TREATMENT EFFICACY AND RESISTANCE MECHANISMS USING THE SECOND-GENERATION ALK INHIBITOR AP26113 IN...

1

TREATMENT EFFICACY AND RESISTANCE MECHANISMS USING THE SECOND-GENERATION ALK

INHIBITOR AP26113 IN HUMAN NPM-ALK-POSITIVE ANAPLASTIC LARGE CELL LYMPHOMA

Ceccon M.*; Mologni L.*; Giudici G.#, Piazza R.*, Pirola A.* Fontana D*, Gambacorti-Passerini C*‡.

* Department of Health Science, University of Milano-Bicocca, Monza, Italy;

# Tettamanti research centre, Pediatric Clinic, University of Milano-Bicocca, Monza, Italy;

‡ Section of Haematology, San Gerardo Hospital, Monza, Italy;

Corresponding author:

Monica Ceccon

Dept of Health Science

University of Milano-Bicocca

Via Cadore 48

20900 Monza, Italy

[email protected]

Conflict of interest:

Professor Gambacorti-Passerini is principal investigator the trial A8081013 sponsored by Pfizer.

on December 1, 2014. © 2014 American Association for Cancer Research. mcr.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on November 24, 2014; DOI: 10.1158/1541-7786.MCR-14-0157

http://mcr.aacrjournals.org/

2

ABSTRACT

ALK is a tyrosine kinase receptor involved in a broad range of solid and hematological tumors. Among

70-80% of ALK+ Anaplastic Large Cell Lymphoma (ALCL) are caused by the aberrant oncogenic fusion

protein NPM-ALK. Crizotinib was the first clinically relevant ALK inhibitor, now approved for the

treatment of late stage and metastatic cases of lung cancer. However, patients frequently develop drug

resistance to Crizotinib, mainly due to the appearance of point mutations located in the ALK kinase

domain. Fortunately, other inhibitors are available and in clinical trial, suggesting the potential for

second line therapies to overcome Crizotinib resistance. This study focuses on the ongoing Phase I/II

trial small-molecule tyrosine kinase inhibitor (TKI) AP26113, by Ariad Pharmaceuticals, which targets

both ALK and EGFR. Two NPM-ALK+ human cell lines, KARPAS-299 and SUP-M2, were grown in the

presence of increasing concentrations of AP26113 and eight lines were selected that demonstrated

resistance. All lines show inhibitory concentration (IC50) values higher (130 to 1000-fold) than the

parental line. Mechanistically, KARPAS-299 populations resistant to AP26113 show NPM-ALK

overexpression, while SUP-M2 resistant cells harbor several point mutations spanning the entire ALK

kinase domain. In particular, amino acid substitutions: L1196M, S1206C, the double F1174V+L1198F and

L1122V+L1196M mutations were identified. The knowledge of the possible appearance of new clinically

relevant mechanisms of drug resistance is a useful tool for the management of new TKI resistant cases.

Implications: This work defines reliable anaplastic large cell lymphoma model systems of AP26113

resistance and provides a valuable tool in the management of all cases of relapse upon NPM-ALK

targeted therapy.

Keywords: AP26113, Tyrosin Kinase Inhibitors, Anaplastic Lymphoma Kinase (ALK), Anaplastic Large Cell

Lymphoma (ALCL).




3

INTRODUCTION

The pharmacological inhibition of the ALK (Anaplastic Lymphoma Kinase) tyrosine kinase has become in

the last years an issue of great interest, given its involvement in different malignancies and the recent

development of several ALK inhibitors. ALK oncogenic role was recognized for the first time in the mid-

nineties,(1), when the NPM-ALK fusion protein was identified as the main cause of a particular subset of

Anaplastic Large Cell Lymphoma (ALCL). After that, other oncogenic fusion proteins involving the

functional ALK kinase domain have been described in different kinds of both solid and haematological

tumors, such as 50% of Inflammatory Myofibroblastic Tumors (IMT)(2), about 5% of cases of Non Small

Cell Lung Cancer (NSCLC)(3), and at low frequency in other types of tumor, such as Rhabdomyosarcoma

(RMS)(4), Extramedullary Plasmacytoma(5), Renal Cell Carcinoma(6), Thyroid Cancer(7), Basal Cell

Carcinoma(8), Breast Cancer and Colorectal Cancer(9, 10). Moreover, aberrant activation or

overexpression of full-length ALK has an oncogenic role in neuroblastoma(11, 12) and glioblastoma

multiforme (13, 14). The oncogenic properties of aberrantly activated ALK are mainly due to the

deregulated activation of different downstream pathways such as RAS/RAF/MEK/ERK1/2 and PCLγ,

involved in cellular proliferation, and PI3K/AKT and JAK3/STAT3, that promote cell survival (15-17). The

first clinically available drug able to efficiently target ALK was the dual ALK and MET inhibitor Crizotinib,

now approved for the treatment of late stage and metastatic ALK+ NSCLC and in clinical trial for other

ALK-related diseases. The latest clinical data about ALK+ NSCLC patients treated with Crizotinib reveal an

increase of median progression free survival (PFS) and response rate compared to chemotherapy. No

significant advantage in overall survival (OS) was observed, however Crizotinib treated patients had a

better quality of life(18). Very limited data are available on ALCL patients (19). The first long term follow

up of ALCL patients who received Crizotinib reported, after two years, a PFS of 63.7% and an OS of

72.7% and the drug was in general well tolerated(20). However, despite great success, as expected from

previous experience with tyrosine kinase inhibitors (21, 22), the first cases of relapse due to the positive




4

selection of mutant clones have already been detected in several Crizotinib-treated NSCLC and ALCL

patients (20, 23-26). In order to effectively overcome Crizotinib resistance, the development of second

generation ALK inhibitors is exponentially growing (27). Currently, several ALK inhibitors are already in

clinical trial: the phase I/II AP26113 (Ariad), the phase II/III LDK-378 (Novartis), the phase I/II CH5424802

(Roche) and the phase I ASP3026 (Astellas). In this work, we decided to focus our attention on the dual

ALK/EGFR inhibitor AP26113 because, after Crizotinib, it was the first inhibitor entered in clinical trials.

Preclinical data showed that this inhibitor is 10 fold more potent than Crizotinib and active against the

gatekeeper mutant L1196M. In xenograft mouse model lower AP26113 doses compared to Crizotinib

lead to complete tumor disappearance (28). Unfortunately, the chemical structure remains undisclosed.

