Identification, cloning and heterologous expression of a new lectin like protein in tea Tirthankar Bandyopadhyay a,1, *, Bornali Gohain a,1 , Raju Bharalee b , Prasenjit Bhagawati a , Mohan Chandra Kalita c , Sudripta Das d a Department of Biotechnology, Tea Research Association, Jorhat 785008, Assam, India b The Energy and Resources Institute, N E Regional Center, VIP Road, Guwahati 781036, Assam, India c Department of Biotechnology, Gauhati University, Gopinath Bordoloi Nagar, Guwahati 781014, Assam, India d Plant Bioresources Division, Institute of Bioresources & Sustainable Development (IBSD), Takyelpat, Imphal 795001, Manipur, India 1. Introduction Assam tea, Camellia sinensis subsp. assamica is one of the most important cash crops in India whose cultivation and production is challenged by many biotic and abiotic stresses. Recently biotic stresses induced by a hemipter- an (jassids) in tea has been extensively studied on a molecular basis by Gohain et al. (2012). Among the many biotic stresses, infestation by Helopeltis theivora Waterhouse (Hemiptera: Miridae), the tea mosquito bug is the most economically important and have emerged as one of the most dreaded foe to tea plantations in Asia (Sundararaju and Sundara Babu, 1999) amounting to 11– 100% crop loss (Muraleedharan, 1992). The nymphs and the adults make reddish brown punctures and suck out the cell sap from tender leaves, stems and buds leading to their curling and under severe infestations causing their desiccation and subsequent crop loss (Hazarika et al., 2009). The present study involves the identification, gene expression profiling, cloning and heterologous expression of a lectin like protein CsL2 tea cultivar 111/1 upon Helopeltis infestation. Molecular, biochemical, cellular, physiological and evolutionary arguments indicate that lectins have a role in plant defense (De Hoff et al., 2009; Journal of Applied Research on Medicinal and Aromatic Plants xxx (2014) e1–e7 A R T I C L E I N F O Article history: Received 31 January 2014 Accepted 28 March 2014 Available online xxx Keywords: Ribosome inactivating protein Heterologous expression qPCR 111/1 A B S T R A C T Tea cultivation in India is greatly challenged by herbivores which render tea leaves unsuitable for any downstream processing in tea industry. Helopeltis theivora (Tea mosquito bug) is a sap sucking pest of tea leaves causing widespread tissue damage and crop loss in North eastern India. In this study we report the expression of a new variant of Ribosome inactivating protein from tea highly induced by tea mosquito bug. The heterologously expressed protein is 110 amino acids long and characterized by the presence of Q-X-W motifs and putative sugar binding sites with a molecular weight of 12.65 kDa. Moreover, the study demonstrates that the expression of the encoding transcript is differentially up regulated in Helopeltis tolerant tea cultivars than the susceptible ones. The present study, for the first time reports Helopeltis induced differential up regulation of a lectin like protein in tea which may have important and positive fallout on crop improvement programmes through breeding and transgenic approaches. ß 2014 Elsevier GmbH. All rights reserved. * Corresponding author. Present address: National Institute of Plant Genome Research (NIPGR), Aruna Asaf Ali Marg, New Delhi-110067, India. Tel.: +91 8860221089. E-mail addresses: [email protected], [email protected](T. Bandyopadhyay). 1 Equal contribution. G Model JARMAP-6; No. of Pages 7 Please cite this article in press as: Bandyopadhyay T, et al. Identification, cloning and heterologous expression of a new lectin like protein in tea. J. Appl. Res. Med. Aromat. Plants (2014), http://dx.doi.org/10.1016/j.jarmap.2014.03.003 Contents lists available at ScienceDirect Journal of Applied Research on Medicinal and Aromatic Plants jo u r nal h om ep age: w ww.els evier.c o m/lo c ate/jarm ap http://dx.doi.org/10.1016/j.jarmap.2014.03.003 2214-7861/ß 2014 Elsevier GmbH. All rights reserved.
