Suppression of Acute Anti-Friend Virus CD8� T-Cell Responses byCoinfection with Lactate Dehydrogenase-Elevating Virus�
Shelly J. Robertson,1† Christoph G. Ammann,1† Ronald J. Messer,1 Aaron B. Carmody,1 Lara Myers,1Ulf Dittmer,2 Savita Nair,2 Nicole Gerlach,2 Leonard H. Evans,1
William A. Cafruny,3 and Kim J. Hasenkrug1*Laboratory of Persistent Viral Diseases, Rocky Mountain Laboratories, National Institute of Allergy and Infectious Diseases,
National Institutes of Health, Hamilton, Montana 598401; Institute of Virology, University of Duisburg-Essen,Hufelandstr. 55, 45122 Essen, Germany2; and Sanford School of Medicine, University of South Dakota,
414 Clark St., Vermillion, South Dakota 570693
Received 28 June 2007/Accepted 11 October 2007
Friend virus (FV) and lactate dehydrogenase-elevating virus (LDV) are endemic mouse viruses that cancause long-term chronic infections in mice. We found that numerous mouse-passaged FV isolates also con-tained LDV and that coinfection with LDV delayed FV-specific CD8� T-cell responses during acute infection.While LDV did not alter the type of acute pathology induced by FV, which was severe splenomegaly caused byerythroproliferation, the immunosuppression mediated by LDV increased both the severity and the durationof FV infection. Compared to mice infected with FV alone, those coinfected with both FV and LDV had delayedCD8� T-cell responses, as measured by FV-specific tetramers. This delayed response accounted for theprolonged and exacerbated acute phase of FV infection. Suppression of FV-specific CD8� T-cell responsesoccurred not only in mice infected concomitantly with LDV but also in mice chronically infected with LDV 8weeks prior to infection with FV. The LDV-induced suppression was not mediated by T regulatory cells, andno inhibition of the CD4� T-cell or antibody responses was observed. Considering that most human adults arecarriers of chronically infectious viruses at the time of new virus insults and that coinfections with viruses suchas human immunodeficiency virus and hepatitis C virus are currently epidemic, it is of great interest todetermine how infection with one virus may impact host responses to a second infection. Coinfection of micewith LDV and FV provides a well-defined, natural host model for such studies.
In 1957, Charlotte Friend described a filterable agent iso-lated from leukemic mice that transmitted the induction ofmalignant tumors following passage to healthy mice (22). Thefilterable agent was later defined as a viral complex containinga replication-competent retrovirus named Friend murine leu-kemia virus (F-MuLV) and a replication-defective retrovirusnamed spleen focus-forming virus (SFFV) (reviewed in refer-ence 31). The structural genes of SFFV are defective, andSFFV cannot spread in the absence of a helper virus such asF-MuLV. However, SFFV is required to induce leukemia inadult mice due to two important factors. First, SFFV encodesa truncated Env glycoprotein (gp55) that binds to erythropoi-etin receptors (EpoR) on nucleated erythroid precursors andinduces a proliferative signal (36). Second, the full transforma-tion of cells to the leukemic state in Friend virus (FV)-infectedmice is associated with SFFV provirus integration into both theSpi-1 proto-oncogene (44) and the p53 tumor suppressor gene(46). For type C retroviruses such as FV, integration into thehost genome requires actively dividing cells. Thus, gp55 bind-ing to EpoR not only increases the number of target cells for
virus entry but also renders them susceptible to provirus inte-gration.
Mouse-passaged retrovirus stocks are typically swarms con-taining numerous variants, with a range of pathogenic capabil-ities. Virus stocks of F-MuLV and SFFV clones have beenobtained by in vitro culture and have been used to successfullyinfect mice (32, 39, 40). However, in our experience, suchtissue culture-derived virus stocks have been less pathogenicthan mouse-passaged virus stocks (unpublished results).Cloned viruses may contain some but not all of the propertiesof the swarm. For example, a Friend virus clone variant, FIS-2,induces immunosuppression but has weak leukemogenicity(14). Low pathogenicity can also be due to low titers of theSFFV component, which is positively selected in vivo but not invitro. Consequently, many studies requiring highly pathogenicvirus complexes have been done with mouse-passaged stockscontaining not only high titers of the pathogenic SFFV com-ponent but also naturally arising virus variants. The use of suchnatural virus swarms has been important in vaccine studiesbecause the viruses present a much stronger challenge to theimmune system than the cloned virus stocks, not only in termsof pathogenicity but also in their antigenic complexity. Like-wise, genetic studies of host resistance have been greatly facil-itated by the use of mouse-passaged virus stocks with sufficientpathogenicity to display phenotypic variability in differentmouse strains (8).
Although in vivo passage of FV stocks offers distinct advan-tages for certain types of studies, there are also inherent dis-
* Corresponding author. Mailing address: Laboratory of PersistentViral Diseases, Rocky Mountain Laboratories, National Institute ofAllergy and Infectious Diseases, National Institutes of Health, Ham-ilton, MT 59840. Phone: (406) 363-9310. Fax: (406) 363-9286. E-mail:[email protected].
† S.J.R. and C.G.A. contributed equally to the work described in thisarticle.
� Published ahead of print on 24 October 2007.
408
advantages. For example, an unintended consequence of invivo passage can be the introduction or propagation of theviruses present in the mice used for passage. Current experi-ments have shown that some FV stocks passaged in mice formore than 3 decades contain lactate dehydrogenase-elevatingvirus (LDV). Evidence suggested that LDV was present in FVstocks as early as 1963 (56), and this was confirmed in 1969(61). Thus, LDV is a long-standing component of the FVcomplex. This information was overlooked in recent decades,and FV studies have not addressed the effects of LDV on FVreplication and pathogenicity in mice.
LDV is an interesting and unusual virus that is endemic inwild-mouse populations. It is an enveloped, positive-strandedRNA virus classified in the order Nidovirales, which also con-tains coronaviruses, the cause of a recent outbreak of severeacute respiratory syndrome infection in humans in 2003 (17,34, 52). Although LDV has been eliminated from most exper-imental mouse colonies, it is still found in some transplantabletumor cell lines and virus stocks (7, 47). Its name derives fromits capacity to rapidly infect and cytolyze a small subset ofmacrophages responsible for scavenging lactate dehydroge-nase from the circulation (53). LDV is highly restricted to thismacrophage subset. LDV has been described as an ideal per-sistent virus because of its ability to establish life-long viremicinfections in mice regardless of strain, age, sex, or immunestatus, with no overt clinical signs (54). Virus replication isextremely rapid, and plasma titers reach 109 to 1010 50% in-fective doses (ID50) per milliliter within 12 to 16 h of infection.Due to the loss of permissive target cells for infection, LDVtiters gradually decrease until they reach a steady-state level of104 to 106 ID50 per milliliter, depending on the mouse strainand the rapidity of target cell replenishment.
Interestingly, the immune response has little detectable ef-fect on LDV infections. Antibodies against LDV are generatedduring the course of infection but appear to be relatively inef-fective at neutralizing virus in vivo. LDV circulates as an in-fectious virus-immunoglobulin G (IgG) complex duringchronic infection (4). Neutralizing epitopes appear to bemasked by sugars (65), similar to that seen with human immu-nodeficiency virus (HIV) infection (3). Furthermore, the pas-sive transfer of polyclonal or monoclonal antibodies that neu-tralize LDV in vitro has little effect on viremia in vivo (24).CD8� T-cell responses are elicited by LDV infection but areineffective at decreasing virus loads, likely because of the rapidcytolytic infection caused by this virus (63). Thus, specific im-mune responses are raised against LDV but are unable tocontrol viremia. There is currently no effective vaccine againstLDV.