In this paper we selected 8 new human NPM-ALK+ cell lines, 4 derived from KARPAS-299 and 4 from

SUP-M2, able to live and proliferate at high AP26113 doses (K299AR300A, K299AR300B, K299AR300C,

K299AR300D, SUP-M2AR500A, SUP-M2AR500B, SUP-M2AR500C, SUP-M2AR500D). For KARPAS-299-

derived cell lines we observed oncogene overexpression as the main resistance mechanism, while in

SUP-M2-derived cell lines we identified several point mutations located within the NPM-ALK kinase

domain, that could explain drug resistance. We also found a L1196M mutation in two out of four SUP-

M2-derived cell lines, but it had no role in conferring resistance at high drug doses. In order to find a

way to overcome AP26113 resistance we explored the cross-resistance of our KARPAS-299 derived cell

lines and mutated Ba/F3 NPM-ALK against other clinically relevant ALK inhibitors nowadays available,

namely Crizotinib, LDK-378, CH5424802, ASP3026. KARPAS-299 derived cell lines are highly resistant to

all inhibitors tested, while all mutants studied were targetable with at least a compound, except S1206C.

Collectively, our data predict in a human cell-based model the appearance of different mechanisms of

resistance to AP26113 , and we explored different ways to overcome resistance using a set of clinically

relevant ALK inhibitors. This kind of knowledge is a powerful tool to manage clinical cases of Crizotinib

and AP26113 relapse.




5

MATERIALS AND METHODS

Cell lines, inhibitors and selection of AP26113 resistant cell lines

The human NPM-ALK+ KARPAS-299 and SUP-M2 cell lines bearing the t(2;5) translocation and the pro-B

murine cell line Ba/F3 were purchased from DSMZ, where they are routinely verified using genotypic

and phenotypic testing to confirm their identity�� Cell lines were subcultured as previously described

(29). AP26113 was kindly provided by Ariad Pharmaceutical and added to the medium initially at 20

nmol/L. Medium was replaced with fresh RPMI-1640 supplemented with AP26113 every 48 or 72 hours,

and cell number and viability were assessed by Trypan Blue count. Ba/F3 cells were maintained in RPMI

medium supplemented with 10% foetal bovine serum and CHO cells supernatant (1:2000) as a source of

IL-3. Ba/F3 cells were transduced with mutagenized pcDNA3.0-NPM/ALK plasmid (see below) by

electroporation, as previously described(29) and selected first with G418 (Euroclone) 2mg/mL, followed

by IL-3 withdrawal. Crizotinib was kindly provided by Pfizer, LDK-378 by Novartis, ASP3026 by Astellas

while CH5424802 was purchased from Selleck Chemicals.

Site-directed mutagenesis

pcDNA3.0 bearing human WT NPM-ALK (pcDNA3.0 NA) was kindly provided by Dr. S. W. Morris (St Jude

Research Hospital, Memphis, TN). Site-directed mutagenesis on pcDNA3-NA was performed using

QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene), according to manufacturer instructions.

Primers used for mutagenesis were: NPM-ALK L1122V FW: 5’ –

ATCACCCTCATTCGGGGTGTGGGCCATGGCGC–3’; NPM-ALK S1206C FW: 3’–

GAGACCTCAAGTGCTTCCTCCGAGAGACCCGCC – 5’; NPM-ALK L1196M 5’-FW:

CTGCCCCGGTTCATCCTGATGGAGCTCATGGCG-3’ NPM-ALK F1174V FW: 3’-

GAAGCCCTGATCATCAGCAAAGTCAACCACCAGAACATTG -5’ NPM-ALK L1198F FW: 3’-




6

GTTCATCCTGCTGGAGTTCATGGCGGGGGGAGAC -5’ . Reverse primers are reverse complements of fw

primers. Sequence numbering is related to GenBank ID NM004304.

Fluorescence In Situ Hybridization (FISH)

Interphase FISH was performed using ALK Dual Color Break Apart Rearrangement Probe(Cytocell). This

probe consists of a green 420Kb probe, which span the majority of the ALK gene and a red 486 Kb probe,

which is telomeric to the ALK gene. Slides were prepared following standards cytogenetics procedures.

Codenaturation/hybridization of the specimen slides and probes were performed at 72°C for 2 min and

at 37 °C overnight, followed by washing in SSC solutions and counter-staining with anti-fade solution

containing DAPI

PCR , quantitative RT-PCR and sequencing

An NPM-ALK fragment encompassing the breakpoint and comprising the whole kinase domain was

amplified by PCR using high fidelity Taq polymerase (Roche), according to instructions. Primers used

were FW: 5’- TGCATATTAGTGGACAGCAC – 3’; REV:5’-CTGTAAACCAGGAGCCGTAC -3’. PCR products were

sent to Eurofins MWG Operon for sequencing. Quantitative real time PCR (qPCR) was performed as

previously described (29). Housekeeping genes used for normalization were murine HPRT FW: 5’ –

TCAGTCAACGGGGGACATAAA -3’ REV: 5’ - GGGGCTGTACTGCTTAACCAG – 3’ or human GAPDH FW: 5’ -

TGCACCACCACCTGCTTAGC - 3’ REV: 5’ – GGCATGGACTGTGGTCATGAG – 3’. Deep sequencing was

performed as previously described (20)

Exome sequencing




7

Exome libraries were generated from 1 �g of genomic DNA extracted with PureLink Genomic DNA kit

(Life Technology). Genomic DNA was fragmented to a size of 200-500 bp and processed according to the

standard protocol for the Illumina TruSeq DNA Sample Preparation kit. Genomic libraries were then

enriched with the Illumina TruSeq Exome Enrichment kit. Libraries were sequenced on an Illumina

Genome Analyzer IIx with 76-bp paired-end reads using Illumina TruSeq SBS kit v5.

Bioinformatics

Image processing and base calling were performed using the Illumina Real Time Analysis Software RTA

v1.9.35 or newer. Qseq files were deindexed and converted to the Sanger FastQ file format using in-

house scripts. FastQ sequences were aligned to the human genome database (NCBI Build 36/hg18) using

the Burrows-Wheeler–based BWA alignment tool. The alignment files (SAM format) were processed

with SAMtools (30): they were initially filtered by proper-pair, then converted into the binary BAM

alignment format, sorted and indexed. Removal of duplicates was performed using the SAMtools rmdup

command. Unique BAM files were then converted into the mPileup format. mPileup data generated

from paired cancer and control samples were cross-matched using a dedicated in-house software tool.

