Page 1
In vitro thymocyte differentiation in MHC class I-negativeXenopus larvae
J. Robert*, M. Sung, N. Cohen
Department of Microbiology and Immunology, University of Rochester Medical Center, Box 672, 601 Elmwood Avenue,
Rochester, NY 14642, USA
Received 17 October 2000; accepted 17 November 2000
Abstract
CTX is a surface antigen whose expression in larval and adult Xenopus is primarily restricted to MHC class I-negative
immature cortical thymocytes. In adult Xenopus, surface expression of CTX marks a population of MHC class I2 CD81
immature thymocytes that appears to be the equivalent of the mammalian CD4CD8 double positive subset. The present
study reveals that transient in vitro exposure of immature CTX1 thymocytes from MHC class I-negative tadpoles to suboptimal
mitogenic concentrations of phorbol ester (PMA) plus ionomycin, induces larval cells to differentiate into more mature T-
lymphoblasts that express high level of surface CD5 and CD45. These T-lymphoblasts have downregulated CTX, Rag 1 and
TdT genes, whereas TCR-b genes remain actively transcribed. Signaling induced by PMA/ionomycin modulates both class I
and class II expression of MHC class I/II-negative larval thymocytes.
This study also reveals that larval T-lymphoblasts are composed of two distinct subsets: CD5highCD82 and CD5 highCD8 high.
q 2001 Elsevier Science Ltd. All rights reserved.
Keywords: CTX; Thymocytes; Thymus; PMA; Xenopus
1. Introduction
Mammalian T-cell differentiation occurs in the
thymus and involves a complex series of differentia-
tion and selection events that are accompanied by
phenotypic changes of cell surface antigens [1±3].
Brie¯y, double negative (DN) CD4±CD82 thymo-
cytes that have successfully rearranged TCR-b gene
and undergone several rounds of division, give rise to
non-dividing double positive (DP) CD41CD81 cells
that constitute the largest population of thymocytes
(approximately 70%) in mice [4,5]. During this inter-
mediate stage of differentiation, the recombination
machinery, including the Rag and TdT genes, is reac-
tivated and the TCRa genes undergo rearrangement
leading to the expression a low level of the CD3-T-cell
receptor (TCR) ab complex on the cell surface. DP
cells are then subjected to positive and negative selec-
tion before they mature into single positive
CD41CD82 or CD42CD81 thymocytes that express
a high level of the CD3-TCRab complex. Low-af®-
nity interactions between the TCR and self peptide-
MHC expressed by the thymic epithelium is critically
Developmental and Comparative Immunology 25 (2001) 323±336
0145-305X/01/$ - see front matter q 2001 Elsevier Science Ltd. All rights reserved.
PII: S0145-305X(00)00066-5
www.elsevier.com/locate/devcompimm
Abbreviations: BSA, bovine serum albumin; CTX, cortical
thymocyte antigen in Xenopus; DP, CD4CD8 double positive
thymocytes; Ig, immunoglobulin; MHC, major histocompatibility
complex; PMA, phorbol 12-myristate 13-acetate; RAG, recombina-
tion activating gene; TCR, T-cell receptor; TdT, terminal deoxynu-
cleotidyl transferase.
* Corresponding author. Tel.: 11-716-275-15359; fax: 11-716-
473-9573.
E-mail address: [email protected] (J. Robert).
Page 2
involved in this selection and lineage commitment.
High-af®nity interactions or no interactions between
the TCR and MHC class I or class II molecules results
in apoptosis [2,6±8].
Although thymus-dependent immunocompetence
has been demonstrated in ectothermic vertebrates
(reviewed in [9,10]), next to nothing is known about
the phylogenetic conservation of thymocyte differen-
tiation and selection pathways. In large part, this has
resulted from a lack of antibody reagents that can
identify speci®c T-cell subsets. To circumvent this
problem in the frog Xenopus, expression of the corti-
cal thymocyte antigen (CTX) has been used to iden-
tify undifferentiated thymocytes [11]. CTX is a
recently discovered surface antigen whose predomi-
nant expression in larvae and adults is restricted to
MHC class I-negative, class II-negative or class II-
low, and CD8 positive immature cortical thymocytes.
The close ontogenetic relationship between CD8 and
CTX expression [12], the absence of MHC class I
expression by CTX positive cells [13], and the down-
regulation of CTX during in vitro-induced differentia-
tion of adult thymocytes [11], all support the idea that
CTX is a differentiation marker of an immature
thymocyte subset equivalent to the CD4CD8
double-positive subset of mammals.
Larval Xenopus have a unique immune system in
which cell surface expression of MHC class I mole-
cules does not occur in most tissues, including the
thymus, until metamorphosis [14±16]. Further-
more, since LMP7 gene expression also does not
occur until metamorphosis [17], MHC class I
restricted peptide presentation is likely to be
absent, or at least inef®cient, in tadpoles. In
mammals, thymocyte differentiation from DP to
SP cells can be induced by very low concentrations
of phorbol myristate acetate (PMA) and ionomycin
that presumably mimic low level stimulation of the
TCR-CD3 complex resulting from its interactions
with self-peptide presented by MHC molecules
[18±20]. Recently, we have demonstrated that
PMA plus ionomycin can also stimulate thymo-
cytes from adult Xenopus to undergo differentiation
[11]. Indeed, the pathway for T-cell differentiation
in mammals and Xenopus appears similar.
However, the facts that Xenopus larvae do not
express MHC class I and that larval thymocytes
and peripheral T-cells are class II-negative, raised
the intriguing possibility of a difference in T-cell
differentiation pathways in larval and adult frog
thymocytes. In this regard, it is noteworthy that
the T-cell mitogen, phytohemagglutinin-P (PHA),
readily activates adult, but not larval, thymocytes.
