+ All Categories
Transcript
Page 1: DNA Double stranded Complimentary Composed of Nucleotides.

Protein Synthesis

Page 2: DNA Double stranded Complimentary Composed of Nucleotides.

DNADouble strandedComplimentaryComposed of

Nucleotides

Page 3: DNA Double stranded Complimentary Composed of Nucleotides.

DNA replicationDNA Helicase – breaks

hydrogen bonds holding complimentary strands together

Forms replication fork Leading strandLagging strand

Page 4: DNA Double stranded Complimentary Composed of Nucleotides.

DNA ReplicationDNA is read 5’ to 3’

Page 5: DNA Double stranded Complimentary Composed of Nucleotides.

Leading Stand

Helicase -> RNA pimase -> DNA polymerase

Page 6: DNA Double stranded Complimentary Composed of Nucleotides.

Lagging Stands

Helicase -> RNA primase -> DNA polymerase -> okazaki fragments -> DNA polymerase cleans up RNA primase strand -> DNA ligase

Page 8: DNA Double stranded Complimentary Composed of Nucleotides.

Protein Synthesis 2 parts

Transcription To copy segment of

DNATranslation

To translate the language of nitrogenous bases into amino acids

Page 9: DNA Double stranded Complimentary Composed of Nucleotides.

RNA vs. DNADifference between mRNA and DNA

Single stranded vs. Double stranded The sugar has an extra oxygen, ribose vs.

deoxyribose Uses uricil “U” instead of thymine

Page 10: DNA Double stranded Complimentary Composed of Nucleotides.

TranscriptionProduction of mRNA

RNA primase binds to DNA at a promoter region

RNA polymerase adds bases copying the gene

Page 11: DNA Double stranded Complimentary Composed of Nucleotides.

MovieTranscription

http://www.dnalc.org/resources/3d/13-transcription-advanced.html

Page 12: DNA Double stranded Complimentary Composed of Nucleotides.

PackagedmRNA is processed to leave the nucleus

Extras are cut out Splicosomes

Introns Exons

Poly-A tail 5’ cap

Page 13: DNA Double stranded Complimentary Composed of Nucleotides.

TranslationmRNA has left the nucleus.Binds with ribosomemRNA -> tRNA -> amino acids -> folded

proteins

What’s the Problem?mRNA

UGGCUUGCAUGCCGGAGUCCACGUAAUCA

Into Amino acids

AUCG

Amino Acids

Page 14: DNA Double stranded Complimentary Composed of Nucleotides.

TranslationtRNA consists of a

Anticodon – 3 bases that match codonAmino acid

Codon – 3 base sequence on mRNA

Page 15: DNA Double stranded Complimentary Composed of Nucleotides.

TranslationmRNA -> tRNA -> amino acids -> proteins

Page 16: DNA Double stranded Complimentary Composed of Nucleotides.

TranslationmRNA

UGGCUUGCAUGCCGGAGUCCACGUAAUCA

Page 17: DNA Double stranded Complimentary Composed of Nucleotides.

MovieTranslation

http://www.hhmi.org/biointeractive/translation-basic-detail


Top Related