Copy number and allelic imbalance/loss of heterozigosity analyses from whole-exome data were

performed using CEQer (31).

Western blotting and antibodies

Cells were seeded in complete medium in 12-well plate and compounds were added at different

concentrations. After 4 hours, cells were harvested, washed once in PBS at 4°C, and resuspended in

Laemmli buffer 1x supplemented with 10% �-mercaptoethanol (100�l/106 cells) and denatured at 97°C

for 20 minutes before electrophoresis. Equal volumes were loaded on 10% SDS-PAGE, transferred to

nitrocellulose membrane Hybond ECL (Amersham), and incubated overnight at 4°C with primary




8

antibody (1:1000 dilution in BSA 2.5%). Secondary horseradish peroxidase–conjugated anti-mouse or

anti-rabbit antibodies (Amersham) were incubated for 1 to 2 hours and then visualized by

chemiluminescence as recommended by the manufacturer. Monoclonal anti-phospho-ALK (Y-1604),

monoclonal anti-ALK (31F12) and monoclonal anti-phospho-STAT3 (Tyr 705) antibodies were from Cell

Signaling Technology. Anti-ACTIN antibody was purchased from Sigma; polyclonal anti-STAT3 is from

Calbiochem.

Proliferation assay

5000 cells per well were seeded in 96-well plates in the presence of serial dilutions (1:2 or 1:3) of each

compound, starting from a concentration of 10 �M or 1 �M, based on drug potency and specific cell line

sensitivity. Incubation with radioactive labelled thymidine and radioactivity detection was performed as

previously described (29)

Software and statistical analysis

Dose–response curves were analyzed using GraphPad Prism 5 software. IC50 indicates the concentration

of inhibitor that gives half-maximal inhibition. Densitometry values are (ALK treated/ALK untreated)

divided by (ACTIN treated/ACTIN untreated) or (P-ALK treated/P-ALK untreated) divided by (ALK

treated/ALK untreated). Relative Resistance (RR) index was calculated as the ratio between mutant and

WT IC50 values (32) qPCR data were analyzed using the ΔΔCt method, normalized on the proper

housekeeping gene. ALK kinase domain was drawn using PDB viewer software (PDB code:3LCS).




9

RESULTS

Establishment and characterization of human AP26113-resistant cell lines.

To obtain a reliable resistance model we grew two different human NPM-ALK positive cell lines, KARPAS-

299 and SUP-M2, in the presence of increasing AP26113 doses (29). We divided each cell line into four

different flasks, assuming that a stochastic selection would occur in each independent population. Cell

selection was started at a drug concentration close to the IC90 value, calculated with a preliminary

proliferation assay as 13nM for KARPAS-299 and 19.4nM for SUP-M2. Each cell line was challenged with

five or six sequential drug doses (fig.suppl.1). An independent cell line was established before each step

increase of drug concentration. This process was stopped at 300nM AP26113 for KARPAS-299 and

500nM for SUP-M2 cells, based on the comparison between IC50 values for resistant and parental cells.

In our experience, for a highly drug-resistant population, an IC50 increase of at least 10 fold compared to

parental cells was expected. In fact, all AP26113-resistant cell lines showed a Relative Resistance Index

(RR) higher than 100 (Tab1). Among all cell lines established we decided to focus our attention on the

highest AP26113 dose resistant populations, referred to as K299AR300A, K299AR300B, K299AR300C,

K299AR300D (AP26113-Resistant at 300nM) and SUP-M2AR500A, SUP-M2AR500B, SUP-M2AR500C,

SUP-M2AR500D (AP26113-Resistant at 500nM). For each cell line NPM-ALK expression and activation

were assessed by western blot (Fig.1, fig. suppl. 7A) using specific antibodies for total ALK and

phosphorylated ALK (Tyr 1604). While in parental cells 100nM AP26113 completely abrogates ALK

activation, in all resistant populations Tyr 1604 phosphorylation is still detectable at 100 or even 300

nM, indicating that drug resistance is due to a mechanism that directly impairs ALK inactivation.




10

Identification of Resistance mechanism

Western Blot analysis revealed an increase in NPM-ALK expression, quantified by densitometry as

9.4±2.1, 6.0±1.3, 7.1±1.8 and 6.5±0.5 fold compared to parental cells for K299AR300A, K299AR300B,

K299AR300C and K299AR300D cells, respectively (fig. suppl.2). Notably, in the first three cell lines (A, B

and C) the basal phospho-ALK signal was higher than in parental cells (Fig.1A). This hyper-activation

could be simply due to the increased NPM-ALK expression rather than to an intrinsic NPM-ALK hyper-

activation, as highlighted in fig suppl.2. To further confirm that in AP26113 resistant cell lines NPM-ALK

targeting was ineffective, the phosphorylation status in Tyr705 of the NPM-ALK downstream effector

STAT-3 was also assessed. In all AP26113 resistant KARPAS-derived cell lines STAT-3 P-Tyr705 was

present at higher drug doses than the one observed for parental cells and correlated with the persistent

NPM-ALK phosphorylation (Fig1A). Quantitative RT-PCR confirmed that oncogene overexpression was

present also at transcriptional level, since a 23.7, 16, 25.5 and 5.1 fold increase of NPM-ALK transcript

was detected in K299AR300A, B, C and D, respectively compared to parental. (Fig.2A, tab.2). Values are

obtained upon normalization on the proper housekeeping gene. Of note, protein and mRNA levels

correlated. Moreover, a FISH experiment revealed that the increase in NPM-ALK overexpression is due

to gene amplification (Fig.2B). Since the IC50 value observed for all resistant cell lines is extremely high,

we explored the presence of low frequency point mutations in ALK kinase domain as an additional

resistance mechanism by deep sequencing. The results excluded this hypothesis (data not shown). NPM-

ALK overexpression in K299AR300D was less evident than in the other cell lines. Moreover, the band

corresponding to P-Tyr1604 ALK disappears at 300nM, suggesting low molecular resistance to AP26113,

despite the fact that STAT-3 phosphorylation remains also at high drug doses and the cells RR index was

180. Whole exome sequencing and copy number analysis of this cell line highlighted that the increase in

ALK expression was due to NPM-ALK amplification. In addition, some huge copy number alterations




11

were present. Also missense mutations were detected but none of them involved proteins clearly

related to tumorigenesis or drug resistance (fig. suppl.3).

