Post on 04-Mar-2021
transcript
SPECIES DIVERSITY AND BIOLOGICAL ACTIVITIES OF SOME LICHENS OF DISTRICT
MANSEHRA
ASMAT ULLAH
DEPARTMENT OF BOTANY HAZARA UNIVERSITY MANSEHRA
2019
ii
HAZARA UNIVERSITY MANSEHRA
Department of Botany
SPECIES DIVERSITY AND BIOLOGICAL ACTIVITIES OF SOME SELECTED LICHENS OF
DISTRICT MANSEHRA
By
Asmat Ullah
This research study has been conducted and reported as partial
fulfulment of the requirements of Ph.D degree in Botany awarded by
Hazara University Mansehra, Pakistan
Date: 30 August, 2019
iii
SPECIES DIVERSITY AND BIOLOGICAL ACTIVITIES OF SOME LICHENS OF DISTRICT
MANSEHRA
Submitted by ASMAT ULLAH
PhD Scholar
Supervisor DR. ZAFAR IQBAL
Assistant Professor
Department of Botany
Hazara University Mansehra
Co-Supervisor DR. MUHAMMAD FIAZ
Assistant Professor
Department of Botany
Hazara University Mansehra
DEPARTMENT OF BOTANY HAZARA UNIVERSITY MANSEHRA
2019
iv
v
vi
Plagiarism Undertaking
I solemnly declare that research work presented in the thesis titled
“Species Diversity and Biological Activities of Some Lichens of District
Mansehra” is solely my research work with no significant contribution
from any other person. Small contribution/help where taken has been duly
acknowledged and that complete thesis has been written by me.
I understand the zero tolerance policy of the HEC and Hazara University
towards plagiarism. Therefore, I as an Author of the above titled thesis
declare that no portion of my thesis has been plagiarized and any material
used as reference is properly referred/cited.
I undertake that if I am found guilty of any formal plagiarism in the above
titled thesis even after award of Ph.D. degree, the University reserves the
rights to withdraw/revoke my Ph.D. degree and that HEC and the
University has the right to publish my name on the HEC/University
Website on which names of students are placed who submitted plagiarized
thesis.
Student Signature: __________________
Student Name: Asmat Ullah
vii
AUTHOR’S DECLARATION
I Asmat Ullah hereby state that my PhD thesis titled “Species Diversity
and Biological Activities of Some Lichens of District Mansehra” is my
own work and has not been submitted previously by me for taking any
degree from this University (Hazara University Mansehra Pakistan) Or
anywhere else in the country/world.
At any time if my statement is found to be incorrect even after my
Graduate the university has the right to withdraw my PhD degree.
Asmat Ullah
Date: 30-08-2019
viii
DEDICATION
To my parents
ix
ACKNOWLEDGEMENTS
All praises be to Almighty Allah Who is The Creater of the universe and
knows whatever is in it, hidden or evident, and Who bestowed upon me
the intellectual ability and wisdom to look for its secrets.
First, I would like to thank my Supervisor Dr. Zafar Iqbal, Department of
Botany and Co-supervisor Dr. Muhammad Faiz, Department of Botany for
their guidance, encouragement, and patience throughout this tenure.
I also express my heartiest and sincerest gratitude to Dr. Fakhr-e-Abbas
BRC Islamabad for his support and for giving me the opportunity to carry
out my research work and thesis at Bioresource Research Center (BRC)
Islamabad. I would like to thank Safia Janjua, Madeeha Manzoor, Kainat
Willaim, Abdur Raziq, Fida Muhammad Khan and other BRC staff for their
assistance in my research work.
I would also like to thank my fellow graduate students Mazhar-ul-Islam,
Rashid Ahmad, Ashfaq Ahmad, Amir Khan Afridi and Saeed Muhammad
for all their time and help as their assistance, cooperation, and experience
proved essential for the completion of the field work.
My deep appreciation goes out to Syed Junaid Shah and Syed Mushrraf
Shah, the locals of District Mansehra. Their excellent help during field
surveys and collection of data made an invaluable contribution to my Ph.D
work.
I would like to thank various staff members and Ph.D students of the
Senckenberg World of Biodiversity Frankfurt, Germany, with whom I had
the opportunity to work; Dr. Christian Printzen, Viola Zilller, Heike
Kappes, Tetiana Lutsak, Elisa Lagostina. They provided cooperative and a
friendly atmosphere at work and also insightful comments on my work.
x
I express my special thanks to Andre Aptroot Curator, ABL Herbarium,
Soest, Netherlands, for his support in identification of lichen specimens.
I would like to say special thanks to my special friends Muhammad Umar,
Muhammad Khalil, Imran Khan and Salman Shahzad in Germany for their
assistance and cooperation during my stay in Germany on IRSIP
fellowship of Higher Education Commission, Pakistan. Finally, I also thank
my mother and other family members who encouraged me and prayed for
me throughout the time of my research.
May the Almighty Allah richly bless all of you?
ASMAT ULLAH
xi
TABLE OF CONTENTS
Title Page No.
ACKNOWLEDGEMENTS ................................................................................. ix
LIST OF TABLES .............................................................................................. xiv
LIST OF FIGURES ............................................................................................ xvi
LIST OF PLATES ................................................................................................ xx
LIST OF SYMBOLS/ABBREVIATIONS .................................................... xxiii
ABSTRACT ....................................................................................................... xxv
Chapter 1 INTRODUCTION......................................................................... 1
1.1 Study Area ............................................................................................... 1
1.1.1 Geography ................................................................................. 1
1.1.2 Climate ....................................................................................... 1
1.1.3 Rivers ......................................................................................... 3
1.1.4 Lakes .......................................................................................... 3
1.1.5 Forests Types ............................................................................ 3
1.2 Lichens ...................................................................................................... 7
1.2.1 General Structure ..................................................................... 7
1.2.2 Occurrence and Distribution .................................................. 8
1.2.3 Climate ....................................................................................... 8
1.2.4 Morphology and Growth Form ............................................. 9
1.2.5 Chemistry ................................................................................ 10
1.2.6 DNA Barcoding ...................................................................... 10
1.2.7 Economic Importance ............................................................ 11
1.2.8 Biological Activities ............................................................... 12
xii
1.2.8.1 Antibacterial Activity ............................................................ 13
1.2.8.2 Antifungal Activity ................................................................ 13
1.2.8.3 Plants Cell Carcinogensis ...................................................... 13
1.3 Study Objectives .................................................................................... 14
Chapter 2 REVIEW OF LITERATURE ...................................................... 15
2.1 Species Diversity and Distribution ..................................................... 15
2.2 Biological Activities of Lichens ........................................................... 21
Chapter 3 MATERIALS AND METHODS............................................... 32
3.1 Field Survey ........................................................................................... 32
3.2 Characterization .................................................................................... 32
3.2.1 Morphological Characters .................................................... 32
3.2.2 Anatomical Characters .......................................................... 33
3.2.3 Chemical Characters .............................................................. 33
3.2.3.1 Spot Tests ................................................................................ 33
3.2.3.2 Thin Layer Chromatography ............................................... 34
3.2.4 DNA Barcoding ...................................................................... 35
3.2.4.1 Genomic DNA Extraction ..................................................... 35
3.2.4.2 Gel Electrophoresis ................................................................ 36
3.2.4.3 Polymerase Chain Reaction (PCR) ...................................... 37
3.3 Identification and Documentation ..................................................... 39
3.4 Distribution Pattern Studies ................................................................ 40
3.5 Biological Activities .............................................................................. 40
3.5.1 Preparation of Lichen Extracts ............................................. 40
3.5.1.1 Antimicrobial Assays ............................................................ 41
xiii
3.5.1.2 Cytotoxicity Assay ................................................................. 41
3.5.1.3 Anticarcinogenic Assay ......................................................... 42
3.5.1.4 Antioxidant Assay ................................................................. 42
Chapter 4 RESULTS ...................................................................................... 44
4.1 Lichen Biodiversity ............................................................................... 44
4.1.1 Species Recorded as New to Pakistan ................................. 58
4.1.2 Species Recorded as New to District Mansehra ................ 59
4.1.3 Distribution Pattern ............................................................... 63
4.1.3.1 Growth Form .......................................................................... 63
4.1.3.2 Substrate .................................................................................. 63
4.1.3.3 Locality-Wise Distribution.................................................... 65
4.2 Taxonomic Description ........................................................................ 70
4.2 Lichen Species Identified by DNA Barcoding ................................ 262
4.3 Biological Activities ............................................................................ 264
4.3.1 Antibacterial Activity .......................................................... 264
4.3.2 Antifungal Activity .............................................................. 267
4.3.3 Cytotoxcity Assay ................................................................ 270
4.3.4 Anticarcinogenic Activity on Plants .................................. 274
4.3.5 Antioxidant Activity ............................................................ 277
Chapter 5 DISSCUSSION .......................................................................... 281
CONCLUSION .................................................................................................. 291
RECOMMENDATIONS ................................................................................. 292
REFFRENCES .................................................................................................... 293
xiv
LIST OF TABLES
Table Page No.