Transcript
Idof
TirPraa Deb Thc Ded Pla
1. I
theandstrean
moma
Journal of Applied Research on Medicinal and Aromatic Plants xxx (2014) e1–e7
A R
Artic
Rece
Acce
Avai
Keyw
Ribo
Hete
qPC
111
*
Gen
Indi
(T. B1
G Model
JARMAP-6; No. of Pages 7
Plle
http
221
entification, cloning and heterologous expression a new lectin like protein in tea
thankar Bandyopadhyay a,1,*, Bornali Gohain a,1, Raju Bharalee b,senjit Bhagawati a, Mohan Chandra Kalita c, Sudripta Das d
partment of Biotechnology, Tea Research Association, Jorhat 785008, Assam, India
e Energy and Resources Institute, N E Regional Center, VIP Road, Guwahati 781036, Assam, India
partment of Biotechnology, Gauhati University, Gopinath Bordoloi Nagar, Guwahati 781014, Assam, India
nt Bioresources Division, Institute of Bioresources & Sustainable Development (IBSD), Takyelpat, Imphal 795001, Manipur, India
ntroduction
Assam tea, Camellia sinensis subsp. assamica is one of most important cash crops in India whose cultivation
production is challenged by many biotic and abioticsses. Recently biotic stresses induced by a hemipter-(jassids) in tea has been extensively studied on alecular basis by Gohain et al. (2012). Among theny biotic stresses, infestation by Helopeltis theivora
Waterhouse (Hemiptera: Miridae), the tea mosquito bugis the most economically important and have emerged asone of the most dreaded foe to tea plantations in Asia(Sundararaju and Sundara Babu, 1999) amounting to 11–100% crop loss (Muraleedharan, 1992). The nymphs andthe adults make reddish brown punctures and suck outthe cell sap from tender leaves, stems and buds leading totheir curling and under severe infestations causing theirdesiccation and subsequent crop loss (Hazarika et al.,2009).
The present study involves the identification, geneexpression profiling, cloning and heterologous expressionof a lectin like protein CsL2 tea cultivar 111/1 uponHelopeltis infestation. Molecular, biochemical, cellular,physiological and evolutionary arguments indicate thatlectins have a role in plant defense (De Hoff et al., 2009;
T I C L E I N F O
le history:
ived 31 January 2014
pted 28 March 2014
lable online xxx
ords:
some inactivating protein
rologous expression
R
/1
A B S T R A C T
Tea cultivation in India is greatly challenged by herbivores which render tea leaves
unsuitable for any downstream processing in tea industry. Helopeltis theivora (Tea
mosquito bug) is a sap sucking pest of tea leaves causing widespread tissue damage and
crop loss in North eastern India. In this study we report the expression of a new variant of
Ribosome inactivating protein from tea highly induced by tea mosquito bug. The
heterologously expressed protein is 110 amino acids long and characterized by the
presence of Q-X-W motifs and putative sugar binding sites with a molecular weight of
12.65 kDa. Moreover, the study demonstrates that the expression of the encoding
transcript is differentially up regulated in Helopeltis tolerant tea cultivars than the
susceptible ones. The present study, for the first time reports Helopeltis induced
differential up regulation of a lectin like protein in tea which may have important and
positive fallout on crop improvement programmes through breeding and transgenic
approaches.
� 2014 Elsevier GmbH. All rights reserved.
Corresponding author. Present address: National Institute of Plant
ome Research (NIPGR), Aruna Asaf Ali Marg, New Delhi-110067,
Journal of Applied Research on Medicinal andAromatic Plants
jo u r nal h om ep age: w ww.els evier .c o m/lo c ate / jarm ap
://dx.doi.org/10.1016/j.jarmap.2014.03.003
ease cite this article in press as: Bandyopadhyay T, et al. Identification, cloning and heterologous expression of a newctin like protein in tea. J. Appl. Res. Med. Aromat. Plants (2014), http://dx.doi.org/10.1016/j.jarmap.2014.03.003
T. Bandyopadhyay et al. / Journal of Applied Research on Medicinal and Aromatic Plants xxx (2014) e1–e7e2
G Model
JARMAP-6; No. of Pages 7
Peumans and Van Damme, 1995). Plant lectins are able tobind simple sugars such as Glc, Man, or Gal, and alsoexhibit a higher affinity for oligosaccharides, uncommon ortotally absent in plants (Peumans and Van Damme, 1995).The preferential association of lectins with those parts ofthe plant that are most susceptible to attack by foreignorganisms is another argument for its protective role(Peumans and Van Damme, 1995; Sadeghi et al., 2003;Nagadhara et al., 2004; Melander et al., 2003). Severalmannose-binding GNA-related lectins proved to be prom-ising candidates for the control of hemipteran pests (VanDamme, 2008). An investigation by Sadeghi et al. (2006) onthe effect of lectins on oviposition revealed that lectinsubstantially reduces the rate of egg laying in seeds ofchickpea. Given that RIPs are very toxic to insect larvae,their tissue specific induced expression may be one of thepotent strategies for containing tea mosquito bug infesta-tion. We therefore hypothesize that remarkable stability,versatility and insect lethality of RIP 2 lectin proteins fromthe leaves of 111/1 cultivar of tea may be an importantdeterminant of its relative tolerance against Helopeltis
infestation and hence an investigation into the dynamics ofits expression is pertinent.