Also in SUP-M2 derived resistant cells we could observe a great increase in IC50 value compared to SUP-

M2 parental cell line, and, as expected, this corresponded to a persistent P-Tyr1604 ALK signal (Fig.1, fig.

suppl.7A). No increase in total ALK or in basal ALK phosphorylation was evident in SUP-M2 derived cell

lines (tab.2, fig.1B, fig 2A). We speculated that SUP-M2 resistance could be due to the positive selection

of point mutations in the NPM-ALK kinase domain, so a fragment comprising the whole kinase domain

from total RNA was amplified after retrotranscription and analyzed by direct sequencing. In all resistant

SUP-M2 derived cell lines we found at least one point mutation as a possible resistance mechanism

(table3, fig.2C). Moreover, STAT-3 was still phosphorylated at the highest AP26113 dose (Fig.1B),

confirming an aberrant upregulation of NPM-ALK driven signalling. To confirm the role of these point

mutations in resistance to AP26113, all of them were introduced into the pro-B murine Ba/F3 cell line

expressing human NPM-ALK model (fig. suppl 4). The AP26113 IC50 value was also calculated for the

Ba/F3 cell line together with the assessment of NPM-ALK P-Tyr1604 and STAT3 P-Tyr 705

phosphorylation status in the presence of increasing drug doses (Tab 4A, 4B, fig.3, fig. suppl.7B). All

mutants, except L1196M, showed intermediate to high resistance to AP26113, paralleled by persistent

NPM-ALK phosphorylation. These data confirmed an effective role for these mutations in AP26113

resistance, except for the gatekeeper substitution L1196M. Clonal sequencing of SUP-M2AR500A

showed the simultaneous presence of two mutations: F1174V and L1198F (tab.5A), while in SUP-

M2AR500B cell line revealed the simultaneous presence of L1196M and at least another substitution,

mainly L1122V, found in 80% of clones analyzed, but also D1203N (6.7%) (tab.5). Notably, F1174V alone

was unable to confer AP26113 resistant, while the double mutant F1174V+L1198F was highly resistant

to the same compound. Similarly L1122V alone was sufficient to induce AP26113 resistance (tab.4), thus

supporting the idea that this was the effective driver mutation, as well as the L1198F for the previous




12

double mutant. Moreover we could not select, after two experiments, a Ba/F3 cell line expressing the

single NPM-ALK D1203N able to survive in the absence of interleukin 3. Moreover, the double

L1196M+D1203N mutant is highly AP26113 resistant, so it is possible that both mutations are required

for an advantageous selection and drug resistance. We detected also the presence of the P1139S

mutation in one clone out of 15, but it is not able to confer high AP26113 resistance (IC50=0.015 �M, RR

index=2.14). Interestingly F1174V and L1198F mutations were not able to induce resistance to AP26113

singularly, but their cooperation was necessary.

Cross-resistance to other ALK inhibitors

To explore a possible way to overcome AP26113 resistance we tested the sensitivity of KARPAS-derived

cell lines and mutated NPM-ALK expressing Ba/F3 cells to other clinically relevant ALK inhibitors:

Crizotinib, LDK-378, CH5424802 and ASP3026. As expected, all KARPAS-299 derived cell lines are highly

resistant to all inhibitors, according to the proliferation assay (tab.6). These data are consistent with the

observation that in K299AR300A, B and C cell lines a general mechanism of drug resistance, oncogene

amplification, has been selected.

We also challenged Ba/F3 NPM-ALK WT and mutated cell lines with all the ALK inhibitors (Tab.4A-4B).

Cells carrying the NPM-ALK L1122V mutation are moderately resistant to Crizotinib and resistant to

CH5424802, LDK378 and ASP3026 (RR index is 2.6, 5.3, 9.1 and 4.9 respectively); our data about the

gatekeeper mutant L1196M suggest a moderate resistance to AP26113, Crizotinib and CH5424802 (RR =

2.1, 3.4 and 2.9), confirming our previous data (29), resistance against ASP3026 and sensitivity to LDK-

378. Combination of L1122V with the L1196M substitution increases the resistance values of all drugs,

especially of AP26113, thus giving an impressive advantage upon treatment with all compounds that

directly inhibit the target. Ba/F3 NPM-ALK bearing the S1206C substitution are resistant to crizotinib,




13

CH5424802 and LDK-378 (RR =4.3, 5.7 and 4.1) and highly resistant to ASP3026. The double

F1174V+L1198F mutant is resistant to all drugs except crizotinib, with an RR index of 12.2 and 10 for

AP26113 and LDK-378 and 9.0 and 5.8 for CH5424802 and ASP3026 respectively. Interestingly, the single

F1174V mutation is completely sensitive to all drugs, AP26113 included, but resistant to CH5424802 and

ASP3026, while the single L1198F is per se resistant to all drugs except Crizotinib. Together, these two

mutations cooperate in conferring higher resistance to AP26113. Moreover we explored the cross

resistance of other two mutations found at lower frequencies in SUP-M2AR500B cell line, namely

P1139S and D1203N. While P1139S mutant is sensitive to all drugs except LDK-378 (RR index = 3.5), we

could not establish an IL-3 independent Ba/F3 cell line carrying the single D1203N substitution. On the

other hand the double L1196M + D1203N mutant is highly resistant to AP26113 (RR index=33.2),

confirming that the latter may be the driver mutation for this compound. Cell proliferation data are

confirmed by western blot analysis (fig.suppl 5).

In conclusion, according to these data, we can foresee that for each mutation, alone or in combination,

except S1206C, there is a clinically available ALK inhibitor able to overcome acquired resistance to

AP26113.