Although immune responses have little apparent effect onLDV titers, LDV induces dramatic effects on the immunesystem. Among the reported effects are impaired antigen pre-sentation by macrophages (30), polyclonal B-cell activation(12, 13), NK cell activation (42), impaired delayed-type hyper-sensitivity responses (29), and inhibited cellular immune re-sponses (28). LDV also induces a potent alpha interferon(IFN-�) response within the first day after infection (53). Thus,the presence of LDV in FV stocks could have major impactson anti-FV immune responses and pathogenesis. In the currentstudy, mice were infected with LDV, FV, and a combination ofboth viruses (FV/LDV), to study the acute effects of infection
on the immune system and on FV replication. Results indi-cated that the presence of LDV delayed FV-specific T-cellresponses by approximately 1 week, thereby extending the pe-riod of peak FV replication and increasing pathogenicity.
MATERIALS AND METHODS
Mice. Experiments were conducted using 12- to 24-week-old female(C57BL/10 � A.BY) F1 mice bred at the Rocky Mountain Laboratories (RML).The relevant FV resistance genotypes of these mice are H-2b/b, FV1b/b, FV2r/s,and Rfv3r/s. FV-specific T-cell receptor (TCR) transgenic (Tg) mice (48), whichcarry a TCR transgene that recognizes the gag leader peptide of FV (6), werealso bred at the RML. BALB/c mice were purchased from Harlan Labs (India-napolis, IN). Mice were treated in accordance with the regulations and guidelinesof the Animal Care and Use Committee of the RML and the National Institutesof Health.
Detection of LDV in mouse-passaged FV stocks. The presence of LDV inmouse-passaged FV stocks maintained at the RML was detected both by lactatedehydrogenase (LDH) assays with serum from infected mice and by TaqManreverse transcription-PCR with RNA purified directly from FV stocks (see be-low). All RML mouse-passaged FV stocks, including B-tropic, N-tropic, and theoriginal 1973 NB-tropic stock obtained from the Lilly laboratory (38), testedpositive for LDV. All virus stocks maintained in tissue culture were negative forLDV, consistent with the inability of LDV to grow in tissue culture cell lines(reviewed in reference 54).
Generation of LDV-free FV stocks. The inability of LDV to grow in tissueculture cell lines was employed to obtain a new FV stock free of LDV. Fischerrat embryo cells were infected with the LDV/FV stocks, and the cells werecultured at 37°C in 5% CO2 for 9 days, with five changes of medium (RPMImedium containing 100 U/ml penicillin, 100 �g/ml streptomycin, 5 � 10�5 M2-mercaptoethanol [Sigma-Aldrich, St. Louis, MO], and 10% fetal calf serum[Nova-Tech, Inc., Grand Island, NY]). Culture supernatants were collected onday 9 and used to infect BALB/c mice. Four days after infection, the mice werebled, and sera were shown to be negative for elevated LDH levels. When thespleens were removed on day 14, all were seen to be enlarged with typical-appearing FV-induced splenomegaly, and all tested positive for F-MuLV byinfectious center assays. An undiluted sample of the new FV stock was amplifiedby reverse transcription-PCR (RT-PCR) using LDV-specific primers and probesand yielded no detectable amplification product. In contrast, a 10�3 dilution ofthe same stock tested positive for both the F-MuLV env-specific and the gag-specific primers and probes. The new FV stock also tested positive for F-MuLVby infectious center assays and positive for SFFV by spleen focus assay asdescribed previously (38). To increase the titer of SFFV, the new FV stock waspassaged again in BALB/c mice.
Generation of FV-free LDV stock. To obtain an LDV stock, plasma was takenfrom mice 14 h after they were coinfected with FV/LDV. At that time point, highlevels of LDV virions were released from infected cells, but F-MuLV replicationhad not been completed. Infection of BALB/c mice with LDV-containing plasmadid not induce splenomegaly, a highly sensitive bioassay for the presence ofF-MuLV, but the mice tested positive for LDV both by reverse transcription-PCR and by the elevation of serum LDH. The undiluted plasma was amplifiedby RT-PCR using F-MuLV-specific primers and probes and yielded no detect-able amplification product. In contrast, a 10�5 dilution of the same plasma testedpositive for LDV, using LDV-specific primers and probe.
Infections. Mice were infected by intravenous injection of 0.5 ml of phosphate-buffered balanced salt solution containing 2% fetal bovine serum and 20,000spleen focus-forming units of FV, alone or in combination with 0.2 ml of a1-to-100 dilution of sera containing LDV.
Infectious center assay. An infectious center assay (57) was used to determinethe number of spleen cells from infected animals that were producing infectiousvirus. Serial 10-fold dilutions of spleen cells were plated onto susceptible Musdunni cells and cocultured for 3 days. Cells were then fixed with ethanol andincubated sequentially with F-MuLV envelope-specific monoclonal antibody(MAb) 720 (57) and peroxidase-conjugated goat anti-mouse IgG (Cappel, WestChester, PA). Foci of infections were identified following development withaminoethylcarbazole substrate.
Virus-neutralizing antibody assay. To test for virus-neutralizing antibodies,heat-inactivated (56°C; 10 min) plasma samples at titrated dilutions were incu-bated with an aliquot of F-MuLV stock in the presence of guinea pig comple-ment at 37°C, as previously described (45). The samples were then analyzed byfocal infectivity assays, as described above. The titer was defined as the plasmadilution at which greater than 75% of the input virus was neutralized.
VOL. 82, 2008 LDV SUPPRESSION OF ANTI-FV IMMUNITY 409
LDH assay. Blood samples were collected by retroorbital bleed and centri-fuged (6,000 � g; 10 min at 4°C) to separate the plasma from cellular compo-nents. The freshly collected plasma samples were tested for LDH activity, aspreviously described (7), with some modifications. Briefly, sodium pyruvate andNADH were prepared fresh by dissolving each at 2.5 mg/ml in LDH buffer (0.1M sodium phosphate, pH 7.4). The freshly prepared sodium pyruvate (0.8 ml)and NADH (0.8 ml) were mixed well with 19.2 ml of LDH buffer. This solution(200 �l per well) was dispensed into a 96-well UV-transparent microtiter plate,and 2 �l of plasma was added and mixed well. The optical densities of thereaction mixture at 340 nm were determined immediately (time zero) and after1 min. A decrease in the absorbance from time zero to 1 min indicated theoxidation of NADH by LDH. Mice were considered positive for LDV if the LDHactivity was at least fivefold higher than that of the uninfected controls.
TaqMan RT-PCR for detection of LDV and FV. Viral RNA was extracted from100 �l of plasma or 200 �l of spleen homogenate, using a MagMAX viral RNAisolation kit (Ambion, Foster City, CA). Approximately 200 ng of RNA wasreverse transcribed and amplified using an RNA UltraSense one-step quantita-tive RT-PCR system (Invitrogen, Carlsbad, CA) with LDV 5� UTR/ORF-1a-specific primers and probe (sense, CGTGCGGTAACCGTCTATTTC; anti-sense, ATCCCGACTGCATGGTTATAGGT; probe, CTCCTACTATACCTCCCTCTCTAACATTTCCGGG) and two sets of FV-specific primers and probe(FV envelope sense, AAGTCTCCCCCCGCCTCTA; antisense, AGTGCCTGGTAAGCTCCCTGT; probe, ACTCCCACATTGATTTCCCCGTCC; FV gagsense, GCCACGAGACGGCACTTT; antisense, TCCATGTGGGCCAGATGAG; probe, ACCCAGACATTATTACACAGGTTAAGATCAAG). The am-plification primers and probes for LDV were designed from the LDV U15146sequence from the NCBI database. Amplification was detected using an AppliedBiosystems 7900HT sequence detection system (Foster City, CA).
Surface and intracellular staining and flow cytometry. The expression of cellsurface markers on splenocytes was analyzed by using fluorochrome-conjugatedantibodies to CD4 (clone RM4-5), CD8 (clone 53-6.7), CD11b (M1/70), CD11c(clone HL3), CD19 (clone 1D3), Ter119 (clone Ter119), and CD43 (clone 1B11)(all from BD Pharmingen, San Jose, CA). Cell surface FV glycosylated Gag(glycogag) was detected with MAb 34 (10) stained with allophycocyanin (APC)-labeled goat anti-mouse IgG2b antiserum (Invitrogen, Carlsbad, CA). Tetramersfor FV-specific CD4� and CD8� T cells have been described previously (60).