Rather, larval thymocyte proliferation requires both
PHA and a supernatant enriched for IL-2-like activ-
ity [21]. Based on these observations, we investi-
gated whether suboptimal mitogenic concentrations
of PMA plus ionomycin would be suf®cient to
drive differentiation of larval thymocytes. The
data reported in this paper reveal that at these
larval stages of development, there is some capa-
city for responding to a positive selection signal
that results in the generation of two different
more mature T-lymphoblast subsets that appear
similar to mammalian CD4 and CD8 single positive
subsets, one of which is CD8highCD5high and the
other, CD8negativeCD5high.
2. Materials and methods
2.1. Culture conditions
Outbred animals were used for preliminary studies;
LG6 isogenetic clones [22] were used subsequently as
indicated in ®gure legends. Thymuses from 20 to 30
tadpoles at stage 56 [23] were pooled, dissociated, and
cultured at a density of 1 £ 106 cells/ml at 268C in 24-
well ¯at-bottom plates. Each culture well contained
1.5 ml/well of Iscove's DMEM basal medium that had
been diluted to amphibian osmolarity and supplemen-
ted with 5% FBS and 20% supernatant from the A6
kidney ®broblast cell line (ATCC: CCL 102) as
detailed elsewhere for culturing lymphoid tumor cell
lines [24].
Thymocytes were either untreated or treated for
16 h (unless otherwise speci®ed) with PMA (0.2±
10 ng/ml) and ionomycin (200±400 ng/ml). After
extensive washing, cells were replated in fresh
medium (without PMA/ionophore) for 1±3 days.
Proliferation assays were performed by culturing
(in triplicate) 2 £ 104 thymocytes/well in 200 ml (trea-
ted or untreated with PMA/ionomycin) for the indi-
cated period of time. Cells were pulsed for the last
20 h with 1 mCi/well [3H]thymidine (Amersham) and
harvested with a 96-well harvester (Betaplate; Wallac,
J. Robert et al. / Developmental and Comparative Immunology 25 (2001) 323±336324
Page 3
Turku, Finland); thymidine uptake was determined by
scintillation spectrometry.
2.2. Flow cytometry and immunocytochemistry
Samples of 105 cells stained with hybridoma super-
natants followed by ¯uorescein-labeled goat anti-
mouse Ig, were analyzed by ¯ow cytometry on a
FACSCalibur. This technique, and the monoclonal
antibodies (mAbs) used in this study have been
described elsewhere ([11], Table 1); the CD45 mAb
was kindly provided by Dr James Turpen [25].
2.3. RT-PCR
Cytoplasmic RNA was prepared from the 5 £ 106
total thymocytes (treated or untreated with PMA/iono-
mycin) using the vanadyl-ribonucleoside complex
method. First-strand cDNA synthesis was performed
using 1 mg of RNA and random primer pd(N)6 (1 mg/
ml) in a 30 ml reaction with 200 U MMLV reverse tran-
scriptase (BRL) for 60 min at 378C. For each PCR reac-
tion (30 ml total volume), 3 ml of 1.25 mM dNTPs, 3 ml
of 10 £ PCR buffer, 1 ml of each primer, 2 U of Taq
DNA polymerase (Life Technologies), and 1 ml of
cDNA reaction were mixed. Tubes were then set for
40 cycles of denaturation for 45 s at 958C, annealing for
45 s at 538C, and extension for 1 min at 728C.The CTX-
speci®c primers in the constant domain were:
GCTGTGTTATTCCGAGGAG (541, 5 0±3 0 orienta-
tion) and CTCAGCATGGTCATGGAATTG (287,
3 0±5 0 orientation). TCR-b-speci®c primers were:
GTCAATAGTCTGTTTGGCCAG (592, 5 0±3 0 orien-
tation) and CGATAGCCGTGACAATGAGC (944,
3 0±5 0 orientation). MHC class Ia-speci®c primers in
the a1±2 domain were: CGAGCCTTTGGGCTGC
CAGAGTT (99, 5 0±3 0 orientation) and CTTCA
GCCCCTCGATACA (562, 3 0±5 0 orientation). MHC
class IIb-speci®c primers in b1±2 domain were:
GGCACCGACAATGTCAGG (146, 5 0±3 0 orienta-
tion) and CTTCAATCCCATTCTTCAGC (501, 3 0±5 0 orientation). Rag 1-speci®c primers were: GCGC
CAAGAATCTGTGTCACT (-64, 5 0±3 0 orientation)
and GATAGCTCCGGTTCTGCTGAT (382, 3 0±5 0
orientation). TdT-speci®c primers were: ATCCACT-
GAGCCAAT (5, 5 0-3 0 orientation) and CCTTCAT
CGCTGTTA (616, 3 0± 5 0 orientation). Elongation
factor-a-speci®c primers: CCTGAAT CACCCAGGC
CAGATTGGTG (5 0±3 0 orientation) and GCACCTCT
CGAAGAGTCTGATGGGAG (3 0±5 0 orientation).
Numbers in parentheses refer to published cDNA
primary sequence (see Table 1).