14

DISCUSSION

In the last 4 years the management of ALK related diseases has successfully changed, thanks to the

availability of a new ALK inhibitor, Crizotinib. However, as expected, the problem arising from drug

resistance soon became reality, in fact several patients relapsed after Crizotinib treatment, mainly

because of the positive selection of point mutations. So, other different ALK inhibitors were developed

with the purpose of overcoming Crizotinib resistance. The first second generation ALK inhibitor was

AP26113, a dual ALK and EGFR inhibitor by Ariad Pharmaceutical. In this work we took advantage of a

reliable cellular model, based on human NPM-ALK+ cell lines, to predict the possible resistance

mechanism to AP26113. We could establish eight AP26113 resistant cell lines, 4 derived by KARPAS and

4 from SUP-M2 cell lines (fig. suppl1). All cell lines were less sensitive to drug targeting than the parental

one (fig1, tab1, fig.suppl.7A), although for K299AR300D this observation was less evident. KARPAS-

derived cell lines A, B and C clearly showed oncogene amplification as the main cause of resistance

(fig.2A), moreover we could exclude by deep sequencing of the NPM-ALK fragment comprising the

whole ALK kinase domain the presence of point mutations as an additional mechanism. NPM-ALK

overexpression was less evident in K299AR300D cells, both at protein and at transcriptional level, and is

clearly due to NPM-ALK amplification. The presence of copy number alterations spread throughout all

the genome may explain the drug resistance. However, further studies will be necessary to clarify this

issue (fig. suppl.3). For all KARPAS-derived cell lines we could not detect any point mutation in NPM-ALK

kinase domain. On the other hand, in SUP-M2 cell lines we detected the presence of point mutations in

the NPM-ALK kinase domain that could explain AP26113 resistance: L1122V+L1196M, L1196M,

F1174V+L1198F, S1206C. Clonal sequencing of SUP-M2AR500B revealed the presence of other point

mutations at lower frequency, namely P1139S and the double L1196M+D1203N (table 5B). We

introduced in the broadly used murine pro-B cell line Ba/F3 all these mutations, and further confirmed

their effective role in drug resistance. Unfortunately AP26113 structure is not available, so we could not




15

perform any molecular modelling analysis. Residue L1122 is located at the P-loop and extends into the

drug binding pocket (fig. suppl.6). To our knowledge, mutations involving this residue have never been

observed thus far, neither for Crizotinib nor for AP26113 resistance. It is interesting to note that L1122

corresponds to Abl L248, whose substitution with valine or with arginine causes resistance to several

TKIs (33). The gatekeeper L1196M was one of the first causes of Crizotinib resistance found in patients.

A moderate AP26113 resistance was predicted in vitro (29, 34, 35), however the IC50 value is low enough

to consider this mutation sensitive to AP26113. Because in SUP-M2AR500B cells both L1122V and

L1196M were found, we hypothesize that the first is the mutation driving resistance, while the latter

was selected at low doses and never counterselected, remaining as a passenger in the high-dose-

resistant clone. Topo-cloning performed on SUPM2AR500B cell line supported this hypothesis, in fact

both mutations are simultaneously present in 12 out of 15 clones (80%), moreover, where L1122V is not

detected, the D1203N is present (13% of cases), highlighting the weakness of L1196M in conferring

AP26113 resistance (tab. 5B). The fact that we could not establish an IL3 independent Ba/F3 NPM-ALK

D1203N cell line means that this mutation alone is disadvantageous. However the double

L1196M+D1203N mutant was not only able to growth upon IL-3 withdrawal but also showed high

AP26113 resistance, thus highlighting the fact that a cooperation between the two single mutations is

favourable for drug resistance. Curiously, the double mutant is targetable by ASP3026 while the single

L1196M is not, but it is moderately resistant or resistant to all other inhibitors. P1139S alone, unique in

SUP-M2AR300B clone #9, is sensitive to AP26113 (RR index = 1.8), thus we can speculate that, in this

clone, other unknown mechanisms may cooperate in its positive selection. F1174 is located at the end of

the αC helix (fig. suppl.6) and lies in a hydrophobic cluster composed by F1098, F1271 and F1245.

Mutations involving F1174 were recognized as activating in neuroblastoma and phenylalanine

substitution with a leucine was found in an IMT patient that relapsed after Crizotinib treatment (24).

Clones carrying cysteine, valine or isoleucine in residue 1174 instead of phenylalanine were selected at




16

AP26113 100nM and 200nM in a previous Ba/F3 screen (34). In our screening, Ba/F3 cells bearing the

single mutation are completely sensitive to all drugs studied, including AP26113. L1198F alone in our

Ba/F3 cells was sufficient to confer resistance to AP26113, CH5424802, LDK-378 and ASP3026, however

it was completely sensitive to Crizotinib. A methionine substitution in this position was predicted to

confer resistance at AP26113 at 100nM(34), whereas a proline was predicted to confer crizotinib

resistance in an in vitro screening (36). This residue corresponds to the Abl F317, a site that, if mutated,

induces resistance to several TKIs. Notably, in our model L1198F and F1174V cooperate in conferring

resistance against AP26113. Finally, S1206 is located into the αD helix. A tyrosine substitution was found

in a NSCLC patient that relapsed after Crizotinib treatment, while substitutions with an arginine, an

isoleucine or a glycine were predicted in vitro as resistant to AP26113. Notably the S1206R was the only

mutation detected at AP26113 500nM, indicating that this residue has a key role in conferring high

AP26113 resistance (34). All data obtained by 3H thymidine incorporation test were validated by western

blot (fig 1, fig.3), evaluating both NPM-ALK activation by phosphorylation status of its tyrosine 1605 and

its downstream target STAT3 phosphorylation in Tyrosine 705. The pattern of STAT3 phosphorylation

recapitulates the one found for NPM-ALK, moreover in some cases it appears even stronger, likely

because NPM-ALK driven signalling is amplified while transduced. Targeting the molecular chaperon

HSP90 has been proposed as an alternative way to hit NPM-ALK and overcome TKI’s resistance, since

NPM-ALK is a well known HSP90 client. For this reason we tested all our NPM-ALK overexpressing

KARPAS-derived cell lines and Ba/F3 cells bearing all single and double mutations against the HSP90

inhibitor 17-AAG (Table suppl.1). AP26113 resistant KARPAS cells seemed to be more sensitive to 17-

AAG than to other TKIs, whereas all mutations except the S1206C were sensitive to the inhibitor, and

this could be due to the vast heterogeneity of HSP90 clients, since other molecules impaired by HSP90

inhibition may cooperate in cell survival and proliferation. Overall, our cross-resistance experiments

revealed that, except for S1206C, all point mutations detected may be targeted simply switching to




17

another inhibitor, already available in clinic. In the light of these data, we could speculate that most of

the efforts should be directed in finding a new inhibitor, able to target mutations involving the S1206

residue. This knowledge, together with all data nowadays available on Crizotinib resistance, is a useful

tool to manage cases of AP26113 resistance, both for the oncologist and for the drug designer.