For the detection of intracellular IFN-� production, spleen cells were stimu-lated with either plate-bound CD3 antibody (see Fig. 3) (27) or DbGagL majorhistocompatibility class I (MHC-I) tetramer (NIAID Tetramer Core Facility)(see Fig. 4) for 5 h in the presence of 10 �g/ml brefeldin A. The cells were thenstained for the surface expression of CD4 and CD8, fixed with 2% formaldehyde,permeabilized with 0.1% saponin in phosphate-buffered saline containing 0.1%sodium azide and 1% fetal calf serum, and incubated with allophycocyaninanti-IFN-� (clone XMG1.2) (BD Pharmingen). Data were acquired using eithera FACSCalibur or an LSRII flow cytometer (BD Biosciences, San Jose, CA) andwere analyzed using FlowJo version 8.3 (Tree Star, Inc., Ashland, OR) software.
In vivo T-cell depletions. FV-infected mice were depleted of CD8� T cells byintraperitoneal (i.p.) injection of 100 �g of anti-CD8 (clone 169.4) at 0, 2, and 5days postinfection (11). Control mice received injections of 100 �g of rat immu-noglobulin (Sigma). Anti-CD8 treatment achieved greater than 98% depletion ofCD8� T cells, as determined by flow cytometry. FV/LDV-infected mice weredepleted of CD4� T cells by intraperitoneal injection of 100 �g of anti-CD4(clone 191.1) at 0 and 3 days postinfection or at day �1 and 0 and at 4 dayspostinfection. Both anti-CD4 treatments resulted in greater than 99% depletionof CD4� T cells and greater than 96% depletion of regulatory T cells (defined asCD25�Foxp3�).
In vitro suppression assay. FV-specific TCR Tg CD8� T cells were purifiedusing anti-CD8� magnetic microbeads and the MidiMACS system as recom-mended by the manufacturer (Miltenyi Biotech). The CD8-depleted spleen cellsfrom TCR Tg mice served as the antigen-presenting cells (APCs), which wereincubated with the DbGagL peptide (5 �g/ml) (6) in Iscove’s modified Dulbec-co’s medium (IMDM; Cambrex, Wilkerville, MD) containing 10% normalmouse serum for 60 min at 37°C, irradiated (3,000 rad), and washed twice withIMDM. TCR CD8� T cells and peptide-pulsed APCs (2 � 105 each) werecultured per well of a flat-bottomed 96-well plate in IMDM containing 10% fetalbovine serum, 2 mM L-glutamine, 50 �M 2-mercaptoethanol, and 100 U/ml eachof penicillin and streptomycin at 37°C, 5% CO2. Naı̈ve CD4� CD25� (2 � 105)T cells were also included in cocultures for optimal IFN-� expression by stimu-lated CD8� T cells. CD4� CD25� (6 � 105) T cells from either naı̈ve orchronically infected mice were added to each well for a 2-to-1 ratio of T regu-latory (Treg)-to-CD8� T cells. Coculture supernatants were collected after 48 hand assayed for IFN-� content by enzyme-linked immunosorbent assay, as de-scribed previously (59). The percentages of suppression were determined by
comparison of the amounts of IFN-� produced in stimulated CD8� T-cell cul-tures containing CD4� CD25� T cells from naive mice.
RESULTS
Exacerbation of FV infection by coinfection with LDV. Toexamine whether the presence of LDV affected the course ofFV infection, we first determined the kinetics of FV infectionin mice inoculated with an LDV-free FV stock compared withthat in mice infected with our standard RML stock of mouse-passaged FV that contained LDV. FV infection was deter-mined by flow-cytometric detection of viral glycogag protein onsplenocytes. At 7 days postinfection, FV-infected mice had asignificantly greater percentage of FV antigen-positive spleencells than mice coinfected with LDV (Fig. 1A). However, byday 14, the percentage of cells expressing FV antigen wasreduced to nearly undetectable levels in FV-infected mice. Incontrast, FV levels continued to climb after 7 days postinfec-tion in mice coinfected with LDV. By day 28, FV infectionswere largely resolved in both groups. FV-induced splenomeg-aly and infectious center data were consistent with those of theabove-described results (data not shown). These results sug-gested that the presence of LDV exacerbated and prolongedFV infection.
Because the spleen focus assay used to determine the titersof the above-mentioned virus stocks does not accurately mea-sure twofold differences, a possible explanation for the highervirus levels observed for FV-infected mice at day 7 is that theFV titer was greater in the LDV-free FV stock than in theRML stock containing both viruses. To ensure that each groupreceived the same FV dose, the kinetic studies were repeatedwith mice inoculated with LDV-free FV, either alone or withFV/LDV. Levels of FV infection were again determined byflow cytometric analysis of viral antigen on splenocytes andalso by infectious center assays. At day 7, the levels of FVinfection between the two groups were not significantly differ-ent (Fig. 1B and C). Interestingly, despite similar FV titers atday 7, the virus levels in mice infected with LDV-free FV againdeclined dramatically over the next week, while the FV levelsin FV/LDV-coinfected mice continued to increase (Fig. 1Band C). Thus, the ability of mice to more quickly resolve FVinfections in the absence of LDV was not due to differences inthe FV dose or to the relative infection levels at day 7. Theresolution of LDV-free FV infection between 1 and 2 weekspostinfection suggested a role for adaptive immunity. More-over, the inability of coinfected mice to resolve FV infectionduring this time suggested that LDV infection caused someinhibition of FV-specific immune responses.
The presence of LDV does not alter the cellular distributionof FV infection at 1 week postinfection. The major organ in-fected by FV is the spleen, and previous studies using LDV-containing FV stocks showed that the infected cells were pri-marily proliferating erythroid progenitor cells. Lymphoid andmonocytic cells were also infected by FV, albeit to a muchlesser extent (16, 26). Because FV requires cell replication forproductive infection, polyclonal activation of immune cells byLDV infection (12, 13, 37) could potentially increase the cells’susceptibility to FV infection (49) and thereby alter their func-tion (50). FV infection with or without LDV induced strongproliferation of erythroid precursor cells (Ter119�), and there
410 ROBERTSON ET AL. J. VIROL.
were no significant differences in the overall cellular composi-tion of the spleens between the two groups of infected mice(Fig. 2A). Furthermore, there was no evidence that the pres-ence of LDV significantly altered the pattern of FV infection inthe cellular subsets analyzed, as determined by the percentage(Fig. 2B) or the number (data not shown) of infected cellswithin each cell subset at 1 week postinfection. We next soughtto determine if LDV altered antiviral immune responses.
FV-specific antibody responses. Since FV-specific antibodieshave previously been shown to be essential for recovery fromFV infection (9, 25), antibody titers were measured at 1 and 2weeks postinfection in FV- and FV/LDV-infected mice. FV-neutralizing antibodies were not detectable at 1 week postin-fection in either group (Fig. 3A). By 2 weeks postinfection, allmice in both groups had detectable antibody responses, andthere were no significant differences in antibody titers betweenthe two groups. Thus, there was no evidence that the antibodyresponse was suppressed by LDV infection.