2. Materials and methods
2.1. Plant materials and stress treatments
For constructing SSH library, 6-year-old tea plants werecollected from new clonal trial plot 2 and were subjected toHelopeltis infestation (8 h) under controlled netted condi-tions. Approximately 50 Helopeltis adults per plant wereallowed to infest experimental plants (3 replicates pertreatment). Young shoots from 111/1 and TV1 wereconsidered for the infestation experiment. 111/1 andTV1 are known to be least and most susceptible cultivar toHelopeltis. For the time course and inter-cultivar geneexpression studies, a second set of infestation experimentswere established comprising of 111/1, TV1, TV18, TV9 andTV26 plants with the same infestation parameters asdiscussed above. Samples were collected from control andexperimental plants at intervals of 30 min, 4 h, 8 h and 12 hpost herbivory.
2.2. Total RNA isolation and suppression subtractive
hybridization
Total RNA was isolated following protocol by Bandyo-padhyay et al. (2012). mRNA was isolated from the total RNAusing PolyA tract1 mRNA isolation systems III (PromegaCorporation, Madison, WI, USA). A subtractive cDNA librarywas constructed by using PCR-Select cDNA Subtraction Kit(Clonetech, Palo Alto, CA, USA) according to the manufac-turer’s instructions. cDNA populations derived frominfested 111/1 leaves were considered as tester while thatof TV1 as driver. The subtracted cDNAs were cloned intopGEM-T Easy vector (Promega Corporation,Madison, WI,USA), transformed into ElectroMax DH10b E. coli cells(Invitrogen, Carlsbad, USA) and sequenced using GA3130xlGenetic Analyzer (Applied Biosystems, Foster City, CA, USA).Sequences were compared with GenBank database
sequences using the BLAST homology search programmeat the National Centre for Biotechnology Information (NCBI).
2.3. Quantitative expression analysis of CsL2
Quantitative gene expression profiling was carried outusing the 2 step-qPCR approach (Transcriptor First StrandcDNA Synthesis kit, Roche diagnostics, Germany) with theSYBR green chemistry (LightCycler 480 SYBR green I Masterkit) according to the manufacturer’s recommendations.Amplification of the target was performed by using genespecific forward primer 50CCTCCAATAATACAGATCCTTTCGand reverse primer 50GTTGGCTAGACCACCCATAACTAC.Data on the expression levels were obtained in the formof crossing point (CP), employing the 2nd derivativemaximum method (Tichopad et al., 2003, 2004) ascomputed by the LightCycler 480 II software (RocheDiagnostics, Germany) Carousel-based system. The geNorm(http://medgen.ugent.be/�jvdesomp/genorm/) softwarewas used to find out the most stable internal controlgene (18S rRNA gene, 50 GGCCGGCTCCGTTACTTTG 30/50
GTTTCAG-CCTTGCGACCATACTC 30) among the set of fourhousekeeping genes (26s rRNA, 18s rRNA, Camellia sinensis
tubulin and Rubisco small subunit) following infestation.GeNorm calculates a gene expression normalization factorfor each tissue sample based on the geometric mean of a userdefined number of reference genes (Vandesompele et al.,2002). This normalized expression value of a gene indifferent biological replicates was compared to know therelative expression level of the target genes among differentsample types.
