A., and Martin,

M.A. (1986) J. Virol. 59, 284-291. 29. Macreadie, I. G., Castelli, L. A., Failla, P., and Azad, A. A. (1993) Mol. Biol. (Life Sci. Adv.)

12, 99-105. 30. Macreadie, I. G., Castelli, L. A., Hewish, D. R., Kirkpatrick, A., Ward, A. C., and Azad, A.

A. (1995) Proc. Natl. Acad. Sci. USA 92, 2770-2774.

285

Vol. 46, No. 2, 1998 BIOCHEMISTRYond MOLECULAR BIOLOGY INTERNATIONAL

31. Curtain, C. C., Separovic, F., Rivett, D., Kirkpatrick, A., Waring, A. J., Gordon, L. M., and Azad, A. A. (1994) AIDS Res. Human Retroviruses 10, 1231-1240.

32. Barnham, K. J., Monks, S. A., Hinds, M. G., Azad, A. A., and Norton, R. S. (1997) Biochemistry 36, 5970-80.

33. Towler, D. A., Adams, S. P., Eubanks, S. R., Towery, D. S., Jackson-Machelski, E., Glaser, L., and Gordon, J. I. (1988) J. Biol. Chem. 263, 1784-1790.

34. Macreadie, I. G., Lowe, M. G., Curtain, C. C., Hewish, D. R., and Azad, A. A. (1997) Biochem. Biophys. Res. Comm. 232, 707-711.

35. Shapiro, H. (1994) Practical flow cytometry, Third Edition, Wiley-Liss, New York. 36. Luria, S., Chambers, I., and Berg, P. (1991) Proc. Natl. Acad. Sci. USA 88, 5326-5330. 37. Bauer, A. S., Sawai, E. T., Dazin, P., Fantl, W. J., Cheng-Mayer, C., and Peterlin, B. M.

(1994) Immunity 1,373-384. 38. Greenway, A., and McPhee, D. (1997) Res. Virol. 148, 58-64.

286