General T-cell responses. Previous studies showed that T-cell responses were important in the recovery from FV infec-tion (58). CD8� T-cell responses were especially important inthe early phase of recovery, while CD4� T cells were mostimportant after 2 to 3 weeks postinfection (58). General levelsof T-cell activation were assessed by measuring the expressionof the activation-induced isoform of CD43 on T cells takendirectly ex vivo (23). Also, the ability of T cells to produceIFN-� was measured by intracellular cytokine staining. Com-pared to the expression level of CD43 in naive mice, the per-centages of both the CD4� T cells (Fig. 3B) and the CD8� Tcells (Fig. 3C) expressing CD43 were significantly increased inall infected groups at 1 week postinfection. Interestingly, thecombination of FV plus LDV did not produce an additiveeffect compared to that of either virus alone. Although there
FIG. 1. Exacerbation of FV infection by coinfection with LDV.(A) Mice were infected with LDV-free FV or with a standard RMLvirus stock, and spleens were removed from naive mice (day 0) or frommice at day 7, day 14, and day 28 after infection. Spleen cells wereanalyzed by flow cytometry for cell surface expression of the FV gly-cogag protein, using MAb 34 (10). The graph indicates the percentageof MAb 34-positive cells in nucleated splenocytes. The data were fromfour mice at each time point. (B) Mice were infected with FV alone orwith FV mixed with LDV, and spleens were analyzed at 7 and 14 daysafter infection. Spleen cells were stained for cell surface expression ofthe FV glycogag protein, using MAb 34. The graph shows the meanpercentages � standard errors of the means (SEM) of MAb 34-posi-tive cells in nucleated splenocytes, as determined by flow cytometry.(C) Spleen cells were also assayed for virus-producing cells by aninfectious center assay, and the graph shows the mean numbers �SEMs of virus-producing cells per spleen from mice infected with FV,or with mixed FV and LDV. Data were compiled from six to eight miceper group at each time point. Error bars indicate standard errors.Asterisks indicate that the differences between FV infection and FV/LDV coinfection are statistically significant (P 0.05) as determinedby the Mann-Whitney U test. FV-induced splenomegaly results (datanot shown) were consistent with the viral antigen and infectious centerresults.
FIG. 2. Cellular distribution of FV infection at 1 week postinfec-tion. Mice were infected with FV or FV/LDV, and spleens were re-moved at day 7 after infection, and single-cell suspensions were madefor immediate analysis. Spleen cells were labeled with MAb 34 inconjunction with antibodies to lineage-specific surface molecules andanalyzed by flow cytometry. The graphs show the mean percentages �standard errors of the means of cells in each lineage (A) of Ter119(erythroid cells), CD11c (dendritic cells), CD11b (monocytes), CD4(helper T cells), CD8 (cytotoxic T cells), and CD19 (B cells), and thepercentage of cells in each lineage expressing FV glycogag (B). Datawere compiled from four mice per group.
VOL. 82, 2008 LDV SUPPRESSION OF ANTI-FV IMMUNITY 411
was no detectable production of IFN-� by CD4� T cells fromany of the groups (Fig. 3D), there was a significant increase inthe percentage of CD8� T cells that produced IFN-� in miceinfected either with LDV alone or with FV/LDV (Fig. 3E).Thus, the overall CD8� T-cell IFN-� response to LDV wassignificantly more robust than the response to FV (Fig. 3E).There was no indication of a generalized suppression of T-cellresponses in LDV-infected mice.
Suppression of anti-FV immune responses by coincidentLDV infection. Although general T-cell responses in FV/LDV-infected mice were not suppressed, we next examined the effectof LDV coinfection with FV-specific CD4� T and CD8� T-cellresponses in mice infected with FV alone or with LDV.Splenocytes were isolated at days 7 and 14 following infection,stained for CD4 and CD8 in conjunction with FV-specificMHC-II and -I tetramers, respectively, and analyzed by flowcytometry. At day 7, there were detectable FV-specific CD4�
T-cell responses from both groups, with no significant differ-ences between the groups (Fig. 4A). However, there was astriking difference in the FV-specific CD8� T-cell responses.FV-infected mice had vigorous proliferative responses to theimmunodominant FV glycogag epitope at day 7, as measuredboth by percentages (Fig. 4B) and by absolute numbers (Fig.4C). Furthermore, the CD8� T cells were functional in termsof their ability to produce IFN-� (Fig. 4D). In comparison, theFV/LDV-coinfected mice had significantly less accumulationof tetramer-positive CD8� T cells by day 7, although vigorousresponses were detectable by day 14 (Fig. 4B and C). Thus,coinfection with LDV caused a delay in detectable FV-specificCD8� T-cell responses.
CD8� T-cell responses are required for early recovery. Itwas of interest to determine if the failure of FV/LDV-coin-fected mice to develop CD8� T-cell responses at day 7 postin-fection was sufficient to account for their inability to control
FIG. 3. No suppression of antibody or general T-cell responses by LDV at 1 week postinfection. Plasma samples were assayed for FV-neutralizing antibody, and titers show the reciprocal of the dilution that produced 75% neutralization of input virus (A). Activation of CD4�
(B) and CD8� T (C) cells at 7 days postinfection was measured by the upregulation of CD43 with spleen cells taken directly ex vivo from miceinfected with FV, LDV, or FV/LDV. Compared to that of naı̈ve mice, there was significant activation of both subsets of cells in all types ofinfections (P 0.008 for all groups). As measured by intracellular cytokine staining following anti-CD3-stimulation, there was no significantincrease in the percentage of CD4� T cells producing IFN-� in any of the groups (D). Increases in percentages of CD8� T cells producing IFN-�were significant in both of the LDV-infected groups (P 0.001) but not the FV-infected group (E). Statistical analyses were carried out using anunpaired t test with Bonferroni correction, where n 8 mice/group.
412 ROBERTSON ET AL. J. VIROL.
FV infection between 1 and 2 weeks postinfection. If that werethe case, then mice infected with FV in the absence of a CD8�
T-cell response should also fail to display early virus control.We found that FV-infected mice depleted of CD8� T cellsprior to infection followed a course very similar to that ofFV/LDV-coinfected mice (Fig. 5). Viral loads increased be-tween the first and second week rather than beginning to
resolve as they did in the presence of CD8� T cells. These dataindicated that LDV-mediated suppression of anti-FV CD8�
T-cell responses during the first week of coinfection likelyaccounted for the delayed control of FV during the acutephase.
Virus-induced regulatory T cells. Previous studies showedthat acute (66) and chronic (15) infection of mice with the FVcomplex containing LDV induced Treg cells that affectedCD8� T-cell functions. To determine if LDV induced Tregcells that might correlate with the decreased accumulation ofFV-specific CD8� T cells, an in vitro suppression assay wasperformed with CD4� Treg cells obtained from mice infectedwith either LDV or FV. Since differences in CD8� T-cellaccumulation were already evident at day 7, Treg cell activitywas tested at days 3 and 7 postinfection. Indeed, mice infectedwith LDV had significant Treg-mediated suppression of IFN-�production by FV-specific CD8� T cells at day 3 (Fig. 6A).These findings are consistent with previous results showingthat virus-induced Treg cells inhibited CD8� T cells in vitroregardless of the TCR specificity of the CD8� T cell (59). Byday 7, the LDV-associated Treg suppression decreased andFV-associated suppression increased. Thus, the timing of theLDV induction of Treg cells fit with a possible role in slowingthe CD8� T-cell response.
If LDV-induced Treg cells were responsible for delayedCD8� T-cell responses, then the depletion of CD4� T cellswould be expected to reverse the delay as long as the CD8�
FIG. 4. Abrogated FV-specific CD8� T-cell responses in mice coinfected with LDV. Mice were infected either with FV alone or with LDV.Spleens were removed from naive mice (day 0) and from mice at 7 and 14 days after infection. (A) Spleen cells were analyzed by flow cytometryfor the expression of cell surface CD4 and FV-specific MHC-II tetramer. The graph shows the mean percentages � standard errors of the means(SEM) of tetramer-positive CD4� T cells (n 4 mice per group). Spleen cells were also stained directly ex vivo for cell surface CD8 andFV-specific MHC-I tetramer. The graphs show the mean percentages (� SEM) (B) and numbers (C) of tetramer-positive CD8� T cells (n 5to 8 mice per group). (D) Spleen cells were stimulated with MHC-I tetramers in the presence of brefeldin A for 5 h and stained for the surfaceexpression of CD8 and the intracellular expression of IFN-� (n 4 to 6 mice per group). The graph shows the mean percentages � SEM of CD8�
T cells that expressed intracellular IFN-�. Asterisks (*) indicate that the difference between FV infection and FV/LDV coinfection is statisticallysignificant (P 0.05) as determined by the Mann-Whitney U test.