2.4. In-silico analysis
The ORF was fed into ProtParam online proteomicanalysis tool (Gasteiger et al., 2005) in order to predict themolecular weight and isoelectric point (pI)of the encodedprotein. The polypeptide sequence was analyzed using theBLASTX online tool (Altschul et al., 1990) to obtain themost nearest homologs while conserved domain analysiswas done using the NCBI conserved domain database(CDD) (Marchler-Bauer et al., 2013, http://www.ncbi.nlm.-nih.gov/cdd/?term=cd00161) and the ExPASy-Prosite webbased tool available in the ExPASy proteomics server(http://expasy.org/prosite/).UTR analysis of CsL2 wasperformed by feeding the individual UTR sequences inthe prediction function section of RegRNA1.0 web server(Huang et al., 2006) with default parameters.
2.5. Cloning, colony PCR confirmation of encoded ORF and
heterologous expression of the putative protein
The predicted ORF encoding the protein was amplified,cloned into the pET-Ek/LIC 43.1 vector (EMD Biosciences,Madison, WI, USA) and subsequently expressed using thecomponents and instructions provided in the Novagen pET-EK/LIC-43.1 kit (EMD Biosciences, Madison, WI, USA). Onetransformed colony of expression host BL21 (DE3) pLysSstrain was subjected to colony PCR using pET primers(50GACGACGACAAGATGCAAAGGAACGAGAACGAGAACAA-GACGACGACAAGATGCAAAGGAACGAGAACGAGAACAATG-
Please cite this article in press as: Bandyopadhyay T, et al. Identification, cloning and heterologous expression of a newlectin like protein in tea. J. Appl. Res. Med. Aromat. Plants (2014), http://dx.doi.org/10.1016/j.jarmap.2014.03.003
T. Bandyopadhyay et al. / Journal of Applied Research on Medicinal and Aromatic Plants xxx (2014) e1–e7 e3
G Model
JARMAP-6; No. of Pages 7
Plle
0 and 50GAGGAGAAGCCCGGTCAAAGCATTGGAAGCC-T CTGGTT30) to confirm the presence of complete ORF36 bp. Expression of the fusion protein (with 549 amino
N terminal tag) was further induced by incubating thel expression host culture with 1 Mm IPTG for 10 h atC at 150 rpm.
Protein purification and SDS-PAGE
Four induced bacterial pellets were processed andified using the components and recommendationsvided by Dynabeads His-Tag isolation and pulldown kititrogen, Carlsbad, CA). 15 mL of the purified fusion
tein was resolved on a SDS-PAGE system along with itsresponding induced and control (uninduced) totalterial protein counterparts (sample volume at
= 2.0). The gel was stained using comassie brilliant bluetion (R-250) (Himedia labs, Cat. No. 443282L) for 1 h and
n de-stained for 1 h each by gentle rocking in destainingtion I and II subsequently. Ready to use protein molecular
ight marker (Bangalore Genei, RPMWH, Cat. no.106004)s used for comparing the position and size of bands.
Enterokinase treatment of fusion protein and purification
ative protein
Enterokinase Cleavage Capture Kit (Novagen) kit wasd to digest the fusion protein followed by removal oferokinase from the reaction volume according to thenufacturer’s instructions. Briefly, 20 mg of protein wasested for 13 h at 21 8C using 0.2 U of enzyme in action volume of 50 mL in the supplied rEK cleavage/ture buffer. Following digestion, enterokinase is
removed from the native protein by adding EKaptureAgarose and performing filter purification by centrifuga-tion. The follow through was concentrated and diluted inthe same buffer. Bradford assay was performed to ascertainthe concentration of the protein.
3. Results and discussion
3.1. Infestation experiment
We performed an infestation study in containedexperimental trial plot 2 of the institute. The infestationprovided estimate of the most tolerant and the mostsusceptible tea clones based on the number of puncturesmade on the leaf surface by the insect in replicatedtreatments (Table 1, Figs. 1 and 2). The basis for initialselection of clones for the experiment was the entomol-ogist’s observation data on the preferability of theclones by Helopeltis in the tea garden/field. The cloneswhich showed the least infestation and the clones whichwere attacked the most were selected in the initialscreen.