3. Results
3.1. Dose effects of PMA and ionomycin on larval
thymocytes in vitro
To determine whether differentiation of Xenopus
larval thymocyte can be initiated in vitro, PMA and
ionomycin were ®rst titrated to induce differentiation,
J. Robert et al. / Developmental and Comparative Immunology 25 (2001) 323±336 325
Table 1
Expression pattern of Xenopus lymphocyte markers (no mAbs speci®c for CD4 and TCR have been described so far)
Markers Expression pattern in the thymus Expression pattern in periphery (e.g. spleen, blood)
CTX [12,13,26] Mainly thymic cortex of both adult and larvae (70%
total thymocytes)
Adult stomach
CD8 [27] Mainly thymic cortex of both adults and larvae (80%
total thymocytes)
T-cells (20% splenocytes) of both adult and larvae
CD5 [28,29] Thymic cortex and medulla; (90% total thymocytes) T-cells and PMA-activated IgM1 B cells
CD45 [25] Majority of larval and adult thymocytes (95%) T- and B-cells
TCRb [30] Adult and larval thymus Circulating T-cells of both adults and larvae
Rag 1 and 2 [31] Mainly thymus of larvae and adults Low level in bone marrow, kidney, spleen and liver
TdT [32] Mainly thymus of old larvae and adults Weak expression in spleen
MHC class I [14,15] Larvae: thymus negative; adults: mainly epithelium
and mature thymocytes
No surface expression in larvae; ubiquitous
expression in adult
MHC class II [27,37] Larvae: epithelium but not thymocytes; adults:
epithelium and thymocytes
Larval leukocyte except T-cells; adult leukocyte
including T-cells
Page 4
but minimal proliferation, of pre-metamorphic larval
thymocytes from stage 55 to 56 tadpoles. As shown in
Fig. 1, cell proliferation was minimal with 200 ng/ml
of ionomycin and PMA concentrations ranging from
10 to 0.1 ng/ml, both in the continual or transient
presence of the drugs. In addition, the level of prolif-
eration remained low after several days of culture and
no marked difference was observed between thymo-
cytes cultured transiently with PMA/ionomycin for
16 h and those cultured in the continual presence of
drugs.
As seen for thymocytes from Xenopus adults, the
concentration of PMA/ionomycin resulting in mini-
mal proliferation (0.2±10 ng/ml of PMA and
200 ng/ml of ionomycin for 20 h [11]) induced rapid
morphological changes of larval thymocytes and
resulted in moderate cell death (less than 50%)
which was more pronounced with higher concentra-
tion of PMA (data not shown). After 16 h exposure, a
subset of large lymphoblastoid cells, often found in
aggregates, was observed. In the absence of PMA/
ionomycin, or with just PMA or ionomycin alone,
such lymphoblastoid cells were rarely observed.
3.2. Change of cell surface expression induced by
PMA/ionomycin
Effects induced after a transient exposure (16 h) of
pre-metamorphic (stage 55±56) thymocytes to low
dose of PMA (0.2 ng/ml) and ionomycin (200 ng/
ml) were further studied by ¯ow cytometry using
cell surface markers whose general pattern of expres-
sion is outlined in Table 1. As seen for thymocytes
from adult Xenopus, the two larval thymocyte
populations generated by PMA/ionomycin treatment
could be electronically gated according to their size
and analyzed separately for their surface phenotype
(Fig. 2). The relative fraction of large T-lymphoblasts
increased during cell culture from about 20% after
16 h exposure to PMA/ionomycin, to more than
60% after the cells were washed extensively and put
back for two more days in culture without PMA/iono-
mycin (data not shown).
Larval large T-lymphoblasts that appear in culture
following a transient exposure to PMA/ionomycin
display a surface phenotype that is very different
from that of the small thymocyte population which
resembles cultures of either untreated or freshly
harvested thymocytes that are mainly (65±75%)
CTX1 (Fig. 2 upper graphs). Even by 16 h, many of
these T-lymphoblasts have downregulated CTX
surface expression, and a fraction of them expresses
high level of CD5 (Fig. 2 bottom). After 3 days in
culture, most of these T-lymphoblasts have lost
surface expression of CTX and have upregulated
surface CD5 (Fig. 2 bottom) and CD45 (Fig. 4)
J. Robert et al. / Developmental and Comparative Immunology 25 (2001) 323±336326
Fig. 1. Cell proliferation induced by PMA/ionomycin. Effect of different concentrations of PMA and ionomycin on growth (cpm) of total
thymocytes from outbred premetamorphic (stage 56) larvae. Approximately 2 £ 104 thymocytes were cultured 3 days with or without (0) a 16 h
treatment with 0.1, 1.0, or 10 ng/ml PMA alone, or with 200 or 400 ng/ml ionomycin (P/I). Cells were pulsed for the last 20 h with
[3H]thymidine. Proliferation due to possible allorecognition was minimal as shown in cultures without PMA/ionomycin treatment (0) as
well as with PMA or ionomycin alone (data not shown).
Page 5
J. Robert et al. / Developmental and Comparative Immunology 25 (2001) 323±336 327
Fig. 2. Phenotypic changes induced in vitro by a transient exposure to PMA/ionomycin. Upper lane, surface phenotype by ¯ow cytometry of
freshly harvested thymocytes from premetamorphic outbred (stage 55±56) tadpoles. The striped peak represents the negative control with a
nonspeci®c isotype-matched mAb (IgG1). Middle lane, control thymocyte cultured in medium alone 16 h and 3 day, stained with the same
mAbs. On the left panel, the dot±plot graph show only one cell population. Bottom lane, surface phenotype of thymocytes after 16 h exposure
to 0.2 ng/ml PMA and 200 ng/ml ionomycin, or after 2 additional days of culture after extensive washing in the absence of PMA/ionomycin.