FIG. 5. Resolution of acute FV infection depends on CD8� T-cellresponses. FV-infected mice were depleted of CD8� T cells during thefirst week of infection, and spleen cells were prepared at day 7 and day14 postinfection to assay for infectious centers. Depletions weregreater than 98% complete. The graphs show the mean numbers �standard errors of the means of infectious centers per spleen from fourmice per group at each time point. The difference between the de-pleted and nondepleted FV-infected mice was statistically significant(P 0.0001 by Student’s t test).
VOL. 82, 2008 LDV SUPPRESSION OF ANTI-FV IMMUNITY 413
T-cell response was CD4� T-cell independent. To determinefirst if this premise was true, FV-specific CD8� T-cell re-sponses were measured in mice depleted of CD4� T cells byinjection of MAb (11). The depletions were highly effective inreducing levels of CD4� T cells, including levels of theFoxp-3� subset, by greater than 99% by day 7 following anti-body injection. At day 7, the CD4-depleted mice had FV-specific CD8� T-cell (tetramer-positive) responses as high asthose in the control, nondepleted mice (Fig. 6B), indicatingthat the FV-specific CD8� T-cell response in FV-infected micewas CD4� T-cell independent. In FV/LDV-coinfected mice,depletion of CD4� T cells did not restore a normal CD8�
T-cell response at 7 days postinfection (Fig. 6B). Similar resultswere obtained from mice treated with PC61 anti-CD25 anti-body, reported to block Treg cell-mediated suppression (33,43) (data not shown). Thus, the failure of coinfected mice todevelop CD8� T-cell responses by 1 week postinfection couldnot be attributed solely to LDV-induced Treg cells.
Suppression of anti-FV responses in mice chronically in-fected with LDV. Infection with LDV causes numerous acute
effects such as extremely high viral load (51), induction ofIFN-� (18), and polyclonal immune cell activation (12, 13, 37)that could be responsible for delaying anti-FV CD8� T-cellresponses. To address the question of whether any of thesefactors were responsible for the inhibition of FV-specific T-cellresponses, we utilized mice chronically infected with LDV.These mice have 10,000-fold lower titers of LDV compared tothat of LDV-infected mice at 16 h postinfection, as determinedby quantitative real-time PCR (data not shown), undetectablelevels of IFN-�, and no polyclonal lymphocyte activation. Micechronically infected with LDV (�8 weeks after LDV infection)were infected with FV. At 16 h postinfection with FV, therewas no significant induction of IFN-� (Fig. 7A) and no signif-icant polyclonal lymphocyte activation as measured by CD69upregulation (Fig. 7B). There was a slight increase in thepercentage of tetramer-positive CD8� T cells in mice chroni-cally infected with LDV compared to that of naı̈ve mice, butthe response was not statistically significant. Regardless, com-pared to mice with no LDV infection, the LDV chronicallyinfected mice had significantly suppressed FV-specific CD8�
T-cell responses (Fig. 7C). As with the mice infected with bothFV and LDV simultaneously (Fig. 4), the FV-specific CD8�
T-cell response recovered by 14 days postinfection (Fig. 7C).Thus, even in the absence of high titers of LDV, type I IFNresponses, and polyclonal T-cell activation, the presence ofLDV suppressed FV-specific CD8� T-cell responses.
DISCUSSION
The findings of this study demonstrate that the presence ofLDV in FV stocks causes suppression of FV-specific CD8�
T-cell responses resulting in prolonged acute infection. LDVcoinfection did not affect the kinetics of the early FV replica-tion, the cellular tropism of FV, the generation of FV neutral-izing antibodies, or the CD4� T-cell responses. However, theFV-specific CD8� T-cell responses were delayed by approxi-mately 1 week, which was sufficient to account for delayed virusclearance. Interestingly, there was no evidence that the LDV-specific CD8� T-cell response was suppressed. Although wedid not have LDV-specific tetramers to directly analyze theCD8� T-cell responses, CD8� T-cell expansion, upregulationof activation markers, and production of IFN-� in LDV-in-fected and FV/LDV-coinfected mice all suggested that theresponse to LDV was intact. This interpretation is consistentwith previous findings that acute LDV infection induces acytotoxic T-lymphocyte response detectable by 1 week postin-fection (21, 54). Thus, the suppression appeared to be specificfor the CD8� T-cell response to FV.
Since LDV titers reach such high levels so quickly (109 to1010 ID50/ml by 16 h postinfection), it is possible that the APCsnecessary to initiate FV-specific CD8� T-cell responses wereoverwhelmed with LDV antigens, with no remaining capacityto process and/or present FV antigens present at compara-tively minute concentrations. In contrast, APCs responding toFV infections in the absence of LDV would be highly focusedand able to prime CD8� T cells. However, we showed thatmice with chronic LDV infections, where LDV titers werereduced by 4 log10 (our unpublished data and see reference 51)compared to acutely infected mice also had suppressed anti-FVresponses. This result demonstrates that extremely high LDV
FIG. 6. Regulatory T-cell induction. (A) CD4� CD25� T cells wereisolated from the spleens of naive mice and from those of mice infectedwith LDV or FV, at days 3 and 7 following infection, and were assayedin vitro for their ability to suppress IFN-� production by CD8� T cells.TCR Tg CD8� T cells were stimulated in vitro with peptide-pulsedAPCs and cocultured in the presence of enriched CD4� CD25� Tcells. After 48 h, the culture supernatants were collected and analyzedfor IFN-� by enzyme-linked immunosorbent assay. The graphs showthe mean percentages � standard errors of the means (SEM) ofsuppression of IFN-� production relative to that of cocultures contain-ing stimulated CD8� T cells with CD4� CD25� T cells from naivemice. The data are compiled from four mice per group. (B) Miceinfected with FV alone or with mixed FV/LDV were treated withCD4-depleting antibody during the first week of infection. Spleen cellswere isolated at 7 days postinfection, stained for cell surface CD8 andFV-specific MHC-I tetramer, and analyzed by flow cytometry. Thegraph shows the mean percentages � SEM of CD8� T cells that aretetramer positive. Data were compiled from four to nine mice pergroup.
414 ROBERTSON ET AL. J. VIROL.
FIG. 7. Suppression of FV infection-specific CD8� T-cell responses during chronic LDV infection. Plasma IFN-� responses (A) and theupregulation of CD69 early activation marker on total spleen lymphocytes (B) (representative data) were measured at 16 h postinfection of naivemice or of mice infected with FV alone or with LDV (left panel) and in mice chronically infected with LDV prior to FV infection (chLDV/FV)(right panel). (C) FV-specific tetramers were used to label CD8� T cells at 7 and 14 days following FV infection of naı̈ve mice or of mice that werealready chronically infected with LDV. The naı̈ve mice, n 7; chronic LDV mice, n 2; FV-infected mice, n 9; chLDV/FV mice, n 4.Asterisks (*) indicate that the difference between the FV infection and chLDV/FV infection groups was statistically significant by two-tailedStudent’s t test (P 0.0118).
VOL. 82, 2008 LDV SUPPRESSION OF ANTI-FV IMMUNITY 415
titers were not necessary to suppress the FV-specific CD8�
T-cell response, but it remains possible that chronic LDV lev-els were still sufficient to swamp the antigen-presenting ma-chinery. It is also possible that LDV peptides have higheraffinity for MHC-I molecules and are able to outcompete FVpeptides for antigen presentation, thereby slowing the FV-specific CD8� T-cell response. Given that CD4� T cells alsoneed APC function and that the CD4� T-cell response was notsuppressed, any impairment of the APC machinery must bepredominantly in the MHC-I pathway.
Our experiments rule out the possibility that LDV-inducedTreg cells were solely responsible for delayed FV-specificCD8� T-cell responses. Although LDV induced suppressive Tcells very early during infection, depletion of those cells did notrestore the FV-specific CD8� T-cell response at 1 week postin-fection in FV/LDV-coinfected mice. It remains possible thatLDV-induced Treg cells play a contributory role in delayingthe FV-specific CD8� T-cell response, but at least one othermechanism must be involved. Interestingly, the LDV-inducedsuppression was transient and waned by 1 week postinfection.In contrast, the FV-induced Treg cell response did not becomeapparent until the 1-week time point, which is consistent withprevious in vivo studies using an FV stock containing LDV(66). Thus, both LDV and FV induced Treg cells but withdifferent kinetics.
