What is DNA
DNA is also know as
DNA is the basic “building Block” of life. But what does that mean? and how does something soooo small make up ALL that is you?
Perhaps when you think of DNA, you think of something out of a sci fi film. Like poor Bryant here…
So let’s Look at the Basic’s DNA is held in your nucleus. It never leaves (copies get
sent out to do the dirty work but NEVER the DNA itself.)
The subunit of DNA is made of a
Basic’s
There are 4 Nitrogenous Bases:
Adenine (____)
Guanine (____)
Thymine (____)
Cytosine (____)
A always bonds with T
G always bonds with C
Think – “A Tall Girl Called”
G C
T A
C G
A T
How is DNA kept in your Cells?
You have roughly 3’ of DNA in each of your billions of cells.
They need to be tightly coiled like a phone cord (remember those things) then coiled around protein.
These are the structures you see as chromosomes.
Chromosomes
Karyotype
When a women has a child they can do what is called a _______________ This is a picture of the baby’s DNA before they are born. They pair up all the Chromosomes to see if there are any abnormalities.
DNA fingerprints?
Everyone’s DNA is unique to them. Unless, they are an identical twin.
I’m sure you’ve seen on CSI, they take DNA evidence.
They do this by doing a DNA Gel Electrophoresis. (we will be doing one too)
On the following slide you will see a picture of several twin’s DNA fingerprints.
Twin DNA Fingerprints
How do you make more?
Well we know you are more then the one cell you started at.
And every cell you have has the same DNA, so how do you make more DNA?
It’s called DNA Replication.
You’re DNA is in the shape of a Double Helix – like a twisted ladder. This shape is not really the best in aiding the replication process.
What to do, what to do …
Replication
First you ______________ a section
Then you must ______________
This is done by breaking the ____________ bonds
between the nitrogenous bases.
Now you find a new “______________________”
partner (A with T, G with C)
Once a section has been partnered up it
____________________
Replication
Closer look at
Replication This is a
_________________ replication because each new strand has half of the old strand.
The old strand is used as a ____________or guide of where to put the new bases
But how does DNA control Cell functions?
Well like any building site – there are a set of
blue prints. You don’t want to hand out the
original, you have to make a copy to give the
plumber, electrician, mason, etc.
So we make a messenger molecule called RNA.
RNA is kind of like DNA in that it is made up of
nucleotides (remember – sugar, phosphate,
base)
RNA
However, RNA’s bases areAdenine (____)
Guanine (____)
Cytosine (____)
URACIL (____)
Also RNA is single Stranded, that’s how it can fit out of the nuclear pores.
The process in which we make RNA from DNA is like replication but the RNA strand leaves, and the DNA just retwists
Transcription
Transcription
So now you keep the original In the nucleus,
and the copy goes out into the cytoplasm.
The code is an exact copy of the DNA’s code
(with the exception of U’s instead of T’s)
So it looks something like -
AUGUUUAAAGGGCCCUAGCGCUUAAGGUUAAGGCCUUUGUAUUAAUAG
OK so how does that RNA tell our cells what to do?
So now the RNA code is in the cytoplasm. A
ribosome bonds to an initiation site.
The ribosome “reads” this code and figures out
what amino acids to put together to make a
protein.
The proteins made are what influences the cells
behavior.
So let’s look at TRANSLATION in detail.
The Ribosome reads the RNA three letters at
a time. This is called the codon.
If you look at the amino acid chart you will
see there are 20 amino acids but 64 different
codon possibilities. That means that several
codons code for the same amino acid.
A T-RNA with the anti-codon brings the
appropriate amino acid to the M-RNA and
links the amino acids together.
Codon - Amino Acid Chart
Translation
In the codon chart, you saw the amino acid
sequences. The ribosome knows where to start
reading based on the initiation codon AUG, and
where to end based on three termination
sequences: UAA, UGA, UAG
You saw in that second picture that the ribosome
held two T-RNA. The first one holds the chain of
amino acids, while the second one brings in the
new amino acid.
The following is an animation of the ribosome
traveling down the Messenger RNA
Translation
Here’s an animation of translation I found online
Many ribosomes can read the RNA strand at one time.
What’s the big deal making proteins?
Proteins are what controls the activities going on in your cells.
Remember, enzymes are protein too.
IMPORTANT :
the sequence of the amino acids determines the SHAPE of the protein
The SHAPE determines the FUNCTION of the protein
If the DNA changes (a mutation), the AMINO ACID could change, which WOULD change the shape, which WOULD change the function.
Remember since some codons code for the same amino acid, substituting one letter for another MAY change the amino acid. It is not a guarantee. However, If you delete or add a letter that would change the reading frame and would change almost all the amino acids.
Overview of Transcription and Translation
Types of Mutations
• Point mutations – occurs when a single nucleotide is substituted by another nucleotide.
• THE CAT ATE THE RAT – original
• THE BAT ATE THE RAT - mutation
• THE CAT ATE THE BAT - mutation
• Frame Shift Mutation – addition or deletion that involves the loss or addition of a single nucleotide
• THE CAT ATE THE BAT – original
• THC ATA TET HEB AT – mutation
• THE CAA THT HEB AT – mutation
• THG ECA TAT ETH EBA T - mutation