Note on the left dot-plot graph, the presence of two distinct subsets after 16 h treatment that were subsequently gated and analyzed separately
(thin peak� small thymocytes, bold peak� large T-lymphoblasts. In each experiment, cells were stained with mAbs against Xenopus CTX
(X71), CD8 (AM22), CD5 (2B1) molecules; Dead cells positively stained by propidium iodide were gated out; 10,000 events were analyzed on
a FACSCalibur ¯ow cytometer (Becton±Dickinson). Fluorescence intensity is plotted on a logarithmic scale.
Page 6
molecules. Furthermore, about half of these T-
lymphoblasts also expressed high levels of CD8
molecules.
A more detailed monitoring of the time-course
of surface phenotype changes in isogenetic larval
cells induced by PMA/ionomycin (Fig. 3) shows
that compared to control cultures in medium
alone, the number of total thymocytes after 16 h
exposure to PMA/ionomycin signi®cantly drops,
and continues to decline at a lower rate on the
days after replating. In contrast, a signi®cant
number of lymphoblasts can already be detected
after 16 h of exposure to PMA/ionomycin.
However, while its relative fraction increased in
culture, the total number of these lymphoblasts
did not increase markedly during the following
days in culture, suggesting that these cells had
limited proliferative capacity. Interestingly, a frac-
tion of T-lymphoblasts still expressed a low level
of surface CTX after 16 h of treatment with PMA/
ionomycin (day 1; Fig. 3 bottom graph) indicating
that PMA/ionomycin treatment not only eliminates
CTX1 thymocytes, but also downregulates CTX
expression in a fraction of them. In the following
days of culture, and despite the absence of PMA/
ionomycin, the fraction of T-lymphoblasts expres-
sing high level of surface CD5 and CD8 markedly
increased to reach a plateau at day 3.
3.3. T-lymphoblast subset
Although most T-lymphoblasts induced by transi-
ent exposure to PMA/ionomycin and cultured for 2
more days expressed high levels of surface CD5 and
CD45, only a fraction (50±70%) was CD8bright. The
presence of distinct T-lymphoblast subsets was
further investigated by two-color ¯ow cytometry.
Indeed, as shown in Fig. 4(b), the CD5bright, CTXnegative
T-lymphoblast subset was further separated into
CD8bright and CD8null cells after 3 days of culture.
The level of CD5 and CD8 surface expression by
PMA/ionomycin-induced T-lymphoblasts was
comparable to that observed on mature larval splenic
T-cells [Fig. 4(a)]. The fraction of small thymocytes
in the same treated cultures displayed a lower level of
surface CD5 and CD8 that is similar to one of the
populations observed for control thymocytes cultured
without PMA/ionomycin, or to freshly harvested
thymocytes. Similar results were obtained in three
experiments.
3.4. Change of gene expression induced by PMA/
ionomycin
To further substantiate that differentiation was
induced upon transient exposure to PMA/inomycin,
gene expression was monitored by RT-PCR. Follow-
ing a 16 h treatment of larval total thymocytes with
0.2 ng/ml PMA and 200 ng/ml ionomycin, CTX
expression was already downregulated, since no
signal could be detected [Fig. 5(a), 1 day). CTX
mRNA remained undetectable during the following
culture period despite the absence of PMA/ionomycin
in the medium. In contrast, the level of CTX expres-
sion remained unchanged in untreated thymocytes
cultured for the same period of time [Fig. 5(a) and
(b)]. Interestingly, the rapid downregulation of CTX
expression following PMA/ionomycin-induced differ-
entiation correlated with a downregulation of Rag 1
gene [Fig. 5(a)]. Weak expression of TdT has been
detected in the thymus at larval stage 56 [32]. In the
present study, a weak but signi®cant TdT signal was
detectable in fresh as well as in 16 h cultures of larval
thymocytes [Fig. 5(c)]. However, no trace of TdT
transcript was seen in larval thymocytes cultured for
16 h with PMA/ionomycin. In contrast, TCRb was
still expressed [Fig. 5(b)]. This provides further
evidence that PMA/ionomycin does not have an over-
all inhibitory or toxic effect, but rather, it induces a
stable speci®c differentiation pathway.
3.5. Change of MHC expression induced by PMA/
ionomycin
Xenopus thymocytes and peripheral T-cells are
MHC class I and class II-negative until metamorpho-
sis [14±17]. This suggests that in vivo differentiation
of larval Xenopus thymocytes may occur in the
absence, or at least inef®cient, class I selection.
Given the differentiation in our in vitro system of
both CD81 and CD82 larval T-lymphoblasts follow-
ing exposure to PMA/ionomycin, it was of interest to
study the ontogenetic pattern of MHC expression in
vitro. Whereas freshly harvested thymocytes and
control thymocytes cultured without PMA/ionomycin
were not stained by anti-class I and anti-class II mAbs,
high levels of surface class II were detected on
J. Robert et al. / Developmental and Comparative Immunology 25 (2001) 323±336328
Page 7
J. Robert et al. / Developmental and Comparative Immunology 25 (2001) 323±336 329
Page 8
J. Robert et al. / Developmental and Comparative Immunology 25 (2001) 323±336330
Fig. 3. Phenotypic changes of total thymocytes from premetamorphic LG-6 (stage 55±56) cloned tadpoles that were induced by a transient
treatment (16 h) with 0.2 ng/ml PMA and 200 ng/ml ionomycin. Cell phenotype was analyzed ex-vivo (day 0), directly after extensive washing
(day 1), or after thymocytes had been put back in culture without PMA/ionomycin (day 2±4). Data are presented as total live cell number
starting with 2 £ 106 cells/ml/well. Percentage obtained by ¯ow cytometry for the different markers and for the two types of cell subsets (small
and lymphoblasts) have been use to calculate the respective cell numbers. Gates were set to exclude 95±98% of the cells that stained with non-
speci®c isotype-matched antibodies.