The current experiments with mice chronically infected withLDV also addressed the possible roles of acute IFN-� re-sponses and polyclonal lymphocyte activation in suppressingFV-specific CD8� T-cell responses. Since LDV chronic micelacked those acute responses and were still suppressed, it isunlikely that either IFN-� responses or polyclonal lymphocyteactivation was responsible for suppression. In further supportof this conclusion, we recently found that mice depleted ofplasmacytoid dendritic cells prior to FV/LDV coinfection,which ablated their ability to mount IFN-� responses or theconsequent polyclonal lymphocyte activation (5 and data notshown), also had no FV-specific CD8� T-cell responses at 7days postinfection.
Assuming that the suppressions of FV-specific CD8� T-cellresponses during acute and chronic infection are related, themechanism by which LDV inhibits FV-specific T-cell responsesmust be due to a long-term effect of LDV on the host. Inaddition to sustained production of LDV peptides that couldaffect the presentation of FV antigens, another long-term ef-fect is the lytic depletion of the subset of macrophages thatscavenge lactate dehydrogenase (54). It has previously beenshown that LDV inhibits antigen presentation by macrophages(30), and it is possible that macrophage loss or dysfunctionplays a direct role in delaying the initiation of FV-specificCD8� T-cell responses. It may also be that the effect is indirectvia dendritic cells (DCs), which are more commonly involvedin priming naı̈ve T cells during viral infections. Although wedid not see a difference in levels of FV-infected DCs at 1 weekpostinfection, it remains possible that there were differences inlevels of processed antigens or infection levels at an earliertime point. A negative effect on CD8� T-cell activation couldinvolve the secretion of anti-inflammatory cytokines such asinterleukin-10 (2, 20) by DCs responding to cytokines or bybreakdown products released from infected or killed macro-phages (41). Alternatively, suppression may occur directly with
the CD8� T cells rather than via APCs. Whatever mechanismis at play must account for apparently intact LDV-specificCD8� T-cell responses as well as FV- and LDV-specific CD4�
T-cell responses. Furthermore, the suppression must be eitherincomplete or transient because the FV-specific response wasonly delayed rather than absent.
Given the evidence for the presence of LDV in FV stocks asfar back as 1963 (56), and possibly from its original isolation in1957 (22), it is likely that most current stocks maintained solelyby mouse passage still contain LDV. At one time, it appearsthat LDV was considered an integral component of the FVcomplex (61) and was also found in stocks of Rauscher leuke-mia virus (55) and murine sarcoma virus (62). LDV is alsocommon in transplantable tumor and cell lines (7, 47). Al-though the presence of LDV can go unnoticed because of thelack of overt clinical signs or pathology, it can generate signif-icant impacts on host immune responses and thereby increasethe degree and duration of pathology induced by a second viralchallenge. Hence, some of the effects previously attributedsolely to FV may have been influenced by LDV. Experimentsare currently under way to determine whether the presence ofLDV plays a role in our current fields of interest: the estab-lishment of FV persistence, the induction of regulatory T cells,and vaccine-induced protection. It is not feasible to retrospec-tively determine how much of the work described in the pub-lished literature on FV also contained LDV because the liter-ature is too vast, and very few of the authors are still activelyinvolved in FV research. However, all studies published hence-forth should designate whether or not the experimental FVstocks contain LDV.
Although most of our current understanding of virus-hostinteractions has come from models of infection with single viralpathogens, there is growing interest in studying the pathogen-esis and immune responses elicited by multiple infections.Studies of mixed or sequential infections have shown that theimmune response to a particular pathogen can be greatly in-fluenced by the presence of other pathogens (reviewed in ref-erence 64). In nature, multiple acute and chronic infections arefrequently observed. Just one example in humans is coinfectionwith HIV type 1 (HIV-1) and hepatitis C virus (HCV), whichis becoming epidemic and is of significant clinical importance(1, 35). Compared to HIV-specific CD8� T-cell responses,those of HCV-specific responses are profoundly impaired incoinfections with HIV (35) and of less breadth than those inHCV monoinfections (19). Thus, the use of characterized an-imal models of coinfection may provide insights into this im-portant aspect of infectious diseases. In this light, it will beinteresting to further characterize the ways in which LDVcoinfection influences various aspects of anti-FV immunity.
ACKNOWLEDGMENTS
This research was funded by the Division of Intramural Research,National Institute of Allergy and Infectious Diseases, National Insti-tutes of Health, and by grants from the Deutsche Forschungsgemein-schaft to U.D. and N.G. (GK-1045/1 and Di714/8-1).
We thank Sandra Ruscetti for locating historical information on thepresence of LDV in murine leukemia virus stocks, Peter G. W. Plage-mann for very helpful advice regarding LDV, Marcia Blackman forhelping to identify LDV, and Bruce Chesebro for advice and criticalreview of the manuscript. We also thank Phil Greenberg and ClaesOhlen for providing us with TCR transgenic mice, the NIH tetramer
416 ROBERTSON ET AL. J. VIROL.
facility for MHC-I tetramers, Ton N. M. Schumacher and Koen Schep-ers for the MHC-II tetramers, and Anita Mora for graphics.
REFERENCES
1. Bonacini, M., and M. Puoti. 2000. Hepatitis C in patients with humanimmunodeficiency virus infection: diagnosis, natural history, meta-analysis ofsexual and vertical transmission, and therapeutic issues. Arch. Intern. Med.160:3365–3373.
2. Brooks, D. G., M. J. Trifilo, K. H. Edelmann, L. Teyton, D. B. McGavern,and M. B. Oldstone. 2006. Interleukin-10 determines viral clearance orpersistence in vivo. Nat. Med. 12:1301–1309.
3. Burton, D. R., R. C. Desrosiers, R. W. Doms, W. C. Koff, P. D. Kwong, J. P.Moore, G. J. Nabel, J. Sodroski, I. A. Wilson, and R. T. Wyatt. 2004. HIVvaccine design and the neutralizing antibody problem. Nat. Immunol. 5:233–236.
4. Cafruny, W. A., and P. G. Plagemann. 1982. Immune response to lactatedehydrogenase-elevating virus: isolation of infectious virus-immunoglobulinG complexes and quantitation of specific antiviral immunoglobulin G re-sponse in wild-type and nude mice. Infect. Immun. 37:1001–1006.
5. Cervantes-Barragan, L., R. Zust, F. Weber, M. Spiegel, K. S. Lang, S. Akira,V. Thiel, and B. Ludewig. 2007. Control of coronavirus infection throughplasmacytoid dendritic-cell-derived type I interferon. Blood 109:1131–1137.
6. Chen, W., H. Qin, B. Chesebro, and M. A. Cheever. 1996. Identification of agag-encoded cytotoxic T-lymphocyte epitope from FBL-3 leukemia shared byFriend, Moloney, and Rauscher murine leukemia virus-induced tumors.J. Virol. 70:7773–7782.
7. Chen, Z., and P. G. Plagemann. 1997. Detection of lactate dehydrogenase-elevating virus in transplantable mouse tumors by biological assay and RT-PCR assays and its removal from the tumor cell. J. Virol. Methods 65:227–236.
8. Chesebro, B., M. Miyazawa, and W. J. Britt. 1990. Host genetic control ofspontaneous and induced immunity to Friend murine retrovirus infection.Annu. Rev. Immunol. 8:477–499.
9. Chesebro, B., and K. Wehrly. 1979. Identification of a non-H-2 gene (Rfv-3)influencing recovery from viremia and leukemia induced by Friend viruscomplex. Proc. Natl. Acad. Sci. USA 76:425–429.
10. Chesebro, B., K. Wehrly, M. Cloyd, W. Britt, J. Portis, J. Collins, and J.Nishio. 1981. Characterization of mouse monoclonal antibodies specific forFriend murine leukemia virus-induced erythroleukemia cells: friend-specificand FMR-specific antigens. Virology 112:131–144.