18

TABLES

Table1: The table summarizes all IC50 values obtained for AP26113-resistant KARPAS derived cell lines

and SUP-M2 derived cell lines.

cell line IC50

(μmol/L) RR index

K299 0.001 1

K299AR300 A 0.1799 179.9

K299AR300 B 0.2015 201.5

K299AR300 C 0.1324 132.4

K299AR300 D 0.1804 180.4

SUPM2 0.004 1

SUP-M2AR500 A 0.9984 249.6

SUP-M2AR500 B 0.9068 226.7

SUP-M2AR500 C 0.4491 112.275

SUP-M2AR500 D 0.4071 101.775




19

Table 2: The table reports all values obtained for NPM-ALK expression by Q RT-PCR, in terms of absolute

number and fold change compared to parental cells

cell line

mRNA

expression

value

normalization

K299 0.0222 1.0

KAR300A 0.5261 23.7

KAR300B 0.3546 16.0

KAR300C 0.5653 25.5

KAR300D 0.1129 5.1

SUPM2 0.0134 1.0

SUP-M2AR500A 0.0182 1.4

SUP-M2AR500B 0.0314 2.3

SUP-M2AR500C 0.0405 3.0

SUP-M2AR500D 0.0368 2.7




20

Table 3: In the table all mutations reported by direct sequencing are shown.

Cell line Mutation Substitution

SUP-M2AR500A 4472T>G+4544C>T F1174V+L1198F

SUP-M2AR500B 4316C>G+4538C>A L1122V+L1196M

SUP-M2AR500C 4538C>A L1196M

SUP-M2AR500D 4569C>G S1206C




21

Table 4: (A) IC50 values obtained by proliferation assay for each Ba/F3 NPM-ALK WT or mutagenized cell

line are summarized. (B) RR index corresponding to each IC50 value is reported. Green: RR < 2. Yellow:

RR = 2.1-4. Orange: RR = 4.1 – 10 Red: RR > 10. Data are the average from at least 2 independent

experiments.

A

IC50 (�mol/L) AP26113 CRIZOTINIB CH5424802 LDK-378 ASP3026

WT 0.01165 0.1243 0.02911 0.0433 0.07159

L1122V 0.09735 0.3229 0.1548 0.3933 0.3493

P1139S 0.01798 0.1315 0.01881 0.1494 0.1333

F1174V 0.01787 0.1182 0.1082 0.04105 0.2831

L1196M 0.02491 0.4224 0.08548 0.04576 0.3552

L1198F 0.06797 0.01249 0.3503 0.9623 0.3849

S1206C 0.166 0.5337 0.1645 0.1785 1.227

L1122V+L1196M 0.7582 0.945 0.5955 0.3762 1.85

F1174V+L1198F 0.1421 0.005771 0.2628 0.4325 0.4161

L1196M+D1203N 0.3863 0.7426 0.1226 0.1292 0.1187




22

B

AP26113 CRIZOTINIB CH5424802 LDK-378 ASP3026

WT 1 1 1 1 1

L1122V 8.4 2.6 5.3 9.1 4.9

P1139S 1.5 1.1 0.6 3.5 1.9

F1174V 1.5 1.0 3.7 0.9 4.0

L1196M 2.1 3.4 2.9 1.1 5.0

L1198F 5.8 0.1 12.0 22.2 5.4

S1206C 14.2 4.3 5.7 4.1 17.1

L1122V+L1196M 65.1 7.6 20.5 8.7 25.8

F1174V+L1198F 12.2 0.0 9.0 10.0 5.8

L1196M+D1203N 33.2 6.0 4.2 3.0 1.7




23

Table 5: Clonal sequencing of (A) SUPM2AR500A and (B) SUPM2AR500B. For each clone the mutations

and consequent aminoacidic substitutions are reported.

A

SUP-M2AR500A

clone mutations substitutions

#1 4472 T>G 4544 C>T F1174V+L1198F

#2 4472 T>G 4544 C>T F1174V+L1198F

#3 4472 T>G 4544 C>T F1174V+L1198F

#4 4472 T>G 4544 C>T F1174V+L1198F

#5 4472 T>G 4544 C>T F1174V+L1198F




24

B

SUP-M2AR500B

clone mutations substitutions

#1 4316C>G 4538C>A L1122V+L1196M

#2 4316C>G 4538C>A 4575T>C L1122V+L1196M+L1208P

#3 4316C>G 4538C>A L1122V+L1196M

#4 4316C>G 4538C>A L1122V+L1196M

#5 4316C>G 4538C>A L1122V+L1196M

#6 4316C>G 4538C>A L1122V+L1196M

#7 4316C>G 4538C>A 4556G>A L1122V+L1196M+G1202R

#8 4316C>G 4538C>A L1122V+L1196M

#9 4367C>T P1139S

#10 4316C>G 4538C>A L1122V+L1196M

#11 4316C>G 4538C>A L1122V+L1196M

#12 4316C>G 4538C>A L1122V+L1196M

#13 4559G>A 4538C>A L1196M+D1203N

#14 4316C>G 4538C>A L1122V+L1196M

#15 4559G>A 4538C>A 4593G>A L1196M+D1203N+R1214H




25

Table 6: (A) IC50 values obtained by proliferation assay for each AP26113 resistant KARPAS-299 derived

cell line are summarized. (B) RR index corresponding to each IC50 value are reported. Green: RR < 2.

Yellow: RR = 2.1-4. Orange: RR = 4.1 – 10 Red: RR > 10.

A.

IC50 (�mol/L) CRIZOTINIB CH5424802 LDK-378 ASP3026

K299 0.02179 0.00002644 0.00949 0.03651

K299AR300A >1 0,01548 >1 >1

K299AR300B >1 0,02255 >1 >1

K299AR300C >1 0.04739 0.1114 >1

K299AR300D 0.9646 0.3232 1.106 >1

B.