<
Fig. 4. Characterization of T-cell and thymocyte subsets by two-color ¯ow cytometry analysis of CD5 and CD8 surface markers. (a) Freshly
harvested thymocytes and splenocytes from premetamorphic LG-6 tadpoles (stage 55±56). (b) Premetamorphic thymocytes transiently
exposed (16 h) to 0.2 ng/ml PMA and 200 ng/ml ionomycin and further cultured in drug-free medium after extensive washes for 2 more
days. Small and large T-lymphoblasts were gated according to their size and analyzed separately. Control culture were sham-treated and
displayed a single small thymocyte population. (c) Histogram analysis of sham-treated control (striped peaks), PMA/ionomycin-treated small
(thin peaks) and large T-lymphoblast thymocytes. Cells were ®rst stained with anti-CD8, followed by FITC-conjugated goat anti-mouse Fab2
pre-absorbed twice with Xenopus lymphocytes. After blocking with 1% mouse serum, cells were stained with PE-conjugated anti-CD5 (2B1).
Quadrants were set with single-colored stained cells and with non-speci®c isotype-matched controls. Downregulation of surface CTX on T-
lymphoblasts was also controlled.
Page 9
T-lymphoblasts as early as 16 h following exposure to
PMA/ionomycin (Fig. 6), as well as after one more
day of culture in PMA/ionomycin-free medium.
However, the level of class II surface expression by
T-lymphoblasts decreased the next day to become
barely detectable over bacground at day 3 (Fig. 6)
and day 4 (data not shown). The small thymocyte
population in cultures treated with PMA/ionomycin
remained class II-negative. Surface class I expression
was also observed after transient exposure to PMA/
ionomycin; however, it became signi®cant only after
the second and third day of culture (16 h treatment and
1 or 2 more days of culture without PMA/ionomycin),
and surface class I signal was also detected on the
small thymocyte population (Fig. 6). This surface
expression persisted at day 4 (data not show).
Although some class I mRNA was detected using
primers speci®c for the a1 and a2 domain in preli-
minary assays using freshly harvested thymocytes
from outbred larvae, no signal was detected with
thymocytes from carefully staged LG-6 premeta-
morphic (stage 55±56) larvae (i.e. clonal tadpoles
do not metamorphose at exactly the same time).
Nevertheless, class I transcript expression was mark-
edly and consistently upregulated in each case after
transient exposure to PMA/ionomycin; this upregula-
tion is depicted at day 2 in Fig. 5(b). No such
increased class I expression was detected with thymo-
cytes cultured without PMA/ionomycin. In fact, the
weak initial expression seen in two experiments
almost disappeared after the second day of culture.
Class II mRNA detected in freshly harvested thymo-
cytes may re¯ect contamination by thymic epithelium
cells and/or thymic antigen presenting cells.
4. Discussion
This study shows that although larval thymocyte
differentiation is temporally and qualitatively
J. Robert et al. / Developmental and Comparative Immunology 25 (2001) 323±336 331
Fig. 5. Regulation of gene expression induced by PMA/ionomycin. Approximately 1 mg of cytoplasmic RNA was reverse-transcribed from
outbred (a, c) or LG-6 (b) thymocytes cultured 16 h in either medium only (c) or in medium with 0.2 ng/ml PMA and 200 ng/ml ionomycin (P/
I), and then either harvested immediately (a, 1 day), cultured for another day (a, 2 days) or another 2 days (b). 1 ml of each RT reaction was
ampli®ed (40 cycles) using primer pairs speci®c for CTX, Rag1 (a, b), Class Ia, Class IIb, TCRb (b), TdT and Ef-1a (a, b, c as RT control).
Page 10
distinct from that of the adult, a similar pathway
of differentiation can be induced in vitro by tran-
sient exposure to PMA/ionomycin at minimally
mitogenic concentrations.
4.1. Larval thymocytes induced in vitro to a
differentiation pathway similar to that of adult
Using CTX as surface marker of an immature stage
that appears equivalent to the double positive stage of
mammalian thymocytes, we have characterized a
differentiation pathway from a small immature stage
CTX1, CD81, CD5low, CD45low to more mature T-
lymphoblast stage CTX2, CD5bright, CD45bright that
can be further separated into a CD8bright and CD8negative
subset.
Although our experiment used total thymocytes
rather than a puri®ed subset, histology and ¯ow cyto-
metry data [11,12] indicate that in larvae as well as in
adults, CTX1 cells constitute the major population of
thymocytes (from 60 to 70%). In the absence of class
II surface expression by larval thymocytes, it was not
possible to purify CTX1 cells by removing class II1
cells (as we have done in adults). Because of possible
effect of cross-linking; positive selection with CTX
was not attempted either. In adult Xenopus, compar-
able results were obtained in terms of gene expression
induced by PMA/ionomycin with negatively puri®ed
and total thymocytes. Therefore, it seems unlikely that
the change in phenotype and gene expression
observed with larval thymocytes exposed to PMA/
ionomycin, results from a rapidly expanding minor
J. Robert et al. / Developmental and Comparative Immunology 25 (2001) 323±336332
Fig. 6. Change of MHC class I and class II surface expression induced by transient exposure to PMA/ionomycin. Upper lane, ¯ow cytometry of
freshly harvested pre-metamorphic LG6 (stage 55±56) thymocytes (bold peak) and splenocytes (thin peak) stained either with anti-class I mAb
(TB17) or anti-class II (AM20). Bottom lane, thymocytes after 16 h treatment with 0.2 ng/ml PMA and 200 ng/ml ionomycin, or 2 additional
days of culture in absence of drugs. Small (thin peak) and large T-lymphoblast (bold peak) were gated according to their size and analyzed
separately. Control cultures (-peak) were mock-treated and displayed a single small thymocyte population.