3.2. SSH cDNA library
Based on the results of controlled infestation experi-ment, we designed a Suppression Subtractive Hybridiza-tion (SSH) based approach to identify differentially up-regulated and infestation induced ESTs from 111/1 relativeto TV1 (Fig. 3). Putative functions of all the subtracted ESTswere ascertained using a combination of sequencealignment (BLAST), mapping and gene ontology platforms(BLAST2GO) (data not shown). We could identify a 701
le 1
ber of punctures observed in the experimental samples.
ltivars Punctures, Rep1 Punctures, Rep2 Punctures, Rep3 SD Mean punctures
1/1 9 14 11 2.516 11.333
18 27 34 31 3.511 30.667
9 72 79 84 6.027 78.333
26 98 110 92 9.165 100
1 154 163 169 7.549 162
Fig. 1. Helopeltis infestation patterns in five cultivars of tea considered in the study.
ease cite this article in press as: Bandyopadhyay T, et al. Identification, cloning and heterologous expression of a newctin like protein in tea. J. Appl. Res. Med. Aromat. Plants (2014), http://dx.doi.org/10.1016/j.jarmap.2014.03.003
T. Bandyopadhyay et al. / Journal of Applied Research on Medicinal and Aromatic Plants xxx (2014) e1–e7e4
G Model
JARMAP-6; No. of Pages 7
nucleotide long contig (Fig. 4) encoding a ricin–agglutininlike protein.
3.3. Transcript abundance of CSL2
In order to ascertain the relative abundance of thetranscript across a representative but diverse set of teacultivars showing variable susceptibility to tea mosquitobug, gene expression studies was conducted in TV1, TV9,TV26, TV18 and 111/1 cultivars. TV1, TV9 and TV26 havebeen known to be susceptible while TV 18 showed sometolerance to Helopeltis attack (Barbora and Singh, 1994).Analysis of the normalized qPCR data (Table 2) show thatendogenous abundance of CsL are relatively much lowerunder control conditions while Helopeltis infestationcaused a general up-regulatory shift among all thecultivars studied. TV18 exhibits a relatively higher basallevel of expression among the cultivars under study.Cultivars show maximum accumulation of the transcriptsfollowing 4 or 8 h of herbivory. Among the cultivars, 111/1
showed a unique pattern of transcript accumulation,especially after 4 and 8 h of infestation (registering 56and 50 fold up-regulation than its control respectively)followed by a decrease in its accumulation (Table 2). Suchdivergent expression behaviour by 111/1 may probably bedue to its divergent parentage (C. irrawadiensis � C.
assamica) than its TV counterparts (C. assamica � C.
assamica). We therefore, hypothesize that such a differen-tial and relatively up-regulated stress induced expressionof Camellia sinensis RIP in 111/1 may be due to the influenceof still unknown genetic determinants in the cultivar.
3.4. UTR analysis of the deduced ORF
The 50 and 30 UTRs of eukaryotic mRNAs possessvarious motifs or elements and are present upstream anddownstream to the ORF respectively. They act as targetsites for RNA binding factors or interact directly withtranslation machinery of the downstream ORF. The CsL2sequences upstream and downstream to translation startand stop sites respectively were analyzed for UTR motifsand elements (Table 3). Two motifs were identified at the50 region upstream of the ORF of CSL2 viz., Terminaloligopyrimidine (TOP) and uORF. The 50 TOP sequence isessential for the translational regulation observed inmaize (Meyuhas et al., 1997) while the presence of uORFsin UTR is known to modulate efficiency of translation ofthe main ORF (Floris et al., 2009). The 30UTR regioncontains an element similar to Gamma interferonactivated inhibitor of Ceruloplasmin mRNA translation(GAIT element). GAIT is involved in selective translationalsilencing of the main ORF (Sampath et al., 2003). Suchupstream and downstream cis regulatory elements mayhave some role to play in herbivory induced overexpres-sion of CsL2.
020406080
100120140160180
111/1 TV 18 TV9 TV 26 TV1
Num
ber o
f pun
ctur
es
Cul �var
Fig. 2. Histogram showing the mean number of punctures per second leaf
in five cultivars studied.