Table 3.1: List of Primer used for PCR Amplification. ................................... 37
Table 3.2: Thermoprofile of PCR reaction, showing each step with
number of cycles and corresponding temperature for each
step. ...................................................................................................... 38
Table 4.1: List of species from District Mansehra, Pakistan ........................... 45
Table 4.2: List of families with genera and number of species from
District Mansehra ............................................................................... 54
Table 4.3: Number of families and genera in District Mansehra .................. 56
Table 4.4: List of dominant families by number of species in District
Mansehra. ............................................................................................ 57
Table 4.5: The new record of species to Pakistan from District
Mansehra ........................................................................................... 59
Table 4.6: List of species with families new to District Mansehra ............... 60
Table 4.7: List of taxa found at more than one locality in District
Mansehra ............................................................................................. 65
Table 4.8: List of taxa recorded from single locality in District
Mansehra. ............................................................................................ 69
Table 4.9: List of species identified by DNA barcoding. .............................. 263
Table 4.10: Antibacterial activity of acetone extracts of selected lichen
species from District Mansehra ................................................... 265
Table 4.11: Antibacterial activity of methanol extracts of selected
lichen species from District Mansehra ........................................ 266
xv
Table 4.12: Antifungal activity of acetone extracts of selected lichen
species from District Mansehra. ................................................... 268
Table 4.13: Antifungal activity of methanol extracts of selected lichen
species from District Mansehra .................................................... 269
Table 4.14: Percentage mortality of acetone extracts in different
concentration of selected lichen species from District
Mansehra ......................................................................................... 271
Table 4.15: Percentage mortality of methanol extracts in different
concentration of selected lichen species from District
Mansehra ......................................................................................... 272
Table 4.16: Anticarcinogenic activity of acetone and methanol extracts
of selected lichen species from District Mansehra ..................... 275
Table 4.17: Antioxidant activity of acetone extracts of selected lichen
species from District Mansehra .................................................... 278
Table 4.18: Antioxidant activity of methanol extracts of selected
species from District Mansehra .................................................... 279
xvi
LIST OF FIGURES
Figure Page No.
Fig. 1.1: Administrative Map of the District Mansehra, Pakistan. .................. 2
Fig. 4.1: Lichen families having more than two genera in District
Mansehra. ............................................................................................... 58
Fig. 4.2: Families with number of genera of species new to District
Mansehra .............................................................................................. 62
Fig. 4.3: Dominant families by number of genus of species new to
District Mansehra ................................................................................ 62
Fig. 4.4: Relative (%) of different growth forms of species in District
Mansehra. ............................................................................................. 63
Fig. 4.5: Realtive (%) of species in different habitat in District
Mansehra. ............................................................................................. 64
Fig. 4.6: Relative (%) of lichens on basis of hosted substrate in District
Mansehra. ............................................................................................. 64
Fig. 4.7: Distribution of Acarosporaceae in District Mansehra; 1.
Jalkhad 2. Lalazar, 3. On the the way to Saif-ul-Maluk, 4.
Manoor Valley, 5. Paras, 6. Mahandri, 7. Balakot, 8. Daader,
9. Ghari Habibullah, 10. Khaki, 11. Oghi top. ................................. 74
Fig. 4.8: Distribution of Arthoniaceae in District Mansehra; 1.
Mandagucha. 2. Shogran, 3. Paras. ................................................... 78
Fig. 4.9: Distribution of Arthopyreniaceae in District Mansehra; 1. On
way to Naran from Paras, 2. Mahandri (Kaghan), 3. Kiwai, 4.
Shogran, 5. Mandagucha. ................................................................... 81
Fig. 4.10: Distribution of Candelariaceae in District Mansehra; 1.
Behsal, 2. Jalkhad, 3. Lalazar, 4. Lake Saif-ul-Maluk, 5.
xvii
Manoor Valley, 6. Paras, 7. Sharan, 8. Shogran, 9.
Mandaghucha, 10. Dader, 11. Batal, 12. Oghi top. .......................... 90
Fig. 4.11: Distribution of Catillariaceae in District Mansehra; 1. Ghari
Habibullah, 2. Dader.. ......................................................................... 94
Fig. 4.12: Distribution of Cladoniaceae in District Mansehra: 1. Lulusar
lake. 2. Lalazar, 3. Kaghan, 4. Manoor Valley, 5. Shogran, 6.
Paras, 7. Sharan. ................................................................................. 102
Fig. 4.13: Distribution of Collemataceae in District Mansehra: 1.
Lalazar, 2. Naran, 3. Manoor Valley near forest rest house, 4.
Kaghan on way Naran, 5. Paras, 6. Shogran on track to
Saripya, 7. Dader, Ooghi top. .......................................................... 113
Fig. 4.14: Distribution of Graphidacea in District Mansehra; 1. Jalkhad.
2. Barhawai, 3. On way to lake Saif-ul-Maluk, 4. Manoor
Valley, 5. On track to Saripaya, 6. Dader, 7. Mandagucha, 8.
Oghi, 9. Parehna................................................................................. 118
Fig. 4.15: Distribution of Lecanoraceae in District Mansehra; 1.
Jalkhad, 2. near Batakundi, 3. Lalazar, 4. Barawai, 5. Naran,
6. Manoor Valley, 7. Kaghan, 8. Shogran, 9. Kiwai, 10. Hasa
Balakot, 11. Dader, 12. Mandagucha, 13. Oghi. ............................ 137
Fig. 4.16: Distribution of Lecidaceae in District Mansehra; 1. Jalkhad,
2. above Lake Saif-ul-Maluk. ........................................................... 143
Fig. 4.17: Distribution of Megasporaceae in District Mansehra; 1.
JalKhad, 2. Lake Saif-ul -Maluk, 3. Paras near the side of
Kunhar river, 4. Shogran, 5. Balakot, 6. Dader near Siran
river, 7. Mandaghucha, 8. Oghi top. 9. Kathai Oghi..................... 151
Fig. 4.18: Distribution of Mycoblastaceae in District Mansehra; 1.
Manoor Valley, 2. on way to lake Saif-ul-Maluk. ......................... 153
xviii
Fig. 4.19: Distribution of Nephromataceae in District Mansehra; 1.
Batakundi, 2. Manoor Valley near forest rest house,
3.Shogran. ........................................................................................... 157
Fig. 4.20: Distribution of Parmeliaceae in District Mansehra: 1. Behsal,
2. Jalkhad, 3. Lalazar, 4. lake Saif-ul-Maluk, 5. Manoor
Valley, 6. Paras, 7. Sharan, 8. Shogran, 9. Managhucha, 10.
Dader, 11. Batal, 12.Oghi top. .......................................................... 181
Fig. 4.21: Distribution of Peltigeraceae in District Mansehra; 1.
Batakundi, 2. Manoor Valley near forest rest house, 3.
Shogran. .............................................................................................. 188
Fig. 4.22: Distribution of Peltulaceae in District Mansehra. 1. Dader......... 191
Fig. 4.23: Distribution of Pertusariaceae in District Mansehra; 1.
Shogran, 2. Mandagucha. ................................................................. 193
Fig. 4.24: Distribution of Physciaceae in District Mansehra: 1. Lulusar
lake. 2. Lalazar, 3. Kaghan, 4. Manoor Valley, 5. Shogran, 6.
Paras, 7. Sharan. ................................................................................. 211
Fig. 4.25: Distribution of Psoraceae in District Mansehra; 1. Lalazar. ........ 216
Fig. 4.26: Distribution of Ramalinaceae in District Mansehra; 1. Lalzar,
2. Naran,3. Manoor Valley, 4. Sharan , 5. on way to Saripaya. ... 226
Fig. 4.27: Distribution of Rhizocarpaceae in District Mansehra: 1.
Jalkhad, 2. Naran, 3. lake Saif -ul- Maluk, 4. Manoor Valley. ..... 231
Fig. 4.28: Distribution of Stereocaulaceae in District Mansehra; 1.
Shogran, 2. Mandagucha. ................................................................. 234
Fig. 4.29: Distribution of Teloschistaceae in District Mansehra; 1.
Lulusar lake, 2. Lalazar, 3. Kaghan, 4. near forest rest house
Manoor Valley, 5. Shogran, 6. Paras, 7. Sharan. ............................ 243
xix
Fig. 4.30: Distribution of Thelotremataceae in District Mansehra; 1.
Jalkhad. 2. Barhawai, 3. on way to lake Saif-ul-Maluk, 4.
Manoor Valley, 6. Dader, 7. Mandagucha, 8. Oghi, 9.
Parehna. .............................................................................................. 248
Fig. 4.31: Distribution of Trapeliaceae in District Mansehra: 1. Kaghan,
2. Mandaghucha. ............................................................................... 251
Fig. 4.32: Distribution of Umbilicariaceae in District Mansehra. 1.
Dader. .................................................................................................. 253
Fig. 4.33: Distribution of Verrucariaceae in District Mansehra; 1.
Jalkhad, 2. Dader. .............................................................................. 260
Fig. 4.34: Percentage mortality of acetone extracts of selected lichen
species from District Mansehra. ...................................................... 273
Fig. 4.35: Percentage mortality of methanol extracts of selected lichen
species from District Mansehra. ...................................................... 273
Fig. 4.36: Percentage tumor-inhibition of acetone extracts of selected
lichen species from District Mansehra. .......................................... 276
Fig. 4.37: Percentage tumor-inhibition of Mathanol extracts of selected
lichen species from District Mansehra. 276
Fig. 4.38: Antioxidant activity of acetone extracts of selected lichen
species from District Mansehra. ...................................................... 280
Fig. 4.39: Antioxidant activity of methanol extracts of selected lichen
species from District Mansehra. ...................................................... 280
xx
LIST OF PLATES
Plate Page No.