11. Cobbold, S. P., and H. Waldmann. 1984. Therapeutic potential of monova-lent monoclonal antibodies. Nature 308:460–462.
12. Coutelier, J. P., P. G. Coulie, P. Wauters, H. Heremans, and J. T. van derLogt. 1990. In vivo polyclonal B-lymphocyte activation elicited by murineviruses. J. Virol. 64:5383–5388.
13. Coutelier, J. P., and J. Van Snick. 1985. Isotypically restricted activation ofB lymphocytes by lactic dehydrogenase virus. Eur. J. Immunol. 15:250–255.
14. Dai, H. Y., A. Faxvaag, G. I. Troseth, H. Aarset, and A. Dalen. 1994. Mo-lecular cloning and characterization of an immunosuppressive and weaklyoncogenic variant of Friend murine leukemia virus, FIS-2. J. Virol. 68:6976–6984.
15. Dittmer, U., H. He, R. J. Messer, S. Schimmer, A. R. Olbrich, C. Ohlen, P. D.Greenberg, I. M. Stromnes, M. Iwashiro, S. Sakaguchi, L. H. Evans, K. E.Peterson, G. Yang, and K. J. Hasenkrug. 2004. Functional impairment ofCD8(�) T cells by regulatory T cells during persistent retroviral infection.Immunity 20:293–303.
16. Dittmer, U., R. Messer, B. Race, I. M. Stromnes, and K. J. Hasenkrug. 2002.Essential roles for CD8� T-cells and interferon gamma in protection of miceagainst retrovirus-induced immunosuppression. J. Virol. 76:450–454.
17. Drosten, C., S. Gunther, W. Preiser, S. van der Werf, H. R. Brodt, S. Becker,H. Rabenau, M. Panning, L. Kolesnikova, R. A. Fouchier, A. Berger, A. M.Burguiere, J. Cinatl, M. Eickmann, N. Escriou, K. Grywna, S. Kramme, J. C.Manuguerra, S. Muller, V. Rickerts, M. Sturmer, S. Vieth, H. D. Klenk, A. D.Osterhaus, H. Schmitz, and H. W. Doerr. 2003. Identification of a novelcoronavirus in patients with severe acute respiratory syndrome. N. Engl.J. Med. 348:1967–1976.
18. Dubuy, H., S. Baron, C. Uhlendorf, and M. L. Johnson. 1973. Role ofinterferon in murine lactic dehydrogenase virus infection, in vivo and in vitro.Infect. Immun. 8:977–984.
19. Dutoit, V., D. Ciuffreda, D. Comte, J. J. Gonvers, and G. Pantaleo. 2005.Differences in HCV-specific T cell responses between chronic HCV infectionand HIV/HCV co-infection. Eur. J. Immunol. 35:3493–3504.
20. Ejrnaes, M., C. M. Filippi, M. M. Martinic, E. M. Ling, L. M. Togher, S.Crotty, and M. G. von Herrath. 2006. Resolution of a chronic viral infectionafter interleukin-10 receptor blockade. J. Exp. Med. 203:2461–2472.
21. Even, C., R. R. Rowland, and P. G. Plagemann. 1995. Cytotoxic T cells areelicited during acute infection of mice with lactate dehydrogenase-elevatingvirus but disappear during the chronic phase of infection. J. Virol. 69:5666–5676.
22. Friend, C. 1957. Cell-free transmission in adult Swiss mice of a diseasehaving the character of a leukemia. J. Exp. Med. 105:307–318.
23. Galvan, M., K. Murali-Krishna, L. L. Ming, L. Baum, and R. Ahmed. 1998.
Alterations in cell surface carbohydrates on T cells from virally infected micecan distinguish effector/memory CD8� T cells from naive cells. J. Immunol.161:641–648.
24. Harty, J. T., and P. G. Plagemann. 1988. Formalin inactivation of the lactatedehydrogenase-elevating virus reveals a major neutralizing epitope not rec-ognized during natural infection. J. Virol. 62:3210–3216.
25. Hasenkrug, K. J., D. M. Brooks, and B. Chesebro. 1995. Passive immuno-therapy for retroviral disease: influence of major histocompatibility complextype and T-cell responsiveness. Proc. Natl. Acad. Sci. USA 92:10492–10495.
26. Hasenkrug, K. J., D. M. Brooks, and U. Dittmer. 1998. Critical role forCD4� T cells in controlling retrovirus replication and spread in persistentlyinfected mice. J. Virol. 72:6559–6564.
27. He, H., R. J. Messer, S. Sakaguchi, G. Yang, S. J. Robertson, and K. J.Hasenkrug. 2004. Reduction of retrovirus-induced immunosuppression by invivo modulation of T cells during acute infection. J. Virol. 78:11641–11647.
28. Howard, R. J., A. L. Notkins, and S. E. Mergenhagen. 1969. Inhibition ofcellular immune reactions in mice infected with lactic dehydrogenase virus.Nature 221:873–874.
29. Inada, T., and C. A. Mims. 1986. Live lactate dehydrogenase-elevating virus(LDV) induces suppressor T cells that inhibit the development of delayedhypersensitivity to LDV. J. Gen. Virol. 67:2103–2112.
30. Isakov, N., M. Feldman, and S. Segal. 1982. Acute infection of mice withlactic dehydrogenase virus (LDV) impairs the antigen-presenting capacity oftheir macrophages. Cell. Immunol. 66:317–332.
31. Kabat, D. 1989. Molecular biology of Friend viral erythroleukemia. Curr.Top. Microbiol. Immunol. 148:1–42.
32. Kaminchik, J., W. D. Hankins, S. K. Ruscetti, D. L. Linemeyer, and E. M.Scolnick. 1982. Molecular cloning of biologically active proviral DNA of theanemia-inducing strain of spleen focus-forming virus. J. Virol. 44:922–931.
33. Kohm, A. P., J. S. McMahon, J. R. Podojil, W. S. Begolka, M. Degutes, D. J.Kasprowicz, S. F. Ziegler, and S. D. Miller. 2006. Cutting edge: anti-CD25monoclonal antibody injection results in the functional inactivation, notdepletion, of CD4� CD25� T regulatory cells. J. Immunol. 176:3301–3305.
34. Ksiazek, T. G., D. Erdman, C. S. Goldsmith, S. R. Zaki, T. Peret, S. Emery,S. Tong, C. Urbani, J. A. Comer, W. Lim, P. E. Rollin, S. F. Dowell, A. E.Ling, C. D. Humphrey, W. J. Shieh, J. Guarner, C. D. Paddock, P. Rota, B.Fields, J. DeRisi, J. Y. Yang, N. Cox, J. M. Hughes, J. W. LeDuc, W. J.Bellini, and L. J. Anderson. 2003. A novel coronavirus associated with severeacute respiratory syndrome. N. Engl. J. Med. 348:1953–1966.
35. Lauer, G. M., T. N. Nguyen, C. L. Day, G. K. Robbins, T. Flynn, K.McGowan, E. S. Rosenberg, M. Lucas, P. Klenerman, R. T. Chung, and B. D.Walker. 2002. Human immunodeficiency virus type 1-hepatitis C virus coin-fection: intraindividual comparison of cellular immune responses against twopersistent viruses. J. Virol. 76:2817–2826.
36. Li, J. P., A. D. D’Andrea, H. F. Lodish, and D. Baltimore. 1990. Activationof cell growth by binding of Friend spleen focus-forming virus gp55 glyco-protein to the erythropoietin receptor. Nature 343:762–764.
37. Li, X., B. Hu, J. Harty, C. Even, and P. G. Plagemann. 1990. Polyclonal B cellactivation of IgG2a and IgG2b production by infection of mice with lactatedehydrogenase-elevating virus is partly dependent on CD4� lymphocytes.Viral Immunol. 3:273–288.
38. Lilly, F., and R. A. Steeves. 1973. B-tropic Friend virus: a host-rangepseudotype of spleen focus-forming virus (SFFV). Virology 55:363–370.