Page 11
population, especially in view of the limited prolifera-
tion induced by the low concentration of PMA and
ionomycin used.
In mammals, low level stimulation of protein
kinase C by PMA has been proposed to mimic a posi-
tive selection signal required for the commitment of
DP to SP cells [18±20]; a recent study of adult Xeno-
pus thymocytes supports this hypothesis [11]. The
present study reveals that a similar signaling pathway
may also be activated in larval thymocytes by PMA/
ionomycin, even though the interaction of the TCR
with MHC is likely to be different in the larval
thymus. Similar to adult Xenopus thymocytes (but in
contrast to mouse), larval Xenopus thymocytes seem
to respond to a wider dose range of PMA (0.1±10)
than do thymocytes from mammals (0.2±1) without
major differences in terms of expression of immuno-
logically relevant genes.
The induction of phenotypic changes by PMA/
ionomycin is accompanied by the downregulation, at
the transcriptional level, of CTX, Rag1 and TdT,
whereas active TCRb transcription is sustained. In
the absence of any enrichment for rare thymocyte
precursors (equivalent, for example, to a CD4 CD8
double negative population), transcripts of CTX,
Rag1, TdT and TCRb found by RT-PCR in freshly
harvested as well as cultured thymocytes, are likely to
have been produced by CTX1 cells that represent
more than 70% of total thymocytes, even after 3
days of culture in absence of PMA/ionomycin. The
fact that the CTX transcript is signi®cantly and rapidly
downregulated in parallel with Rag 1 and TdT upon a
transient PMA/ionomycin treatment, whereas TCRbmRNA remains well-expressed for several days after
treatment, suggests that immature larval thymocytes
have differentiated into more mature T-cells that have
shut off their rearrangement machinery and express
functional TCRab complexes.
The appearance of morphologically distinct T-
lymphoblasts with a more mature CD5high CD45high
phenotype after transient treatment with minimally
mitogenic concentrations of PMA/ionomycin further
supports an induction of differentiation rather than a
selection of rare cells or a short-lived activation. In
adult Xenopus although the majority of Xenopus
thymocytes are positively stained by anti-CD5 mAb
(up to 80% [28]), the signal is weaker than that of
peripheral T-cells, except for a minor subset [29];
similar observations have been made in our study
with tadpoles. In addition as in larvae, adult T-
lymphoblasts generated by PMA/ionomycin express
higher level of surface CD5 (Robert, unpub. observ.).
In mice, the DP stage is characterized by surface
expression of a low level of TCRb and intermediate
levels of CD8, CD4 and CD5 markers, and by Rag1
and Rag 2, activity [1±5]. CD5 surface expression is
upregulated during the positive selection of the CD8
SP lineage [33] and CD4 SP lineage [20].
Although in the present study we cannot formally
establish that the PMA/ionomycin-generated T-
lymphoblasts originate from a single stage of
homogeneous immature thymocytes, it is tempting
to regard the two T-lymphoblast subsets CD8negative,
CD5high, CD5high CD8high, as equivalent to the
mammalian SP CD41, CD81 subsets that also
express higher levels of CD5 [4,5]. The presence
of peripheral CD81 T-cells and the possibility of
inducing, in vitro, a differentiation pathway that
appears to lead to mature CD81 thymocytes, is
intriguing considering that thymic selection is unli-
kely to involve class I presentation (i.e. neither
surface class I nor LMP7 are expressed in the
thymus until metamorphosis; [17]). It is possible
that differentiation of the CD8 lineage in larval
Xenopus involves TCR interactions with MHC
class II as is the case in mice that express trans-
genic TCR speci®c for a class II-restricted peptide
where positive selection and lineage commitment
of CD8 SP, as well as activation and cytotoxic
activity of CD8 T-cell in periphery is mediated
by class II molecules [34]. In this murine model,
however, class I is still needed for the ®nal matura-
tion stage of thymocytes characterized by surface
expression of heat stable antigen (HSA). Whether
similar class I-dependent maturation is required in
Xenopus, is not known. Although as yet there is no
formal evidence of functional CD8 cytotoxic T-
cells in tadpoles, our in vitro characterization of a
similar inducible pathway of thymocyte differentia-
tion giving rise to CD8high,CD5high thymocytes,
together with peripheral thymus-dependent CD8
T-cells and the absence of class I expression by
most tissues until metamorphosis, is in agreement
with the idea, as previously suggested by Flajnik
et al. [14], of naturally occurring MHC class II-
restricted CD8 cytotoxicity.
J. Robert et al. / Developmental and Comparative Immunology 25 (2001) 323±336 333
Page 12
4.2. Regulation of MHC class I and class II expression
by larval thymocytes
Changes in MHC class II expression in Xenopus
appear to depend strictly on developmental stage
[35,36]. Speci®cally, T-cells become class II1 only
when metamorphosis has been initiated [27,37]; this
change does not occur when metamorphosis is
blocked with the goitrogen sodium perchlorate [35].