Plate 1.1a: A. Sub-mountain forests, Trappi B. Mountain sub-tropical
forests, C. Moist Temperate Forest Dhor, District
Mansehra. ............................................................................................ 5
Plate 1.1b: D. Sub- alpine forest, Paya E. Sub-alpine pasture, Khori
(Musa ka Musalla) F. Cold desert, Malika Parbat, District
Mansehra. ............................................................................................ 6
Plate 3.1: A. Acarospora heufleriana, B. Acarospora impressula, C.
Acarospora veronensis (scale= 1 cm) in District Mansehra............ 75
Plate 3.2: Arthonia radiata (scale= 1 cm) in District Mansehra. ..................... 78
Plate 3.3: A. Arthopyrenia cinereopruinosa, B. Arthopyrenia punctiformis
(scale= 1 cm) in District Mansehra. ................................................ 82
Plate 3.4: Candelaria concolor (scale= 2 cm) in District Mansehra................... 90
Plate 3.5: A. Candelariella aurella (scale= 1 cm), B
Candelariella efflorescens, C. Candelariella reflexa (scale= 2 cm)
in District Mansehra. ........................................................................ 91
Plate 3.6: A. Candelariella vitellina (scale= 1 cm) , B
Candelariella xanthostigma (scale= 2 cm) in District
Mansehra. .......................................................................................... 92
Plate 3.7: Catillaria lenticularis (scale= 2 cm) in District Mansehra. ............... 95
Plate 3.8: A. Cladonia caespiticia, B. Cladonia fimbriata, C.
Cladonia floerkeana (scale= 2 cm) in District Mansehra. ............. 103
Plate 3.9: A. Cladonia pocillum, B. Cladonia pyxidata (scale= 2 cm) in
District Mansehra. .......................................................................... 104
xxi
Plate 3.10: A. Collema flaccidum B. Collema furfuraceum, C.
Collema subflaccidum (scale= 2 cm) in District Mansehra. ......... 114
Plate 3.11: A. Leptogium burnetiae, B. Leptogium cyanescens, C.
Leptogium hildenbrandii, D. Leptogium saturninum (scale= 2
cm) in District Mansehra. ............................................................. 115
Plate 3.12: A. Graphis elegans, B. Graphis scripta (scale= 2 cm) in District
Mansehra. ........................................................................................ 119
Plate 3.13: A. Lecanora albella, B. Lecanora argentata, C.
Lecanora cenisia (scale= 2 cm) in District Mansehra. .................. 138
Plate 3.14: A. Lecanora pseudistera, B. Lecanora pulicaris, C.
Lecanora rupicola (scale= 2 cm) in District Mansehra. ................ 139
Plate 3.15: A. Lecidella euphoria, B. Lecidella stigmatea (scale= 0.5 cm) in
District Mansehra. .......................................................................... 140
Plate 3.16: A. Rhizoplaca chrysoleuca, B. Rhizoplaca melanophthalma C.
Rhizoplaca peltata (scale= 0.5 cm) in District Mansehra. ............ 141
Plate 3.17: Porpidia crustulata (scale= 2 cm) in District Mansehra. .............. 144
Plate 3.18: Tephromela atra (scale= 0.5 cm) in District Mansehra. ................ 154
Plate 3.19: Nephroma parile(scale= 1 cm) in District Mansehra. .................... 157
Plate 3.20: Canoparmelia texana (scale= 2 cm) in District Mansehra. ........... 181
Plate 3.21: Flavoparmelia caperata (scale= 2 cm) in District Mansehra. ........ 182
Plate 3.22: A. Flavopunctelia flaventior, B. Flavopunctelia soredica (scale=
2 cm) in District Mansehra. ........................................................... 182
Plate 3.23: Parmelia sulcuta (scale= 2 cm) in District Mansehra. .................. 183
Plate 3.24: A. Peltigera horizontalis, B. Peltigera polydactylon, C.
Peltigera rufescens (scale= 2 cm) in District Mansehra. .............. 189
Plate 3.25: Peltula obscurans (scale= 2 cm) in District Mansehra. ................. 191
xxii
Plate 3.26: Pertusaria leioplaca (scale= 2 cm) in District Mansehra. .............. 194
Plate 3.27: Amandinea punctate (scale= 1 cm) in District Mansehra. ............ 211
Plate 3.28: A. Anaptychia crinalis, B. Anaptychia runcinata (scale= 1 cm)
in District Mansehra. ...................................................................... 212
Plate 3.29: Buellia stellulata (scale= 0.5 cm) in District Mansehra. .............. 212
Plate 3.30; A. Phaeophyscia ciliate, B. Phaeophyscia endococcina C.
Phaeophyscia orbicularis (scale= 0.5 cm) in District Mansehra. .. 213
Plate 3.31: Physconia muscigena (scale= 1 cm) in District Mansehra. ........... 214
Plate 3.32: Psora decipiens (scale= 2 cm) in District Mansehra. ..................... 217
Plate 3.33: Ramalina sinensis (scale= 2 cm) in District Mansehra. ................ 226
Plate 3.34: A. Bacidia laurocerasi, B. Bacidia rosella, C.
Bacidia rosella (scale= 2 cm) in District Mansehra. ...................... 227
Plate 3.35: A. Rhizocarpon geographicum (scale= 2 cm), B.
Rhizocarpon lecanorinum (scale= 0.5 cm), C.
Rhizocarpon viridiatrum (scale= 2 cm) in District Mansehra. ..... 232
Plate 3.36: Lepraria elobata (scale= 2 cm) in District Mansehra. .................... 234
Plate 3.37: A. Caloplaca cirrochroa, B. Caloplaca decipiens, C.Caloplaca
teicholyta. (scale= 0.05 cm) in District Mansehra. ....................... 244
Plate 3.38: A. Diploschistes diacapsis, B. Diploschistes muscorum, C.
Diploschistes scruposus (scale= 1 cm) in District Mansehra. ...... 249
Plate 3.39: Lasallia papulosa. (scale= 0.5 cm) in District Mansehra. .............. 254
Plate 3.40: A. Catapyrenium cinereum, B. Dermatocarpon miniatum, C.
Endocarpon pusillum (scale= 0.5 cm) in District Mansehra. ....... 261
Plate 3.41: Verrucaria muralis (scale= 2 cm) in District Mansehra. .............. 262
xxiii
LIST OF SYMBOLS/ABBREVIATIONS
% Percentage
+ Positive
_ Negative
℃ Degree centigrade
µg Micro-gram
µL Micro-liter
Aa Ascorbic acid
Aca Acarosporaceae
Alt Altitude
Art Arthoniaceae
Can Candelariaceae
Cat Catillariaceae
Cd Caloplaca decipines
Cf Collema flaccidum
Cld Cladoniaceae
Col Collemataceae
Cort Corticolous
Cp Cladonia pyxidata
Crus Crustose
Dm Dermatocarpon miniatum
DMSO Di methyl Sulfoxide
DPPH 2,2-diphenyl-1-picrylhydrazyl.
Fc Flavoparmelia caperata
Ff Flavopunctelia flaventior
Fig Figure
Foli Foliose
Frut Fruticose
Gra Graphidaceae
xxiv
Gra Graphidaceae
HUP Hazara University Pakistan
KPK Khyber Pakthunkhwa
La Lecanora allophana
Lec Lecanoraceae
Lepr Leprose
Meg Megasporaceae
Musc Muscicolous
Myc Mycoblastaceae
Min Minute
Par Parmeliaceae
Pel Peltigeraceae
Per Pertusariaceae
Phy Physciaceae
Pp Peltigera polydactylon
Ram Ramalinaceae
Rhi Rhizocarpaceae
Rv Rhizocarpon viridiatrum
Saxi Saxicolous
Squa Squamulose
Tel Teloschistaceae
Teri Tericolous
Uf Usnea fulvoreagens
Ver Verrucariacea
xxv
ABSTRACT
The present study was designed to explore the biodiversity of lichen
species in District Mansehra, Khyber Pakhtunkhwa, and hunt potential
extracts with high biological activities. For this purpose, species diversity
of lichens in the study area was explored from January 2012 to July 2015.
The study recorded 110 lichen species distributed within 27 families and 56
genera from research area. Twelve novel lichens species were also
identified as new to Pakistan including Acarospora veronensis A. Massal.,
Anaptychia crinalis (Schleich.) Vezda, Candelariella efflorescens R.C. Harris &
W.R. Buck, Cladonia caespiticia (Pers.) Flörke, Cladonia floerkeana (Fr.) Flörke,
Lecanora chlarotera Nyl., Lecanora pulicaris (Pers.) Ach., Lepraria elobata
Tønsberg, Nephroma parile (Ach.) Ach., Punctelia subrudecta (Nyl.) Krog,
Rhizocarpon lecanorinum Anders and Trapeliopsis granulosa (Hoffm.)