39. Linemeyer, D. L., S. K. Ruscetti, J. G. Menke, and E. M. Scolnick. 1980.Recovery of biologically active spleen focus-forming virus from molecularlycloned spleen focus-forming virus-pBR322 circular DNA by cotransfectionwith infectious type C retroviral DNA. J. Virol. 35:710–721.
40. Linemeyer, D. L., S. K. Ruscetti, E. M. Scolnick, L. H. Evans, and P. H.Duesberg. 1981. Biological activity of the spleen focus-forming virus is en-coded by a molecularly cloned subgenomic fragment of spleen focus-formingvirus DNA. Proc. Natl. Acad. Sci. USA 78:1401–1405.
41. Lovgren, T., M. L. Eloranta, U. Bave, G. V. Alm, and L. Ronnblom. 2004.Induction of interferon-alpha production in plasmacytoid dendritic cells byimmune complexes containing nucleic acid released by necrotic or lateapoptotic cells and lupus IgG. Arthritis Rheum. 50:1861–1872.
42. Markine-Goriaynoff, D., X. Hulhoven, C. L. Cambiaso, P. Monteyne, T.Briet, M. D. Gonzalez, P. Coulie, and J. P. Coutelier. 2002. Natural killer cellactivation after infection with lactate dehydrogenase-elevating virus. J. Gen.Virol. 83:2709–2716.
43. McNeill, A., E. Spittle, and B. T. Backstrom. 2007. Partial depletion of CD69low-expressing natural regulatory T cells with the anti-CD25 monoclonalantibody PC61. Scand. J. Immunol. 65:63–69.
44. Moreau-Gachelin, F., A. Tavitian, and P. Tambourin. 1988. Spi-1 is a puta-tive oncogene in virally induced murine erythroleukaemias. Nature 331:277–280.
45. Morrison, R. P., P. L. Earl, J. Nishio, D. L. Lodmell, B. Moss, and B.Chesebro. 1987. Different H-2 subregions influence immunization againstretrovirus and immunosuppression. Nature 329:729–732.
46. Munroe, D. G., J. W. Peacock, and S. Benchimol. 1990. Inactivation of thecellular p53 gene is a common feature of Friend virus-induced erythroleu-kemia: relationship of inactivation to dominant transforming alleles. Mol.Cell. Biol. 10:3307–3313.
VOL. 82, 2008 LDV SUPPRESSION OF ANTI-FV IMMUNITY 417
47. Nakai, N., C. Kawaguchi, K. Nawa, S. Kobayashi, Y. Katsuta, and M.Watanabe. 2000. Detection and elimination of contaminating microorgan-isms in transplantable tumors and cell lines. Exp. Anim. 49:309–313.
48. Ohlen, C., M. Kalos, L. E. Cheng, A. C. Shur, D. J. Hong, B. D. Carson, N. C.Kokot, C. G. Lerner, B. D. Sather, E. S. Huseby, and P. D. Greenberg. 2002.CD8� T cell tolerance to a tumor-associated antigen is maintained at thelevel of expansion rather than effector function. J. Exp. Med. 195:1407–1418.
49. Olbrich, A. R., S. Schimmer, and U. Dittmer. 2003. Preinfection treatment ofresistant mice with CpG oligodeoxynucleotides renders them susceptible toFriend retrovirus-induced leukemia. J. Virol. 77:10658–10662.
50. Oldstone, M. B., and G. F. Rall. 1993. Mechanism and consequence of viralpersistence in cells of the immune system and neurons. Intervirology 35:116–121.
51. Onyekaba, C. O., J. T. Harty, C. Even, B. G. Hu, and P. G. Plagemann. 1989.Persistent infection of mice by lactate dehydrogenase-elevating virus: effectsof immunosuppression on virus replication and antiviral immune responses.Virus Res. 14:297–315.
52. Peiris, J. S., S. T. Lai, L. L. Poon, Y. Guan, L. Y. Yam, W. Lim, J. Nicholls,W. K. Yee, W. W. Yan, M. T. Cheung, V. C. Cheng, K. H. Chan, D. N. Tsang,R. W. Yung, T. K. Ng, and K. Y. Yuen. 2003. Coronavirus as a possible causeof severe acute respiratory syndrome. Lancet 361:1319–1325.
53. Plagemann, P. G., and V. Moennig. 1992. Lactate dehydrogenase-elevatingvirus, equine arteritis virus, and simian hemorrhagic fever virus: a new groupof positive-strand RNA viruses. Adv. Virus Res. 41:99–192.
54. Plagemann, P. G., R. R. Rowland, C. Even, and K. S. Faaberg. 1995. Lactatedehydrogenase-elevating virus: an ideal persistent virus? Springer Semin.Immunopathol. 17:167–186.
55. Proffitt, M. R., C. C. Congdon, and R. L. Tyndall. 1972. The combined actionof Rauscher leukemia virus and lactic dehydrogenase virus on mouse lym-phatic tissue. Int. J. Cancer 9:193–211.
56. Riley, V. 1963. Enzymatic determination of transmissible replicating factorsassociated with mouse tumors. Ann. N. Y. Acad. Sci. 100:762–790.
57. Robertson, M. N., M. Miyazawa, S. Mori, B. Caughey, L. H. Evans, S. F.Hayes, and B. Chesebro. 1991. Production of monoclonal antibodies reactive
with a denatured form of the Friend murine leukemia virus gp70 envelopeprotein: use in a focal infectivity assay, immunohistochemical studies, elec-tron microscopy and western blotting. J. Virol. Methods 34:255–271.
58. Robertson, M. N., G. J. Spangrude, K. Hasenkrug, L. Perry, J. Nishio, K.Wehrly, and B. Chesebro. 1992. Role and specificity of T-cell subsets inspontaneous recovery from Friend virus-induced leukemia in mice. J. Virol.66:3271–3277.
59. Robertson, S. J., R. J. Messer, A. B. Carmody, and K. J. Hasenkrug. 2006.In vitro suppression of CD8� T cell function by Friend virus-induced reg-ulatory T cells. J. Immunol. 176:3342–3349.
60. Schepers, K., M. Toebes, G. Sotthewes, F. A. Vyth-Dreese, T. A. Dellemijn,C. J. Melief, F. Ossendorp, and T. N. Schumacher. 2002. Differential kineticsof antigen-specific CD4� and CD8� T cell responses in the regression ofretrovirus-induced sarcomas. J. Immunol. 169:3191–3199.
61. Steeves, R. A., E. A. Mirand, S. Thomson, and L. Avila. 1969. Enhancementof spleen focus formation and virus replication in Friend virus-infected mice.Cancer Res. 29:1111–1116.
62. Turner, W., P. S. Ebert, G. Spahn, R. Bassin, and M. A. Chirigos. 1971.Potentiation of murine sarcoma virus (Harvey) (Moloney) oncogenicity inlactic dehydrogenase-elevating virus-infected mice. Proc. Soc. Exp. Biol.Med. 136:1314–1318.
63. van den Broek, M. F., R. Sporri, C. Even, P. G. Plagemann, E. Hanseler, H.Hengartner, and R. M. Zinkernagel. 1997. Lactate dehydrogenase-elevatingvirus (LDV): lifelong coexistence of virus and LDV-specific immunity. J. Im-munol. 159:1585–1588.
64. Welsh, R. M., and L. K. Selin. 2002. No one is naive: the significance ofheterologous T-cell immunity. Nat. Rev. Immunol. 2:417–426.
65. Williams, M. A., and R. A. Lamb. 1988. Polylactosaminoglycan modificationof a small integral membrane glycoprotein, influenza B virus NB. Mol. Cell.Biol. 8:1186–1196.
66. Zelinskyy, G., A. R. Kraft, S. Schimmer, T. Arndt, and U. Dittmer. 2006.Kinetics of CD8� effector T cell responses and induced CD4� regulatory Tcell responses during Friend retrovirus infection. Eur. J. Immunol. 36:2658–2670.