CRIZOTINIB CH5424802 LDK-378 ASP3026

K299 1 1 1 1

K299AR300A >10 >10 >10 >10

K299AR300B >10 >10 >10 >10

K299AR300C >10 >10 >10 >10

K299AR300D >10 >10 >10 >10




26

FIGURES LEGEND

Figure 1: Human cell lines characterization. Parental or resistant KARPAS-299 (A) or SUP-M2 (B) cell lines

were incubated for 4 hours in the presence of increasing AP26113 concentrations: 0, 100, 300 and 1000

nM. P-ALK (Tyr1604), ALK, P-STAT3 (Tyr705), STAT3 and �ACTIN expression levels were assessed by

western blot.

Figure 2: Mechanism of AP26113 resistance in KARPAS and SUP-M2 cell lines. A. NPM-ALK expression at

transcriptional level in KARPAS and SUP-M2 cells grown respectively at AP26113 concentration 300 and

500 nM were investigated by quantitative real time PCR. B. Gene amplification is shown by FISH analysis.

C: Chromatograms related to all mutations found in AP26113 resistant SUP-M2 derived cell lines are

shown and compared to the parental SUP-M2 cells.

Fig.3: NPM-ALK targeting by AP26113 in Ba/F3 mutant cell lines. All cell lines were incubated for 4 hours

in the presence of increasing doses of the compound, then ALK P-Tyr 1604, total ALK, STAT3 P-Tyr705

and total STAT3 level are assessed by western blot. � -actin was used as loading control.




27

ACKNOWLEDGEMENTS

This work was supported by the Lombardy Region: (ID14546A).

We thank ARIAD PHARMACEUTICAL, PFIZER, ASTELLAS and NOVARTIS that kindly provided all drugs

used for this work.




28

BIBLIOGRAPHY

1. Morris SW, Kirstein MN, Valentine MB, Dittmer KG, Shapiro DN, Saltman DL, et al. Fusion of a

kinase gene, ALK, to a nucleolar protein gene, NPM, in non-Hodgkin's lymphoma. Science. 1994 Mar

4;263(5151):1281-4.

2. Coffin CM, Patel A, Perkins S, Elenitoba-Johnson KS, Perlman E, Griffin CA. ALK1 and p80

expression and chromosomal rearrangements involving 2p23 in inflammatory myofibroblastic tumor.

Mod Pathol. 2001 Jun;14(6):569-76.

3. Soda M, Choi YL, Enomoto M, Takada S, Yamashita Y, Ishikawa S, et al. Identification of the

transforming EML4-ALK fusion gene in non-small-cell lung cancer. Nature. 2007 Aug 2;448(7153):561-6.

4. van Gaal JC, Flucke UE, Roeffen MH, de Bont ES, Sleijfer S, Mavinkurve-Groothuis AM, et al.

Anaplastic lymphoma kinase aberrations in rhabdomyosarcoma: clinical and prognostic implications. J

Clin Oncol. 2012 Jan 20;30(3):308-15.

5. Wang WY, Gu L, Liu WP, Li GD, Liu HJ, Ma ZG. ALK-positive extramedullary plasmacytoma with

expression of the CLTC-ALK fusion transcript. Pathol Res Pract. 2011 Sep 15;207(9):587-91.

6. Debelenko LV, Raimondi SC, Daw N, Shivakumar BR, Huang D, Nelson M, et al. Renal cell

carcinoma with novel VCL-ALK fusion: new representative of ALK-associated tumor spectrum. Mod

Pathol. 2011 Mar;24(3):430-42.




29

7. Murugan AK, Xing M. Anaplastic thyroid cancers harbor novel oncogenic mutations of the ALK

gene. Cancer Res. 2011 Jul 1;71(13):4403-11.

8. Ning H, Mitsui H, Wang CQ, Suarez-Farinas M, Gonzalez J, Shah KR, et al. Identification of

anaplastic lymphoma kinase as a potential therapeutic target in Basal Cell Carcinoma. Oncotarget. 2013

Oct 2.

9. Lin E, Li L, Guan Y, Soriano R, Rivers CS, Mohan S, et al. Exon array profiling detects EML4-ALK

fusion in breast, colorectal, and non-small cell lung cancers. Mol Cancer Res. 2009 Sep;7(9):1466-76.

10. Lipson D, Capelletti M, Yelensky R, Otto G, Parker A, Jarosz M, et al. Identification of new ALK

and RET gene fusions from colorectal and lung cancer biopsies. Nat Med. 2012 Mar;18(3):382-4.

11. Mosse YP, Laudenslager M, Longo L, Cole KA, Wood A, Attiyeh EF, et al. Identification of ALK as a

major familial neuroblastoma predisposition gene. Nature. 2008 Oct 16;455(7215):930-5.

12. Azarova AM, Gautam G, George RE. Emerging importance of ALK in neuroblastoma. Semin

Cancer Biol. 2011 Oct;21(4):267-75.

13. Powers C, Aigner A, Stoica GE, McDonnell K, Wellstein A. Pleiotrophin signaling through

anaplastic lymphoma kinase is rate-limiting for glioblastoma growth. J Biol Chem. 2002 Apr

19;277(16):14153-8.

14. Lori Hudson KK, Debra Young, Roger McLendon and Amy Abernethy. ALK and cMET expression

in glioblastoma multiforme: Implications for therapeutic targeting. Molecular Cancer Therapeutics.

2011;10(11):supplement 1.

15. Roskoski R, Jr. Anaplastic lymphoma kinase (ALK): structure, oncogenic activation, and

pharmacological inhibition. Pharmacol Res. 2013 Feb;68(1):68-94.

16. Chiarle R, Simmons WJ, Cai H, Dhall G, Zamo A, Raz R, et al. Stat3 is required for ALK-mediated

lymphomagenesis and provides a possible therapeutic target. Nat Med. 2005 Jun;11(6):623-9.




30

17. Chiarle R, Voena C, Ambrogio C, Piva R, Inghirami G. The anaplastic lymphoma kinase in the

pathogenesis of cancer. Nat Rev Cancer. 2008 Jan;8(1):11-23.

18. Shaw AT, Kim DW, Nakagawa K, Seto T, Crino L, Ahn MJ, et al. Crizotinib versus chemotherapy in

advanced ALK-positive lung cancer. N Engl J Med. 2013 Jun 20;368(25):2385-94.