Lumbsch. Additionally, another remarkable milestone was the
identification of 59 lichen species belonging to 17 families and 35 genera for
the first time in District Mansehra, Khyber Paktoonkhawa. Most abundant
were crustose lichens consisting of 51 species (46.36%) while foliose lichens
comprised 11 species (42.72%). On the basis of hosted substrate, 43 species
(39.09%) were found on bark followed by 42 species (38.18%) on rocks and
12 species (10.9%) on soil. The distribution percentage of lichen species in
various habitats showed that 55 lichen species (50%) were Corticolous
followed by saxicolous with 42 species (38.18%), tericolous with 12 species
(10.9%) and muscicolous having only one species (0.9%). The leading lichen
family was Parmeliaceae with 12 genera (10.90%) followed by Physciacea
with 7 genera (6%), Teloschistaceae and Verrucariaceae with 4 genera
(3.63%) each. In present study, among the 110 identified lichens species, 63
lichen species (57.27%) were macro-lichens while remaining 47 species
(42.72%) were micro-lichens. For biological assays, antibacterial potential of
crude acetonic and methanolic extracts of ten lichen species was assessed
xxvi
against Gram+ve and Gram-ve bacteria. The maximum zone of inhibition
(12.66 mm) for acetone extracts were shown by Flavoparmelia caperata,
Lecanora allophana and Cladonia pyxidata against Escherichia coli
(ATCC_39111), Enterococcus faecalis (ATCC-19433) and Staphylococcus aureus
(ATCC_33591). However, crude methanol extracts exhibited a slightly
lower action of lichen species Flavoparmelia caperata and Rhizocarpon
viridiatrum (inhibition= 12.33 mm) against E. coli. Similarly, the maximum
antifungal activity for crude acetone extracts of ten lichen species were
shown by Caloplaca decipine and Flavoparmelia caperata (11.66 mm) against
Aspergillus niger (ATCC_16888) and A. fumigatus (ATCC_16424) while for
methanol extract, maximum activity were shown by Flavoparmelia caperata
and Lecanora allophana (10.66 mm) against A. fumigatus and A. niger.
Cytotoxicity of crude acetone and methanol extracts of the tested lichen
species were evaluated by Brine Shrimp lethality assay. The maximum
cytotoxic effect of crude acetone extract was recorded for Flavopunctelia
flaventior (60%) while maximum cytotoxic effect in crude methanol extract
was shown by Flavoparmelia caperata (53%). Antitumor activity of crude
aetone and methanol extracts of ten selected lichen species were
determined by potato disc bioassay. The highest tumor inhibition in crude
acetone extract was shown by Flavoparmelia caperata (40%) while in crude
methanolic extracts maximum tumor inhibition was shown by
Flavopunctelia flaventior (38%). The highest free radical scavenging activity
for crude acetone extract was manifested by Cladonia pyxidata (66%) while
in crude methanol extract; maximum activity was shown by Rhizocarpon
viridiatrum (57%). The present research will be helpful in the
documentation of lichen flora of District Mansehra. It is expected that the
present work on diversity and biological activities of lichens of District
Mansehra will be helpful not only for identification of lichen species but
also in opening up Pakistan unique lichen flora for further study.
1
Chapter 1
INTRODUCTION
1.1 Study Area
District Mansehra, also known as Takht-e-Hazara, is the north-
eastern district of Khyber Pakhtunkhwa, Pakistan.
1.1.1 Geography
Mansehra District covers an area of 4,579 km2 and lies from 34°-14´
to 35°- 11´ north latitude and 72°- 49´ to 74°- 08´ east longitude in Hazara
Division. Kohistan and Batagram Districts are located in the north,
Muzaffarabad District in the east, Abbottabad and Haripur Districts in the
south and Shangla and Buner Districts in the northwest. District Mansehra
is administratively divided in to five tehsils viz., Mansehra, Oghi, Balakot,
Bafa Phakal and Darband (Fig. 1.1) (Anonymous, 1998, 2005, 2011; Mazari
et al., 2012; Syed et al., 2012).
1.1.2 Climate
There are two distinct seasons, summer and winter season in
Mansehra District. For the most part of District Mansehra, climate is
pleasant warm in the summer (April-September) and very cold in the
winter (October-March). The northern parts of district, like Kaghan Valley,
face severe winters, receiving heavy snowfall. Average temperatures in the
district ranges from 2 °C to 36 °C; November-February being the coldest
months (Anonymous, 2005, 2011; Awan et al., 2011).
2
Fig. 1.1: Administrative Map of the District Mansehra, Pakistan.
3
1.1.3 Rivers
Siran and Kunhar are the two main rivers of District Mansehra
(Syed et al., 2012). River Siran starts in the north of Bhogarmang and flows
through Bhogarmang and Pakhli plain and runs for some 130 km when it
falls in to river Indus at Tarballa (Anonymous, 2005; Shah and Khan, 2006).
River Kunhar starts from Lulusar Lake of the Kaghan Valley at 3,455 m
above sea line and after flowing through 180 km falls into river Jehlum
(Anonymous, 2005; Khan et al., 2011).
1.1.4 Lakes
District is famous for its nine beautiful lakes located at different
point in Kaghan Valley, also known as “Land of Lakes”. Saif-ul-Maluk,
Ansoo lake, Dhodipatsar lake and Lulusar lake being prominent
(Anonymous, 2005).
1.1.5 Forests Types
District Mansehra is famous for its natural beauty and natural
forests (Shabaz et al., 2012); covering an area of 332,252 ha. Forests in
district are generally categorized as sub-mountain forest, mountain sub-
tropical forests, mountain temperate forests, sub-alpine forests, alpine
scrubs and pastures and Cold deserts (Husain and Ilahi, 1991).
Sub-mountain forests are located in Mansehra, Tanawal and
Darband area with Accacia, Periploca, Olea, Dodonea, Justicia and Otostegia
being key plant species.
Mountain Sub-tropical forests are distributed at 1000 - 1900 m and
are located in Shinkiari, Tanawal, Oghi, Dhodial, Balakot and Garhi Habib
Ullah areas. The main plant species in this type of forest include, Accacia,
Dodonea, Olea and Pinus roxbergii.
4
Mountain temperate forests are distributed at 1450 - 3500 m mainly
in Kaghan, Naran, Shogran, Mandagucha, Batal and Manoor areas. Pinus
willichiana, Querqus, Juglans, Prunus, Rhododendron, Papulus, Cedurs, Ulnus,
Cornus and Pyrus are the major plant species in this forest type.
Sub-alpine forests are distributed at 3182 - 3788 m and are fall in
Musa Ka Musala, Lalazar, Paya and Shogran upper areas, Batakundi and
Kaghan areas. Key plants are Rhododendron, Vibernum, Juniper, Ephedra Salix
and Betula.
Alpine scrubs and pastures are located at 3789 - 4546 m in Musa ka
Musala, Makra Peak and Batakundi areas. Key plants are Salix,
Rhododendron, Junipers and Polygonum.
Cold deserts are located in the north-eastern parts of Mansehra,
falling at > 4546 m and fall in Manoor Gali, Malika Parbat, above Ansoo
lake, Ratti Gali areas. Major plant species are Sedum, Oxyria, Sibaldia,
Primila, Oxytropis, Potentila and Thilaspia (Plate 1.1 a, b).
5
Plate 1.1a: A. Sub-mountain forests, Trappi B. Mountain sub-tropical forests,
C. Moist Temperate Forest Dhor, District Mansehra.
6
Plate 1.1b: D. Sub- alpine forest, Paya E. Sub-alpine pasture, Khori (Musa ka
Musalla) F. Cold desert, Malika Parbat, District Mansehra.
7
1.2 Lichens
1.2.1 General Structure
Symbiotic association between photobionts and mycobionts form
important group of non-vascular cryptogams, called Lichens. Lichens get
attention because of their position in evolutionary history of land plants
and pioneer colonizer of terrestrial and inhospitable environment
(Matsunage et al., 2013). This symbiotic association between algae and
fungi individuals to survive desiccation and oxidative stress with increased
reproductive success (Killmann, 2005). Both organisms in this association
undergo different structural, physiological and biochemical changes, which
prominently occurs, in the reduction of cell size, reproduction mode and in
the structure of different cell organelles (Paksa and Skaloud, 2008).
Some lichens are composed of green photobiont and cynobionts which are
called tripartite or cynolichens (Caldiz, 2005). The cynolichens contain
nitrogen fixing bacteria which provide important source of nitrogen to
nitrogen deficient ecosystem (Green et al., 1980). Lichens are quite different
from their associated organism and normally these are classified based on
their fungal partner (Karunaratne, 2005; Honegger, 2008). The fungal
partner of lichen develops the main plant body (thallus) and other fruiting
structure of lichen and that are nearly 20% of all known fungi (Sanders,
2001; Kirk et al., 2008). Only about 100 photobiont species have been
recorded in this association with more than 13,500 lichens forming fungal
species, so many mycobiont share the same photobiont. More than 99% of
these highly diverse groups of lichen forming fungi belong to Ascomycota
while less than 1% of the species recorded within Basidomycota. Large
majority of lichen species reported from world have photobiont in the form
of green algae and some 10% belong to cyanobacteria (Negi, 2003; Temina
et al., 2005). The most important cynobacterial species of lichen photobionts
include representative of Nostocales, Chroococcales, Pleurocapsales and
8
Stigonematales (Friedl and Budel, 2008). Trebouxia and Trentepohila of
green algae and cynobacteria are common photobiont that take part in this
assoaction (Lutzoni and Miadlikowsk, 2009).
1.2.2 Occurrence and Distribution
Lichens are cosmopolitan in distribution and grow in harsh
environmental condition where other organisms are not able to grow
(Halcomb, 2010). They are widely distributed in all climatic zones of the
earth surface and dominate more than 8% of terrestrial habitat (Muggia et
al., 2010). Geographic location, distance to sea, wooded meadow area and
average tree circumference are important determinants of lichen species
composition (Jansson et al., 2011). This unique group is able to grow on
rocks, soil, bark, leaves of trees and also on the shells of many insects and
turtles (Kumar, 2010). They have ability to survive in extreme
environmental conditions of temperature, moisture and low availability of
nutrient (Armstrong and Welch, 2007). Lichens also have the ability to
utilize fog and dew as source of water. About 20,000 species of lichen have
been reported from the world and distributed in wide range of habitat
dominant terrestrial ecosystem (Kumar et al., 2010). Aptroot and Iqbal
(2012) reported 368 lichen species from Pakistan.