0 50 10 0 15 0 20 0
calmodu lin -rela ted prote inchlorophyll A/B bind ing protein
conde nsin compl ex subun it 2cystatin
fructose dehy droge nase small sub unithaloacid dehalog enase-like hy drola se fa mily
hemaggl utinin esteraselysophospho lipa se-like protein
putative r everse tr anscr iptaseS-(hy droxymethyl )glutathione dehydrogenase
Tachyki nin/Neuro kininTonB-d epende nt receptor
Transpos aseubiquitin exten sion protein
met allot hio nein -li ke pr oteinhyperse nsitive- induced res ponse protein
aldehyde dehydrogena seATP bi nding / kinase
DehydrinThauma tin -like protein
beta- D-gluco sidaseOXS3 (OXIDATIVE STRE
CatalaseCold induci ble protein
Ricin-ag glutinin family pr oteinformate dehydro gena se
Hypotheti cal proteins
Fig. 3. Abundance of subtracted ESTs from SSH library. Ricin–agglutinin family protein accounted 4% (16 ESTs) which is the second most abundant candidate
in the library.
Please cite this article in press as: Bandyopadhyay T, et al. Identification, cloning and heterologous expression of a newlectin like protein in tea. J. Appl. Res. Med. Aromat. Plants (2014), http://dx.doi.org/10.1016/j.jarmap.2014.03.003
T. Bandyopadhyay et al. / Journal of Applied Research on Medicinal and Aromatic Plants xxx (2014) e1–e7 e5
G Model
JARMAP-6; No. of Pages 7
Plle
In-silico sequence analysis of CsL2
The encoded 111 amino acid long protein was predictedave a pI and molecular weight of 4.94 and 12.65 KDa
pectively. Alignment of the encoded amino acid queryuence with the most closely related BLASTX hitsADF45510.1, giIADF45512.1 and giIACV60361.2)ealed high degree of sequence conservation represent-
91% homology with the putative sugar binding sites ofe 2 ribosome-inactivating protein precursor Camellia
nsis. Conserved domain analysis of the polypeptide
shows a conserved ricin-type beta-trefoil and a carbohy-drate-binding domain (cd00161). Nine of 9 residues thatcompose this conserved feature of Q-X-W motif have beenmapped to the query sequence (Fig. 5) while 13 of 14residues that compose sugar binding sites on conserveddomain RICIN could be mapped to the query sequence(GenBank: JX042312). The (QXW) 3 domain (called thelectin domain) and the sugar binding sites within it havebeen widely reported to play important role in recognitionand binding to carbohydrate structures within the insectmidgut (Hazes, 1996; Vandenborre et al., 2011).
Fig. 4. Details of CsL2 mRNA sequence.
le 2
malized Cp values of CsL2 of five cultivars at different time points as indicated.
ltivars/treatment 111/1 E TV18 E TV1 E TV26 E TV9 E 111/1 C TV18 C TV1 C TV26 C TV9 C
034 GAIT element 62–89 28 TTTATTTTATTAGCTACTAGCTAGTAGG
ease cite this article in press as: Bandyopadhyay T, et al. Identification, cloning and heterologous expression of a newctin like protein in tea. J. Appl. Res. Med. Aromat. Plants (2014), http://dx.doi.org/10.1016/j.jarmap.2014.03.003
T. Bandyopadhyay et al. / Journal of Applied Research on Medicinal and Aromatic Plants xxx (2014) e1–e7e6
G Model
JARMAP-6; No. of Pages 7
3.6. Heterologous expression of CsL using SDS-PAGE
Heterologous expression of amplified and suitablycloned CsL2 was accomplished in E. coli (Fig. 6). It wasperformed to investigate the predicted expressionpattern of the protein and obtain its purified form.CsL2 was expressed as part of a fusion protein of 72 kDa
(549 amino acid) containing 60 kDa of N terminal his tagand 12.21 kDa of actual protein. Its electrophoreticmigration matched the theoretically predicted molecularweight of 12.65 kDa. Maximum induction occurred(Fig. 6b) when the cell culture was incubated for 10 hat 30 8C with a final concentration of 1Mm IPTG in themedia.