19. Gambacorti-Passerini C, Messa C, Pogliani EM. Crizotinib in anaplastic large-cell lymphoma. N

Engl J Med. 2011 Feb 24;364(8):775-6.

20. Gambacorti Passerini C, Farina F, Stasia A, Redaelli S, Ceccon M, Mologni L, et al. Crizotinib in

advanced, chemoresistant anaplastic lymphoma kinase-positive lymphoma patients. J Natl Cancer Inst.

2014 Feb 1;106(2):djt378.

21. Deininger MW, Holyoake TL. Can we afford to let sleeping dogs lie? Blood. 2005 Mar

1;105(5):1840-1.

22. Gambacorti-Passerini CB, Gunby RH, Piazza R, Galietta A, Rostagno R, Scapozza L. Molecular

mechanisms of resistance to imatinib in Philadelphia-chromosome-positive leukaemias. Lancet Oncol.

2003 Feb;4(2):75-85.

23. Choi YL, Soda M, Yamashita Y, Ueno T, Takashima J, Nakajima T, et al. EML4-ALK mutations in

lung cancer that confer resistance to ALK inhibitors. N Engl J Med. 2010 Oct 28;363(18):1734-9.

24. Sasaki T, Okuda K, Zheng W, Butrynski J, Capelletti M, Wang L, et al. The neuroblastoma-

associated F1174L ALK mutation causes resistance to an ALK kinase inhibitor in ALK-translocated

cancers. Cancer Res. 2010 Dec 15;70(24):10038-43.

25. Doebele RC, Pilling AB, Aisner DL, Kutateladze TG, Le AT, Weickhardt AJ, et al. Mechanisms of

resistance to crizotinib in patients with ALK gene rearranged non-small cell lung cancer. Clin Cancer Res.

2012 Mar 1;18(5):1472-82.




31

26. Katayama R, Shaw AT, Khan TM, Mino-Kenudson M, Solomon BJ, Halmos B, et al. Mechanisms of

acquired crizotinib resistance in ALK-rearranged lung Cancers. Sci Transl Med. 2012 Feb

8;4(120):120ra17.

27. Mologni L. Inhibitors of the anaplastic lymphoma kinase. Expert Opin Investig Drugs. 2012

Jul;21(7):985-94.

28. Victor M. Rivera RA, Frank Wang, Sen Zhang, Jeffrey Keats, Yaoyu Ning, Scott D. Wardwell,

Lauren Moran, Emily Ye, Dung Yu Chun, Qurish K. Mohemmad, Shuangying Liu, Wei-Sheng Huang, Yihan

Wang, Mathew Thomas, Feng Li, Jiwei Qi, Juan Miret, John D. Iuliucci, David Dalgarno, Narayana I.

Narasimhan, Tim Clackson and William C. Shakespeare Efficacy and pharmacodynamic analysis of

AP26113, a potent and selective orally active inhibitor of Anaplastic Lymphoma Kinase (ALK) AACR.

Washington, D.C., April 17-21, 2010.

29. Ceccon M, Mologni L, Bisson W, Scapozza L, Gambacorti-Passerini C. Crizotinib-resistant NPM-

ALK mutants confer differential sensitivity to unrelated Alk inhibitors. Mol Cancer Res. 2013

Feb;11(2):122-32.

30. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. The Sequence Alignment/Map

format and SAMtools. Bioinformatics. 2009 Aug 15;25(16):2078-9.

31. Piazza R, Magistroni V, Pirola A, Redaelli S, Spinelli R, Galbiati M, et al. CEQer: a graphical tool for

copy number and allelic imbalance detection from whole-exome sequencing data. PLoS One.

2013;8(10):e74825.

32. Redaelli S, Piazza R, Rostagno R, Magistroni V, Perini P, Marega M, et al. Activity of bosutinib,

dasatinib, and nilotinib against 18 imatinib-resistant BCR/ABL mutants. J Clin Oncol. 2009 Jan

20;27(3):469-71.




32

33. Redaelli S, Mologni L, Rostagno R, Piazza R, Magistroni V, Ceccon M, et al. Three novel patient-

derived BCR/ABL mutants show different sensitivity to second and third generation tyrosine kinase

inhibitors. Am J Hematol. 2014 Nov;87(11):E125-8.

34. Sen Zhang FW, Jeffrey Keats, Yaoyu Ning, Scott D. Wardwell, Lauren Moran, Qurish K.

Mohemmad, Emily Ye, Rana Anjum, Yihan Wang, Xiaotian Zhu, Juan J. Miret, David Dalgarno, Narayana I.

Narasimhan, Tim Clackson, William C. Shakespeare, Victor M. Rivera. AP26113, a potent ALK inhibitor,

overcomes mutations in EML4-ALK that confer resistance to PF-02341066. AACR poster session, 2010.

35. Katayama R, Khan TM, Benes C, Lifshits E, Ebi H, Rivera VM, et al. Therapeutic strategies to

overcome crizotinib resistance in non-small cell lung cancers harboring the fusion oncogene EML4-ALK.

Proc Natl Acad Sci U S A. May 3;108(18):7535-40.

36. Heuckmann JM, Holzel M, Sos ML, Heynck S, Balke-Want H, Koker M, et al. ALK mutations

conferring differential resistance to structurally diverse ALK inhibitors. Clin Cancer Res. Dec

1;17(23):7394-401.













Published OnlineFirst November 24, 2014.Mol Cancer Res M. Ceccon, L. Mologni, G. Giudici, et al. LYMPHOMAHUMAN NPM-ALK-POSITIVE ANAPLASTIC LARGE CELL

INUSING THE SECOND-GENERATION ALK INHIBITOR AP26113 TREATMENT EFFICACY AND RESISTANCE MECHANISMS

Updated version

10.1158/1541-7786.MCR-14-0157doi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2014/11/21/1541-7786.MCR-14-0157.DC1.html

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

[email protected] at

To request permission to re-use all or part of this article, contact the AACR Publications



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-14-0157

http://mcr.aacrjournals.org/content/suppl/2014/11/21/1541-7786.MCR-14-0157.DC1.html

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

mailto:[email protected]


Date post:	29-Apr-2023
Category:	Documents
Upload:	independent
View:	0 times
Download:	0 times

TREATMENT EFFICACY AND RESISTANCE MECHANISMS USING THE SECOND-GENERATION ALK INHIBITOR AP26113 IN...

Documents