1.2.3 Climate
Lichens are slow growing organism with an average rate of 1-5 mm
per year (Negi, 2003). These are able to grow on almost any undisturbed
surface and in climatic condition ranging from top of mountains to low tide
sea shores and from arctic to tropical regions (Ahmadjian, 1993; Desbenoit
et al., 2004). Climatic conditions along with several other variables affect
the distribution of lichen on large scale (Marmor et al., 2011). In temperate
region their growth strongly depends upon air humidity and seasonal
variation (Caldiz, 2005). As poikilohydric in nature lichens directly absorb
9
water from atmosphere and higher fungal content of thallus are limiting
factor responsible for slow growth rate of lichens (Green et al., 1980).
Lichens are highly sensitive to microclimatic changes and any man-made
and natural disturbance affect the population of lichens (Kumar, 2010).
During unfavorable climatic condition lichen are able to shut down their
metabolic activities and withstand extreme condition of heat, cold and
drought (Desbenoit et al., 2004). On the availability of favorable condition
lichens absorbed water from surrounding environment and become active
within few minutes (Negi, 2003).
1.2.4 Morphology and Growth Form
The main plant body of lichens is known as thallus which
comparable to vegetative portion of other cryptogams, like mosses and
liverworts. The fungal component of this symbiotic association forms the
main thallus of lichen while algal part sandwich between the upper and
lower fungal layers (Gilbert, 2004). Lichen Ascomycetes often exhibit
complex morphology of vegetative thallus that are usually not found in
non lichenzoid fungi. These include the thallus organization and other
structure associated with main thallus, like cilia and rhizines. These
characters are widely used in taxanomy at generic level (Divakar et al.,
2006).
Lichens are able to grow on various substrates in diverse climatic
conditions include rocks, soil, wood, branches, tree trunk, animal bones,
insects shells, plastic and building materials (Wolseley and Hudson, 1995;
Negi, 2003). On the basis of thallus morphology, lichens are divided into
three main forms viz., crustose (closely attached to substrate), foliose
(loosely attached to substratum by holdfast like rhizines and hapter), and
fruticose (attached to substratum by single hold fast) (Nayaka, 2007;
Kumar, 2010).
10
Lichens are also characterized on the variety of vegetative structures
i.e. on upper and lower surfaces of the thallus such as presence of finger
like projections (isidia), granular powder in groups (soredia), fine powder
(pruina), black dots (pycnidia) and whitish decorticated areas
(pseudocyphellae), presence or absence of rihizines (root like structures).
1.2.5 Chemistry
Lichen produces different metabolites viz., primary metabolites and
secondary metabolites. Primary metabolites included carbohydrate, lipid,
protein and other organic compounds. Secondary metabolites are in
amorphous and crystalline forms, produced by the fungus partner
(Mitrovic et al., 2011 a, b). Secondary metabolites are the compound of
relative low molecular weight, insoluble in water and usually extracted in
organic solvent. Lichens produce various types of secondary metabolites
that are unique to lichens. These compounds are produced by three major
metabolic pathways and have important role in chemotaxonomy of lichen
species (Wolseley and Hudson, 1995; Huneck, 1999). These secondary
metabolites are phenolic compound, usnic acid, quinins, depsidones,
deposones and pulvinic acid derivatives etc. Their amount ranges from 0.1
to 1% of the dry weight of the thallus and sometime reaches upto 30%
(Galun, 1988; Rankovic et al., 2011). These compounds protect lichens from
harmful irradiation and from microorganism, as source of minerals in
stress condition and increase cell wall permeability of algae (Huneck,
1999). Over 1050 lichen compounds have been isloted from differet lichen
species having important role in chemotaxonomy and systematic studies
of lichens (Molnar and Farkas, 2010).
1.2.6 DNA Barcoding
Identification of lichen on the basis of morphological and chemical
characterization is time consuming and also requires training and
11
experience for accurate identification. Furthermore, phenotypic basis of
identification of species in some case misrepresent the species diversity.
DNA barcode may be used as effective alternative tool to phenotype based
identification of species. This technique provides correct identity of the
specimens that lack morphological and chemical characters needed for
taxonomic identification (Begerow et al., 2010).
DNA barcoding uses specified DNA sequence for taxonomic
identification of specimen at cellular level (Blaxter et al., 2005). The usability
of DNA barcoding, as major tool for identification, largely depends on the
development of high quality sequence database, thoroughly curated by
taxonomist and systematists (Kelly et al., 2011). The molecular based
species identification has been shown to be highly effective in cases where
taxonomy is well studied and reference database has been generated. The
reference DNA barcoding of lichens is not avialble for for most taxa and
geographic regions of lichens. The application of DNA identification may
be particular important in case where user may not have access to expertise
or reference materials necessary to make accurate identification. Despite
the potential limitation and challenges to DNA based identification of
lichenized fungi, molecular sequence data will most likely play important
role in accelerating the inventory and analysis of species diversity in lichen
communities
1.2.7 Economic Importance
Lichens are economically very important and are used in many
industries, like cosmetic, perfume and as dyeing in textile industry (Negi
2003; Muggia et al., 2009). Their dye produces musky odour and giving
insect proofing quality to the fiber (Shukla et al., 2014). Due to shortage of
food, lichens are used as important source of food during winter seasons
(Redzic et al., 2010). In Yunnan Province (China) people use lichen as food
12
and health promoting tea (Wang et al., 2001). Compound from lichens, such
as pulvinic acid derivatives, contain relatively high nitrogen content,
making them a valuable source of food (Karunaratne et al., 2005). In
southern part of India local people use lichen as fodder for their livestock.
Lichen species with cynobacterial algae as primary symbiont extensively
contribute for forest nitrogen fixation (Slack, 1988). These lichens are also
used as green organic manure (Negi, 2003). Lichens are highly sensitive to
air pollution and therefore extensively used as tool to monitor level of
pollution in area (Negi, 2003; Shah, 2013). Lichens are important part of
traditional medicines and used for treatment of many human and animal
diseases (Mitrovic et al., 2011 a, b). In Asia, Europe and Africa species of
Usnea are used for fever control and pain relief while decoction of Usnea
barbata are used for the treatment of wound in South Africa (Okuyama et
al., 1995; Madamombe and Afolayan, 2003). Many lichen species have
reportedly shown antibacterial, antifungal and anticancer activities in-vitro
(Kosanic and Rankovic, 2010; Mitrovic et al., 2011 a, b).
1.2.8 Biological Activities
Secondary metabolites of lichens have remarkable antibacterial,
antiviral, antifungal, antioxidant and antitumor activities (Esimone and
Adikwu, 1999; Mitrovic et al., 2011 a, b). These bioactive compounds of
natural origin are different from synthetic drugs and have no side effects.
Various studies conducted in different parts of the world recorded the
biological activities of the lichens secondary compounds (Hara et al., 2011).
Due to their biological activity many Native American, Indian and
European use lichens in their traditional medicines for treatment of many
animals diseases (Karthikaidevi et al., 2009). Slow growth rate,
identification of species and collection of enough material are the problems
due to which little work have been done on biological activities of lichens
(Boustie and Grube, 2005).
13
1.2.8.1 Antibacterial Activity
Infectious diseases caused by bacteria remain a major threat to
public health, despite tremendous progress in human medicine (Kumar et
al., 2010). Lichens represent powerful source of bioactive compound but
pharmaceutical industries has given little attention to these because of
their slow growth. Lichen metabolites have manifold biological activity.
A few decades after the introduction of antibiotics in clinical practice,
resistance by pathogenic bacteria has become a major health concern
(Tabarez, 2004). According to wide screening of antimicrobial activities it
seem that bacterial inhibition can vary within lichen species, solvent
used and bacteria tested (Mitrovic et al., 2011 a, b).
1.2.8.2 Antifungal Activity
Fungi are ubiquitous in the environment, and infection due to
fungal pathogens has become common. In plants many pathogenic fungi
are main infectious agents responsible for alterations during
developmental stages including post-harvest (Ribera and Zuniga, 2012).
Many pathogenic fungi are responsible for causing infectious diseases,
both in human and animal (Shahi et al., 2012). Several antifungal agents can
be used to manage these infections (Blazekovic et al., 2011).
1.2.8.3 Plants Cell Carcinogenesis
Plant Cancer, a disease of uncontrolled growth and spread of
abnormal cells, is one of the main diseases caused by the bacterium
Agrobacterium. That disease can affect a wide range of plant including
woody ornamentals, tree fruits, and small fruits. Plant Cancer also
occasionally affects few herbaceous ornamentals and vegetable crops is one
of the most dangerous diseases for nursery production of these and many
other plants. In some previous studies secondary metabolites of many
lichen species were assessed against cancer cell in humans and animal.