Fig. 6. (a) Colony PCR to show CsL2 amplicon amplified using pET-EK ready primers. The 362 bpamplicon is inclusive of the sense (12 nt) and antisense
primer (14 nt) sequence to assist in ligation independent cloning of the ORF (336 bases) into pET-EK vector. (b) SDS-PAGE showing heterologous expression
of CsL2 fusion protein (72 kDa). Expression induced using 1 mM IPTG for 10 h at 30 8C with 150 rpm (UN = un-induced total protein, IN = induced total
protein, PUR = purified protein using His-tag beads, M = protein marker).
Fig. 5. A multiple sequence alignment of amino acid sequence of encoded query polypeptide (CsL) with five most closely related BLASTX hits. CDD output
show three glutamine-any residue-tryptophan (Q-X-W) domains, (blue rectangles) and thirteen 13 sugar binding residues (grouped in 11 red rectangles).
Aligned with peptides possessing similar domain composition. Red and blue colour of amino acids represents the highest and lowest levels of conservation
of amino acids. Each amino acid has been differently coloured.
Please cite this article in press as: Bandyopadhyay T, et al. Identification, cloning and heterologous expression of a newlectin like protein in tea. J. Appl. Res. Med. Aromat. Plants (2014), http://dx.doi.org/10.1016/j.jarmap.2014.03.003
T. Bandyopadhyay et al. / Journal of Applied Research on Medicinal and Aromatic Plants xxx (2014) e1–e7 e7
G Model
JARMAP-6; No. of Pages 7
Plle
onclusion
The present study reports identification, cloning andression of a ribosome inactivating protein from tea
nts widely known to be toxic to herbivores. The 111ino acid long protein is characterized by the presence ofee (Q-X-W) motifs and 13 putative sugar binding sitesracteristic of many plant lectins. Transcript abundanceoding the protein appears to be significantly influencedHelopeltis attack in tolerant cultivar 111/1 unlike aller cultivars in the study. Such an expression patternld explain the relative tolerance of 111/1 to Helopeltis
ich may be attributed to yet unknown geneticerminants from one of its wild parent C. irrawadiensis,ough further studies are required to substantiate thee. Heterologous expression of the protein has demon-ted that the encoding ORF is successfully translated.thermore, this study is the first preliminary evidence of
role of plant lectins against the hemipteran H. theivora.ntification of factors assisting CsL2 activity and theirogression in quality cultivars remains an important
ahead for obtaining tea plants with durable toleranceelopeltis with commercial value.
nowledgement
The authors would like to acknowledge the support Department of Biotechnology, Govt. of India, for
viding funds to carry out the research.
erences
chul SF, Gish W, Miller W, Myers EW, Lipman DJ, 1990. Basic localalignment search tool. Journal of Molecular Biology 215, 403–410.dyopadhyay T, Bharalee R, Gohain B, Gupta S, Agarwala N, Singh HR,Chakrabarty S, Bhorali P, Kalita MC, Das S, 2012. Isolation of functionalRNA from heavily infested, wilted and necrotic leaf tissues of tea withhigh polyphenol content. Journal of Agricultural Science and Tech-nology B2, 121–127.ora BC, Singh K, 1994. All about Helopeltis theivora: a serious pest of
tea. Two and a bud 41 (2), 19–21.off PL, Brill LM, Hirsch AM, 2009. Plant lectins: the ties that bind in
root symbiosis and plant defense. Molecular Genetics and Genomics282, 1–15.is M, Mahgoub H, Lanet E, Robaglia C, Menand B, 2009. Post-tran-scriptional regulation of gene expression in plants during abioticstress. International Journal of Molecular Sciences 10, 3168–3185.eiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR, Appel RD,Bairoch A, 2005. In: John M, Walker, (Eds.), The Proteomics ProtocolsHandbook. Humana Press, Totowa, NJ, pp. 571–607.ain B, Borchetia S, Bhorali P, Agarwal N, Bhuyan LP, Rahman A,Sakata K, Mizutani M, Shimizu B, Gurusubramaniam G,
Ravindranath R, Kalita MC, Hazarika M, Das S, 2012. UnderstandingDarjeeling tea flavour on a molecular basis. Plant Molecular Biology78 (6), 577–597.
Hazarika LK, Bhuyan M, Hazarika BN, 2009. Insect pests of tea and theirmanagement. Annual Review of Entomology 54, 267–284.