In fact, the pattern of class II expression in tadpoles is
similar to that of most mammals with a predominant
expression by B-lymphocytes and accessory cells. By
constrast, in adult Xenopus, most mature lympho-
cytes, including mature thymocytes and T-cells, are
class II1. Unlike class II expression, developmental
regulation of class I expression seems to be more
dependent on some tissue-speci®c factors (expression
begins at different times in different tissues; [17]) and
class I expression appears independent of factors
controlling metamorphosis (i.e. its expression is not
affected by blocking metamorphosis, [16]). Our data
suggest that a low concentration of PMA/ionomycin is
able to modulate both class I and class II expression of
larval thymocytes. Whereas class I expression seems
to increase after 2±3 days in culture, upregulation of
class II occurs earlier but is short-lived. Whether these
effects may result from a side effect unrelated to
mimicry of positive selection by PMA/ionomycin,
remains to be determined. However, although the
pathway for T-cell differentiation seems to be similar
in mammals and Xenopus [11], the fact that Xenopus
larvae do not express MHC class I raised the intri-
guing possibility of a difference in T-cell differentia-
tion pathways in larval and adult frog thymocytes. In
this regard, it is noteworthy that the T-cell mitogen,
PHA, that triggers the TCR-CD3 complex directly
does not have a demonstrable effect on larval thymo-
cytes but it does stimulate adult thymocytes to divide
and produce T-cell growth factors [21]. Given that
this lectin stimulates thymocytes by interactions at
the cell surface, whereas PMA/ionomycin acts more
downstream in the signaling cascade, it is possible
that in Xenopus, the larval and adult TCR-CD3
complexes display some qualitative difference. Until
now, MHC regulation in Xenopus has essentially been
considered to be under control of hormones regulating
metamorphosis [36]. The possible involvement of
protein kinase C in MHC expression in larval thymo-
cytes may make thymic cultures with PMA/ionomy-
cin an especially interesting model with which to
further investigate regulation of these genes during
ontogeny and thymocyte positive selection in this
amphibian species.
4.3. CTX is regulated during differentiation of class I2
larval thymocytes
Despite such differences in their developmental
programs, PMA/ionomycin-induced in vitro differen-
tiation of larval as well as adult thymocytes involves a
rapid down-regulation of CTX surface expression.
Although the biological role of CTX remains specu-
lative, this `tight' regulation during two independent
developmental stages of differentiation strongly
suggests that CTX plays some signi®cant develop-
mental role. A strict association of CTX with a parti-
cular developmental step in the lineage of T-cells is
also supported by its pattern of expression during
ontogeny. CTX is ®rst detected just after the initial
colonization of thymic anlagen by stem cells and after
the ®rst expression of CD8. During the differentiation
of mammalian thymocytes, CD8 is ®rst expressed just
prior to the appearance of DP cells [5].
It has been previously shown in Xenopus that PMA
and ionomycin can induce adult CTX1, CD81 class
I2 thymocytes to differentiate into more mature
CTX2 T-lymphoblasts that express surface class I
and class II molecules [11]. Since larval mature
thymocytes and peripheral T-cells do not express
surface class I and class II molecules until metamor-
phosis, it was questioned whether low dose PMA/
ionomycin larval thymocytes would induce a similar
differentiation pathway. Indeed, this study supports
the idea that this mammalian type of thymocyte
differentiation has been not only conserved during
evolution from ectothermic vertebrates, but is also
maintained during distinct developmental stages.
These results further substantiate the tight regulation
of CTX, a homodimeric cell surface receptor that is
independent of the TCR-CD3 complex, during the
differentiation and selection of cortical thymocytes.
Acknowledgements
The expert animal care provided by David Albright
is gratefully acknowledged; this research was
J. Robert et al. / Developmental and Comparative Immunology 25 (2001) 323±336334
Page 13
supported by NIH grants R01 CA-76312, R01 AI-
44011, and R37 HD-07901. We thank John Horton
for his helpful criticisms and discussion.
References
[1] Goldrath AW, Bevan MJ. Selecting and maintaining a diverse
T-cell repertoire. Nature 1999;402:255±62.
[2] Sebzda E, Mariathasan S, Ohteki T, Jones R, Bachmann M,
Ohashi P. Selection of T cell repertoire. Ann Rev Immunol
1999;17:829±74.
[3] Anderson G, Hare J, Jenkinson EJ. Positive selection of
thymocytes: the long and winding road. Immunol Today
1999;20:463±8.
[4] Shortman K, Wu L. Early T lymphocyte progenitors. Annu
Rev Immunol 1996;14:29±61.
[5] von Boehmer H, Fehling HJ. Structure and function of the pre-
T cell receptor. Annu Rev Immunol 1997;15:433±52.
[6] Ashton-Rickardt PG, Bandeira A, Delaney JR, Kaer LV,
Pircher HP, Zinkernagel RM, Tonegawa S. Evidence for a
differential avidity model of T cell selection in the thymus.
Cell 1994;76:651±63.
[7] Hogquist KA, Jameson SC, Heath WR, Howard JL, Bevan
MJ, Carbone FR. T cell receptor antagonist peptides induce
positive selection. Cell 1994;76:17±27.
[8] Janeway CA. Thymic selection: two pathways to life and two
to death. Immunity 1994;1:3±6.
[9] Cohen N, Sigel MM, editors. The reticuloendothelial system.
Phylogeny and ontogeny, vol. 3. New York: Plenum Press,
1982.
[10] Du Pasquier L, Flajnik M. Origin and evolution of the verte-
brate immune system. In: Paul WE, editor. Fundamental
immunology, 4th ed. New York: Raven Press, 1999. p.
605±49.
[11] Robert J, Cohen N. Induction of thymocyte differentiation and
proliferation in vitro by PMA/ionophore correlates with a
down-regulation of CTX expression in Xenopus. Int Immunol
1999;11:499±508.
[12] Robert J, Cohen N. Ontogeny of CTX expression in Xenopus.
Dev Comp Immunol 1998;12:605±12.