14
Most of these secondary metabolites have reportedly shown anticancer
activity. (Rezanka et al., 2006; Trigiani et al., 2009; Nguyen et al., 2014)
1.3 Study Objectives
Lichen flora of Pakistan is little known and available literature
provides casually prepared checklists for some localities of Pakistan
(Hawksworth and Mahmood 1971; Shaheen and Iqbal, 1978; Aptroot and
Iqbal, 2011). In order to assess lichens resource of Pakistan detail
documentation is eminently required. The objectives of the present study
therefore include:
To explore the lichen diversity of District Mansehra
To study the distribution of lichen in study area
To test the potential species for antibacterial, antifungal, antioxidant
and anticarcinogenic activities
15
Chapter 2
REVIEW OF LITERATURE
2.1 Species Diversity and Distribution
Lichens grow on wide variety of natural and manmade substrates,
obtaining nutrients and water directly from the atmosphere. Lichens and
mosses are dominating component of terrestrial ecosystem but their study
is still neglected throughout the world. Linnaeus (1753) first published a
list of 80 lichen species in “Species Plantarum under 24th class of
cryptogamie-algae”. The extensive exploration of lichens flora in the 19th
and the 20th century from different parts of Asia, America and Africa
caught attention of lichenogisted.
Various studies recorded the occurrence of lichen species from
different parts of Africa. Almborn (1989) listed nine lichen species
distributed within genus Teloschists from central and southern parts of
Africa, of which four species were endemic to Africa. Similarly, a study
listed the occurrence of 27 lichen species from Gambia as new to the
country while Caloplaca gambiensis were reported as new to science.
Another study described 69 lichen species as new to Rwanda and Catillaria
alba, Chaenotheca stemonea and Parmotrema neotropicum listed as new to
Africa (Aptroot, 2001; Killmann and Fischer, 2005). Zedda et al. (2009) listed
37 taxa of epiphytic lichens from Savannh biome of Namibia, of which 24
species were recorded as new to Namibia while two species were new to
Africa.
The lichens diversity of Europe was explored through various
studies conducted in different parts of the continent. A study listed 262
lichen species from Swiss plateau and Pre-Alps area, of which 14 species
were reported as new to Switzerland (Dietrich and Scheidegger, 1997).
16
Anne (1998) described the occurrence of 170 lichen species belonging to
more than 70 genera from northeast Olympic and north Cascade regions.
Sipmaned and Raus (2002) reported 209 lichen species from Greece, of
which 12 species were new to Greece and four species were new to science.
Another study listed 232 epiphytic lichen species from Estonia natural
forest, of which 10 species were included in the list of Estonia red data
book (Jurido et al., 2003). Similarly, 170 lichen species were recorded from
islands in the Russian part of the Gulf of Finland (Alexeeva, 2005).
Blinkova and Urbanavichus (2005) listed 389 lichen species from Teberda
State Biosphere Reserve of the Great Caucasus mountain range, of which
three species viz., Aspicilia szechenyi, Bacidina delicate and Rhizocarpon
carpaticum were reported as new to Russia. Marmor et al. (2011) recorded
the distribution and diversity of 151 epiphytic lichen species from spruce
and pine trees in old coniferous forests of Estonia.
Like other parts of the world, lichen diversity in Asia was explored
and described through various studies in different regions. A study listed
the occurrence of 110 lichen species from Tibetan plateau, of which some
were recorded as new to the area. In another study 21 lichen species were
reported as new to Khorasan Province of Iran, of which two genera and
nine species were new to Iran (Obermayer, 2004; Moniri et al., 2005).
Studies on lichen flora of Turkey listed the occurrence and
distribution of lichen species from different localities of the country. An
inventory listed 215 lichen species and eight lichenicolous fungi distributed
within 63 genera from Erciyes mountain, of which six taxa were reported
for the first time from Turkey. Another study listed 73 species of saxicolous
and terricolous lichens distributed within 27 genera from Sirvan Mountain
Kayseri, of which 3 taxa were reported for the first time from Turkey.
Similarly, 161 lichen species were listed from Termesses National Park,
southern Turkey, of which Collema conlomeratum, Lecania inundata,
17
Leptogium furfuraceum, Peltigera monticola and Physconia servitii were
reported as new to Turkey (Halici et al., 2005; Halici and Aksoy, 2006;
Tufan et al., 2006).
Altitude is one of the main factors effecting the diversity and
distribution of epiphytic lichens. Various studies listed the occurrence and
distribution of epiphytic lichen species at different altitude ranges from
Turkey. A study described the occurrence of 24 species of epiphytic lichen
at 900-1400 m from Bursa. An inventory listed 52 epiphytic lichen species
growing on Cedrus libani trees at 1300-1900 m from Elmali research forest.
Occurrence of 48 epiphytic lichen species were reported, distributed at
1500-1900 m in Bursa (Cobanoglu and Sevgi, 2009; Ozturk et al., 2010;
Ozturk and Guvence, 2010).
Different studies were conducted to explore the lichen diversity
from different parts of North and South America. An inventory listed 288
foliicolous lichens species from Mexican lowland and montane rainforest,
of which 238 were reported for the first time from the study area, and some
6% of reported lichen species were recorded as new to the country (Herrera
et al., 2004).
Some other studies explored the occurrence and distribution of
lichen species from Greenland. An inventory described the occurrence of
117 lichen species from Uummannaq area, of which Aspicilia myrinii
recorded as new to Greenland. Similarly, another study listed 189 lichen
species from two localities of Nuussuag Peninsula. Another inventory
described 42 lichen species and two genera viz., Lepraria and Leprocaulon,
from Greenland (Hansen, 2007; Saag et al., 2007; Hansen, 2009).
Rosato (2006) described 33 lichen species growing on mortars and
concert from Buenos Aires Province, one species reported as new to
Argentina. Twenty one (21) species of epiphytic lichen, growing on tree
18
trunks were listed from rainforest of Gran Piedra, of which three were
recorded as new to Cuba (Rosabal et al., 2010). Quilhot et al. (2012)
described 319 lichen species belonging to 87 genera from oceanic to steppe
area of Aisen, southern Chile. Occurrence of 145 species of lichen were
recorded from Joshua Tree National Park, California, of which four were
reported for the first time to California and Sarlogyne mitziae as new record
to science (Knudsen et al., 2013). An inventory described 193 epiphytic
lichen species during investigation of epiphytic lichen diversity in riparian
forest of Brazil (Kaffer et al., 2016).
The documentation of lichens flora of South Sister, Northeastern
Tasmania, reported 234 lichen species from Tasmania, of which 16 were
reported for the first time from the area. Occurrence of 15 species of lichens
belonging to genus Peltigera were recorded from Papua New Guinea, of
which six were recorded as new to science (Kantvilas et al., 2008; Serusiaux
et al., 2009).
During pre-independence period European doctors, botanists and
other defense persons initiated lichens exploration in Indian Subcontinent.
Awasti (1965, 1988 and 1990) published catalogue consisting of 1,310
species belonging to 150 genera from India, Pakistan and Sri Lanka and
prepared keys of macro-lichens and micro-lichens of the area. Nayaka et al.
(2001) listed 99 lichen species, of which 74 species were corticolous, from
Meghamalai Wildlife Sanctuary, Tamil Nadu, India. Folicolous lichens are
special group of lichens that usually colonized leaves of trees. Folicolus
lichens are widely distributed in wet or moist, humid and foggy tropical
and subtropical forests (Pinokiyo and Singh, 2006; Singh et al., 2006). Some
studies on folicolous lichens of India described the occurrence of 21 species
of lichens genera Porina and 91 species of folicolous lichens from Arunachal
Pradesh, India (Pinokiyo et al., 2004), while two new species and two new
varieties were reported from Eastren India (Pinokiyo et al., 2008).
19
Rout et al. (2010) described 55 lichen species and 15 families from
Reserve forests of southern Assam, of which Graphidacea and
Pyrenulaceae were dominant families comprising more than 50% of the
total lichens population. Another study listed 48 lichen species, belonging
to 23 genera and 12 families, from Tamil Nadu, of which three genera viz.,
Heterdermia, Parmotrema and Pertusaria, dominated (Kumar et al., 2011).
Similarly, 111 lichen species belonging to 41 genera and 22 families were
recorded from Western Ghats, of which 101 species were corticolous.
Another study recorded six macrolichen species from Karnataka as new to
lichens flora of India (Vinayaka, 2011; Vinayaka et al., 2012).
Shetty et al. (2012) described 29 lichen species occurring on
mangrove plants from Andaman Islands, of which 14 were reported as
new to the study area and five species were recorded for the first time from
India. Similarly, 37 epiphytic lichen species belonging to 16 genera and 10
families were recorded on Areca catechu trees from pristine habitats in
southern Assam, of which Graphidacea was recorded as dominant family
representing 13 species followed by Trypetheliaceae comprising six species
(Rout et al., 2012).
The occurrence of 137 lichen species was reported from different
vegetations within Bolampatti II Forest range in Tamil Nadu, of which 58
lichen species were listed for the first time in the study area (Balaji and
Hareharan, 2013). Similarly, 106 lichen species were described from
Western Himalaya, while Parmeliacaea were reported as dominant in the
study area (Gupta et al., 2014). Rana et al. (2015) listed 22 species of
fruticose lichens belonging to four genera Usnea, Cladonia, Ramalina and
Teloschistes from Arunachal Pradesh, of which 10 species were reported as
new in the investigated area. Similarly, another survey listed 404 species of
lichens distributed within 105 genera and 39 families from Arunachal
Pradesh. During this investigation, 12 species were reported as new to
20
India (Singh et al., 2015). An inventory on lichens diversity listed a total 159
lichen species from Mizoram state, while 14 species were recorded for the
first time in India (Logesh et al., 2015).