Hazes B, 1996. The (Q � W) domain: a flexible lectin scaffold. ProteinScience 5, 1490–1501.
Huang HY, Chien CH, Jen KH, Huang HD, 2006. RegRNA: a regulatory RNAmotifs and elements finder. Nucleic Acids Research 34, W429–W434.
Marchler-Bauer A, Zheng C, Chitsaz F, Derbyshire MK, Geer LY, Geer RC,Gonzales NR, Gwadz M, Hurwitz DI, Lanczycki CJ, Lu F, Lu S, MarchlerGH, Song JS, Thanki N, Yamashita RA, Zhang D, Bryant SH, 2013. CDD:conserved domains and protein three-dimensional structure. NucleicAcids Research 41 (D1), D384–D452.
Melander M, Ahman I, Kamnert I, Stromdahl AC, 2003. Pea lectinexpressed transgenically in oilseed rape reduces growth rate of pollenbeetle larvae. Transgenic Research 12, 555–567.
Meyuhas O, Avni D, Biberman Y, Shama S, Ostareck DH, Ostareck LedererA, Hentze MW, 1997. Growth-dependent translational control of TOPmRNAs. FASEB Journal 11 (9), A1285–A2500.
Muraleedharan N, 1992. Pest control in Asia. In: Wilson KC, Clifford MN(Eds.), Tea: Cultivation to Consumption. Chapman & Hall Inc., London,pp. 375–412.
Nagadhara D, Ramesh S, Pasalu IC, Rao YK, Sarma NP, Reddy VD, Rao KV,2004. Transgenic rice plants expressing the snowdrop lectin gene(gna) exhibit high-level resistance to the whitebacked planthopper(Sogatella furcifera). Theoretical and Applied Genetics 109, 1399–1405.
Peumans WJ, Van Damme EJM, 1995. Lectins as plant defense proteins.Plant Physiology 109, 347–352.
Sadeghi A, Smagghe G, Broeders S, Hernalsteens JP, De Greve H, PeumansWJ, Van Damme EJM, 2003. Ectopically expressed leaf and bulb lectinsfrom garlic (Allium sativum L.) protein transgenic tobacco plantsagainst cotton leafworm (Spodoptera littoralis). Transgenic Research17, 9–18.
Sadeghi A, Van Damme EJM, Peumans WJ, Smagghe G, 2006. Deterrentactivity of plant lectins on cowpea weevil Callosobruchus maculatus(F.) oviposition. Phytochemistry 67, 2078–2084.
Sampath P, Mazumder B, Seshadri V, Fox PL, 2003. Transcript-selectivetranslational silencing by gamma interferon is directed by a novelstructural element in the ceruloplasmin mRNA 30 untranslated re-gion. Molecular Cell Biology 23, 1509–1519.
Sundararaju D, Sundara Babu PC, 1999. Helopeltis spp. (Heteroptera:Miridae) and their management in plantation and horticultural cropsof India. Journal of Plantation Crops 27, 155–174.
Tichopad A, Didier A, Pfaffl MW, 2004. Inhibition of real-time RT-PCRquantification due to tissue specific contaminants. Molecular andCellular Probes 8, 45–50.
Tichopad A, Dilger M, Schwarz G, Pfaffl MW, 2003. Standardised deter-mination of real-time PCR efficiency from a single reaction setup.Nucleic Acids Research 31 (20), e122.
Van Damme EJM, 2008. Plant lectins as part of the plant defensesystem against insects. In: Schaller A (Ed.), Induced Plant Resis-tance to Herbivory. Springer Science + Business media, pp. 285–307.
Vandenborre G, Smagghe G, Ghesquiere B, Menschaert G, Nagender Rao R,2011. Diversity in protein glycosylation among insect species. PLoSONE 6 (2), e16682.
Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, Paepe AD,Speleman F, 2002. Accurate normalization of real-time quantitativeRT-PCR data by geometric averaging of multiple internal controlgenes. Genome Biology 3,, RESEARCH0034.1-0034.11.
ease cite this article in press as: Bandyopadhyay T, et al. Identification, cloning and heterologous expression of a newctin like protein in tea. J. Appl. Res. Med. Aromat. Plants (2014), http://dx.doi.org/10.1016/j.jarmap.2014.03.003