[13] ChreÂtien I, Robert J, Marcuz A, Garcia-Sanch J, Courtet M,
Du Pasquier L. Speci®c expression on cortical thymocytes of
CTX a new polymorphic IgSF member. Eur J Immunol
1996;26:780±91.
[14] Flajnik MF, Kaufman JF, Hsu E, Manes M, Parisot R, Du Pasqu-
ier L. Major histocompatibility complexÐencoded class I mole-
cules are absent in immunologically competent Xenopus before
metamorphosis. J Immunol 1986;137:3891±9.
[15] Flajnik MF, Du Pasquier L. MHC class I antigens as surface
markers of adult erythrocytes during the metamorphosis of
Xenopus. Dev Biol 1988;128:198±206.
[16] Rollins-Smith LA, Flajnik MF, Blair P, Davis AT, Green WF.
Expression of MHC class I antigens during ontogeny in Xeno-
pus is metamorphosis-independent. Dev Comp Immunol
1994;18:S95.
[17] Salter-Cid L, Nonaka M, Flajnik MF. Expression of MHC
class Ia and class Ib during ontogeny: high expression in
epithelia and coregulation of class Ia and lmp7 genes. J Immu-
nol 1998;160:2853±61.
[18] Ohoka Y, Kuwata T, Asada A, Zhao Y, Mukai M, Iwata M.
Regulation of thymocyte lineage commitment by the level of
classical protein kinase C activity. J Immunol 1997;158:5707±
16.
[19] Takahama Y, Nakauchi H. Phorbol ester and calcium iono-
phore can replace TCR signals that induce positive selection
of CD4 T-cells. J Immunol 1996;157:1508±13.
[20] Takahama Y, Tokoro Y, Sugawara T, Negishi I, Nakauchi H.
Pertussis toxin can replace T cell receptor signals that induce
positive selection of CD8 T cells. Eur J Immunol
1997;27:3318±31.
[21] Rollins-Smith LA, Parsons CV, Cohen N. During onto-
geny of Xenopus, PHA and Con A responsiveness of
splenocytes precedes that of thymocytes. Immunology
1984;52:491±7.
[22] Kobel HR, Du Pasquier L. Production of large clones of histo-
compatible fully identical clawed toads (Xenopus). Immuno-
genetics 1975;2:87±91.
[23] Nieuwkoop PD, Faber J. Normal table of Xenopus laevis
(Daudin). Amsterdam: North Holland, 1967.
[24] Robert J, Du Pasquier L. Xenopus lymphoid tumor cell lines.
In: Lefkovitz I, editor. Manual of immunological methods.
San Diego and London: Academic Press, 1996. p. 2367.
[25] Barritt LC, Turpen JB. Characterization of lineage restricted
forms of Xenopus CD45 homologue. Dev Comp Immunol
1995;19:525±36.
[26] ChreÂtien I, Marcuz A, Courtet M, Katevuo K, Vainio O, Heath
JK, White SJ, Du Pasquier L. CTX, a Xenopus thymocte
receptor, de®nes a molecular family conserved throughout
vertebrates. Eur J Immunol 1998;28:4094±104.
[27] Flajnik MF, Ferrone S, Cohen N, Du Pasquier L. Evolution of
the MHC: antigenicity and unusual tissue distribution of
Xenopus (frog) class II molecules. Molec Immunol
1990;27:451±62.
[28] JuÈrgens JB, Gartland LA, Kishimoto T, Du Pasquier L, Horton
JD, Cooper MD. Identi®cation of a candidate CD5 homologue
in the amphibian Xenopus laevis. J Immunol 1995;155:4218±
23.
[29] Gravenor I, Horton TL, Ritchie P, Flint E, Horton JD. Onto-
geny and thymus-dependence of T-cell surface antigens in
Xenopus, ¯ow cytometric studies on monoclonal antibody-
stained thymus and spleen. Dev Comp Immunol
1995;19:507±23.
[30] ChreÂtien I, Marcuz A, Fellah J, Charlemagne J, Du Pasquier L.
The T cell receptor b genes of Xenopus. Eur J Immunol
1997;27:763±91.
[31] Greenhalgh P, Olesen C, Steiner L. Characterization and
expression of recombination activating genes (Rag-1 and
Rag-2) in Xenopus laevis. J Immunol 1993;151:3100±10.
[32] Lee A, Hsu E. Isolation and characterization of the
Xenopus terminal deoxynucleotidyl transferase. J Immunol
1994;152:4500±6.
[33] Tarakhovsky A, Kanner S, Hombach J, Ledbetter J, Muller W,
J. Robert et al. / Developmental and Comparative Immunology 25 (2001) 323±336 335
Page 14
Rajewsky K. A role for CD5 in the TCR-mediated signal trans-
duction and thymocyte selection. Science 1995;269:535±9.
[34] Kirberg J, Baron A, Jakob S, Rolink A, Karjalainen K, Von
Boehmer H. Thymic selection of CD81 single positive cells
with a class II major histocompatibility complex-restricted
receptor. J Exp Med 1994;180:25±34.
[35] Rollins-Smith LA, Blair P. Expression of class II major histo-
compatibility complex antigens on adult T cells in Xenopus is
metamorphosis-dependent. Dev Immunol 1990;1:97±104.
[36] Rollins-Smith LA. Metamorphosis and the amphibian
immune system. Immunol Rev 1998;166:221±30.
[37] Du Pasquier L, Flajnik MF. Expression of MHC class II anti-
gens during Xenopus development. Dev Immunol 1990;1:85±
95.
J. Robert et al. / Developmental and Comparative Immunology 25 (2001) 323±336336