Dey et al. (2015) described the occurrence of 31 lichen species
distributed within 16 genera and 11 families while Physciaceae was
recorded as dominate family consisting of 9 species followed by
Parmeliaceae family. Nine species of lichens belonging to six families were
reported as new to Uttarkhand (Gupta et al., 2016). A survey conducted by
Vinayaka et al. (2016) described 40 lichen species distributed within 18
genera and 15 families within an altitude range of 1100-1300 m in southern
Western Ghats. Mishra et al. (2016) listed the occurrence of 246 lichen
species distributed within 45 genera and 13 families from Uttarakhand,
India. Similarly, 28 lichen species belonging to 9 families were listed from
Madhya Pradesh, of which Physciaceae, Teloschistaceae and
Verrucariaceae were recorded as dominant families (Uppadhyay et al.,
2016).
A survey on lichen flora of Jammu and Kashmir listed 31 lichen
species distributed within 19 genera and 13 families for the first time in
Poonch. In another study, 279 lichen species comprising 79 genera and 33
families, of which Parmeliaceae and Physiaceae were reported as dominant
families and Xanthoria, Cladonia, Lecanora and Caloplaca were the genera
consisting of higher number of species (Khan et al., 2010; Haq et al., 2012).
Kumar et al. (2014 a) listed the occurrence of four lichens species within 12
genera and 10 families from Ladakh, of which Endocarpon pallidum were
reported as new record in the study area. Similarly, 44 species of lichens
were listed as new addition to lichen flora of Jammu and Kashmir, of
which corticolous lichens consisting of 25 species dominated the study area
(Goni and Sharma, 2015).
21
Various studies were conducted on exploration of lichens from
Nepal. Baral (2015), described the occurrence of 32 lichen species within 9
families and 10 genera from Phulchowki hills (Kathmandu Valley) in
which Parmeliaceaea family was recorded as dominant family consisting of
ten species. Another study conducted by Devkota (2008) listed the
occurrence of 13 lichen species distributed within four families from
Manaslu conservation area and 69 lichen species distributed within 15
families from Sagarmatha National Park, Nepal.
Similarly, explorations of lichens from Sri Lanka were also carried
out in different parts of the country. Nayanakantha and Gajameragedara
(2003) described the occurrence of 50 species distributed in 32 genera and
18 families from Kandy Municipal Region, Sri Lanka. In this study,
crustose were recorded as dominate growth form followed by foliose and
fruticose. Similarly, another study conducted by Silva and Senanayake
(2015) listed 19 epiphytic species from Peacock hill, Pussellawa, Sri Lanka,
of which 16 species were crustose and three species were foliose. Aptroot
and Feijen (2002) listed 287 lichens and lichenicolous fungi from Bhutan, of
which 225 species were reported as new to country.
So far, no prominant study on the diversity and distributom of lichen
species has been reported from Pakistan. A survey conducted by Aptroot
and Iqbal (2012) listed the occurrence of 368 lichen species from Pakistan.
2.2 Biological Activities of Lichens
In traditional medicines, many plant extracts having biologically
active compounds are used. These compounds in extracts are evaluated for
their biological activities through simple methods, like brine shrimp
lethality assay (Pisutthanan et al. 2004). Large numbers of antibiotics are
used in the treatment of bacterial infections, but due to their excessive use,
22
microorganism became resistance to these drugs. Investigation on natural
antibiotic can help us to fight antibiotic resistant bacteria.
Generally, most of explored lichens have relatively strong
antimicrobial activity which can be very important in treatment of various
disease caused by microorganism. Manojlovic et al. (2002) evaluated the
antimicrobial activity of lichen Caloplaca schaereri collected from Durmitor
Mountain, Yugoslavia. The crude extract and anthraquinones of tested
lichen were investigated against eight strains of bacteria and fungi. A study
to investigate the antimicrobial properties of the extracts of Usnea barbata
against fifteen different strains of fungi and bacteria, the acetone extract of
the investigated lichen specie was recorded to have stronger inhibitory
effect ranging from 51.60% to 100% on the growth of S. commune and A.
alternaria at 10 mg/mL (Madamombe and Afolayan, 2003). Another study
reported the antimicrobial activities of lichen Cetraria aculeate extracts in
various solvents against different strains of bacteria and fungi. The acetone
extract of the tested lichen showed highest activity against bacterial strains
(Turk et al., 2003). Halama and Haluwin (2004) evaluated antifungal
activity of lichen species Evernia prunastri, Cladonia portentosa and
Hypogymnia physodes against eight plant pathogenic fungi. The extracts of
E. prunastri and H. physodes showed strong effect on growth of P.
ultimum, U. maydis and P. infestans while the extract of Cladonia showed
less effect on growth of these fungi.
Balaji et al. (2006) conducted a study to on the antimicrobial
properties of lichen species Roccella montagnei. Extracts of this species in
different solvent were tested against six bacterial strains and one strain of
fungi. The extract prepared in methanol showed maximum effect (zone of
inhibition= 15-18 mm) on the growth of tested organism while no activity
was recorded for acetone extract. Candana et al. (2006) investigated
antimicrobial activity of Xanthoparmelia pokornyi against foodborne
23
bacterial strains. The extracts prepared in acetone, chloroform, diethyl
ether, ethanol and petroleum ether were recorded active against the tested
bacteria.
Karagoz et al. (2009) investigated the antimicrobial activity of
aqueous and ethanol extracts of lichen species against eight bacterial
strains. Both extracts of investigating lichen showed variable range of
antimicrobial activity against the tested bacteria (zone of inhibition= 7-16
mm). The aqueous extract of lichen species Peltigera polydactyla (zone of
inhibition= 14 mm) and ethanol extract of Ramalina farinacea, Rhizoplaca
melanophthalma (zone of inhibition= 16 mm) were shown strong effect on
growth of tested bacteria. The antibacterial activity of lichen species
Roccella belangeriana was evaluated against 12 different strains of bacteria.
The chloroform extract of the investigated lichens showed maximum (zone
of inhibition= 29 mm) effect on the growth of Enterococci while minimum
(zone of inhibition= 2 mm) activity were recorded for ethyl acetate extract
against Klebsiella pneumonia (Karthikaidevi et al., 2009). Rankovic et al.
(2009) evaluated the antimicrobial activity of acetone, methanol and
aqueous extract of five lichen species against different strain of bacteria and
fungi. The acetone and methanol extracts of three lichens; Hypogymnia
physodes, Parmelia pertusa and Umbilicaria polyphylla were reported active
and effect the growth of all tested organism.
Kumar et al. (2010) investigated the antibacterial activity of lichen
Collema auriforme collected from Tamil Nadu, India. Acetone and alcohol
extracts of the tested lichen species were evaluated against four bacterial
strains. The study recorded zone of inhibition within range of 15 – 22 mm
against E. coli, Staphylococcus sp. and Klebsiella. Similarly, another study
conducted by Cobanoglu et al. (2010) on the antimicrobial activity of five
lichen species against three bacterial strains by paper disc assay. The
extract prepared in acetone showed slightly stronger effect (zone of
24
inhibition= 10.30 mm) on the growth of tested bacteria than chloroform
(zone of inhibition= 10.20 mm). Similarly, another study recorded the
antibacterial activity of lichen specimens collected from Luzon Island,
Philippines. Extract of these specimen were evaluated against different
strain of gram positive and gram negative bacteria. The study recorded
that out of a total of 45 investigating extracts, only 38 extracts showed
strong effect on growth of Gram-positive bacteria (Santiago et al., 2010).
Baral and Maharjan (2011) investigated antimicrobial activities of lichen
species Usnea longifolia, Cetraria sp., Parmotrema reticulatum and
Evernastrium nepalense collected from Nepal. The extracts of investigating
lichens were evaluated against eight human pathogen and five plants
pathogenic. The study recorded that ethyl acetate extracts of E. nepalense
and U. longifolia showed strong effect on growth of tested bacteria and
fungi. Neeraj et al. (2011) recorded the antibacterial activity of seven
secondary metabolites isolated from three different species of lichen. The
extracts prepared in methanol, acetone, ethyl acetate and n-hexane solvent
were tested against 11 different strains of bacteria. The investigation
observed that ethyl acetate extract of lichen species in concentration of 10
µg/mL showed promised antibacterial activity. Another study conducted
by Rankovic et al. (2011) on the acetone extracts of three lichen species for
their antifungal, antibacterial and antioxidant properties. The study
recorded stronger effect on growth of tested bacteria and fungi for lichen
species Cladonia furcata while highest antioxidant activity was shown by the
extract of Lecanora atra. The antimicrobial activity of lichen Roccella
belangeriana collected from Gulf of Mannar, were tested against 14 bacterial
and 3 fungal strains. The study reported maximum antibacterial activity for
methanol extract against Vibrio cholera while stronger effects on fungal
growth were recorded for chloroform extract against Aspergillus niger (Devi
et al., 2011).
25
Sati and Joshi (2011) evaluated the antibacterial activity of
Himalayan lichen Parmotrema nilgherrense against five different strains of
bacteria. The chloroform extract of investigated lichen was reported active
against all tested bacteria followed by methanol and ethanol extracts. A
study was conducted by Sina and Biswas, (2011) to test the antibacterial
activity of five lichen species collected at altitude range of 2438 m from
Sikkim, India. The extracts of investigated lichens species were evaluated
against five different strains of bacteria and reported that all lichens
species show considerable effect on growth of tested bacteria. Maximum
activity was recorded for methanol extract while aqueous extract of all
evaluated lichens show no effect on growth of tested bacteria. Tiwari et al.
(2011a) evaluated the acetone, methanol and chloroform extracts of five
lichen species against various fungal strains. The study recorded that
acetone and methanol extracts have strong inhibitory effect on growth of
tested strains. Kekuda et al. (2012) conducted study on Antifungal and
cytotoxic activity of Everniastrum cirrhatum (fr) Hale. Highest mortality
of shrimps (100%) was observed in case of extract concentration 1,000
μg/mL.
Sharma et al. (2012) evaluated the antibacterial activity of five lichen
species collected from Darjeeling hills in Eastern Himalaya of India. The
extracts prepared in different solvents were tested against four bacterial
strains. Methanol extract of the studied lichen was shown maximum effect
on growth tested bacteria while a minimum growth effect was recorded
for aqueous extract. Vidyalakshmi and Kruthika (2012) evaluated the
potential effects of various extract of lichen Parmelia perlata against
bacterial strain causing wound infections. Their study recorded that
acetone, methanol and ethyl acetate extract of the investigated lichen
species had significant inhibitory effects against Staphylococcus aureus.
Shahi et al. (2012) investigated the antifungal activity of lichen Peltigera
26
practextata against different fungal strains causing infectious diseases. The
study recorded that extract effected the growth of tested fungal strains.
Rankovic et al. (2012) investigated the biological activities of two lichen
species Toninia candida and Usnea barbata and their norstictic and usnic
acid constituents. In this study, stronger antimicrobial activity was
recorded for usnic acid.
Idamokoro et al. (2013) in their study investigated the methanolic
and ethyle-acetate extracts of lichen Usnea barbata against 13 bacterial
strains of Staphylococcus species. Both lichen extracts were recorded active
and inhibited the growth (zone of inhibition= 10–34 mm) of most tested
bacteria. Aydin and Kinalioglu (2013) collected Flavoparmelia caperata and
Roccella phycopsis from Black Sea Region. The ethanol and methanol extract
of these species were evaluated against sixteen strains of gram positive
and gram negative bacteria by disc diffusion assay. The methanol extract
of Flavoparmelia caperata showed stronger effect on growth of Bacillus cereus
(zone of inhibition= 24.5 mm) while minimum activity was recorded for
ethanol extract of Roccella phycopsis against Bacillus megaterium (zone of
inhibition= 6 mm). Javeria et al. (2013) investigated antimicrobial activity
of lichen species Parmotrema nilgherrense against some drugs resistance
pathogen. The extracts within acetone, methanol, benzene and ethyl
acetate were tested against six stains of drugs resistance bacteria. The
study recorded that ethyl acetate extract of investigating lichen had
highest (100%) antibacterial activity against Pseudomonas aeruginosa.
Similarly, another study on antibacterial activity of some lichen species
was conducted by Srivastava et al. (2013) in India. The acetone, ethanol
and methanol extracts of investigating lichens were tested against six
pathogenic bacteria.
Dorszynska et al. (2014) recorded the mechanism of antibacterial
activity of lichen metabolite usnic acid against four different strains of
27
gram positive and gram negative bacteria. The tested extract of
investigated metabolite was found to inhibit the synthesis of RNA and
DNA in gram positive bacteria.
Basile et al. (2015) investigated the extract of lichen Xanthoria
pariethina and its metabolite parietin for their antibacterial and antifungal
activity. The extract and parietin from investigated lichen were recorded
having strong antibacterial activity against tested bacteria. Similarly,
another study conducted by Karabulut and Ozturk (2015) on antifungal
activity of three lichen species Evernia prunastri, Pseudoevernia furfuracea
var. furfuracea and Parmelia sulcata against plant pathogens. The extracts of
investigating lichen were reported having variations in level of inhibition
against tested organism. The study of Anjalli et al. (2015) recorded the
antimicrobial activity of lichen Parmotrema tinctorum against ten bacterial
and fungal strains in Eastern Ghats, India. The crude extract of
investigating lichens showed maximum zones of inhibition against
bacterial strains Escherichia coli (14.66 ± 0.57) and Bacillus subtilis (13.0 ±
2.99). Another study conducted by Prabhu and Sudha (2015) on
antibacterial activity of acetone, methanol, chloroform and petroleum ether
extracts of lichens against human pathogenic bacteria. All the investigated
extracts were recorded to have strong effects on the growth of all tested
microorganism.
Chahra et al. (2016) investigated the antibacterial activity of essential
oil isolated from two lichen species Evernia prunastri and Ramalina frinacea
against four different strains of bacteria. The investigated oil of lichen
showed moderate activity against gram positive while lethal activity was
reported against gram negative bacteria.
Antioxidants play an important role in prevention of human disease.
The methanol and aqueous extracts of three lichen species were
28
investigated by Odabasoglu et al. (2004) for their antioxidant properties.
Methanol extracts of lichen species Lobaria pulmonaria and Usnea longissima
were recorded having strong antioxidant activity. Luo et al. (2006)
investigated antioxidant activities of lichen Thamnolia vermicularis, collected
at altitude of 4500 m from Yunnan province, China. Methanol extract of
tested lichen were reported having higher free radical scavenging activity.
Mitrovic et al. (2011b) investigated lichen species Parmelia sulcata,
Flavoparmelia caperata, Evernia prunastri, Hypogymnia physodes and cladonia
faliacea for their antioxidant, antimicrobial and antiproliferative activities.
The study recorded that the extract of Hypogymnia physodes had stronger
DPPH radical scavenging effect. Similarly, another study by Hara et al.
(2011) evaluated the antioxidant activity of 85 lichen species. The study
recorded significant activities for species of Peltigera. Susithra et al. (2011)
isolated antioxidant compounds from lichen species Usnea undulata. An
effective radical scavenging activity by the extracts of SU-I was recorded at
80 µg/mL concentration. Kosanic and Rankovic (2011) prepared the
extracts of five lichen species in acetone, methanol and aqueous solvents.
Antioxidant activity was investigated by five different methods and strong
activity was recorded for all the tested extracts.
Aydin and Turkez (2011) collected four lichen species from Erzurum
and Artvin provinces, Turkey. The aqueous extracts of lichen Aspicilia
calcerea, Cetraria chlorophylla, Dermetacarpon intestiniforme and Physcia aipolia
were recorded to exhibited antioxidant activity. Melo et al. (2011) evaluated
the toxicological activity of atranorin isolated from Cladonia kalbii lichen
collected from northeastern Brazil which showed no significant acute
toxicity or cytotoxicity. Kusumaningrum et al. (2011) screened bioactive
compounds from the extract of Parmotrema tinctorum and toxicity was
recorded by brine shrimp toxicity assay. Di-chloromethane extract of tested
lichen in different concentration were recorded toxic to Artemia salina.
29
Ramamoorthy et al. (2012) evaluated the extract of Everniastrum
cirrhatum in different concentration to record their cytotoxic effect. The
investigated extract in concentration of 1000 μg/mL showed
highest mortality rate (100%). Paudel et al. (2012) evaluated cytoxcity of 24
lichen species collected from Nepal. The toxicity of the investigated lichen
in methanol was evaluated through brine shrimp lethality assay. The
methanol extracts of Ramalina sp and Heterodermia sp. showed toxic effect
comparable with standard berberine chloride. Manojlovic et al. (2012)
investigated the methanol, chloroform and petrol ether extracts of lichen
Toninia candida for their antioxidant activities, both extracts showed strong
activities. Sharma and Kalikotay (2012) collected two lichen species,
Parmotrema reticulatum and Usnea sp. from Darjeeling hills, India. Both of
investigated lichen species showed significant antioxidant activity while
31% free radical scavenging activity was recorded for the extract of lichen
Parmotrema reticulatum.
Kosanic et al. (2013a) investigated the antioxidant, anticancer and
antimicrobial activities of some selected lichens from Serbian region. The
extract of lichen Parmelopsis ambigua was recorded having highest free
radical scavenging activity.
Ravaglia et al. (2014) collected six lichen species from Brazil and
Antarctica to investigate the toxicity and antioxidant activities. The study
reported that crude extracts of S. alpinum, P. mesotropum and P. cetratum
showed most toxic effect against A. salina. Similarly, another study
conducted by Jesus et al. (2016) on antioxidant, cytotoxic and antimicrobial
activities of three lichens collected from Quezon, Philippines. The acetone
extract of lichens Canoparmelia aptata, Parmotrema gardneri and Parmotrema
sp. were recorded for low radical scavenging activity.
30
Lichen contain unique chemical compounds, some of these are
already reported to be effective against various cancer (Backorova et al.,
2011; Mahamuni et al., 2012). A study was conducted by Rankovic et al.
(2011) to investigate the extracts of three lichen Cladonia furcate, Lecanora
atra and L. muralis for their anticancer, antioxidant and antimicrobial
activities. The methanol extracts of all tested was recorded having strong
anticancer effect.
Kosanic et al. (2012) investigated three species of Parmelia for their
anticancer, antioxidant and antimicrobial activities. One of tested lichen, P.
saxatiles showed highest antioxidant activity while extract of all lichen
species were recorded having strong anticancer activity.
Kosanic et al. (2013 b) investigated acetone extracts of two lichen
species Evernia prunastri and Pseudoevernia furfuraceae and some of their
metabolites for their anticancer, antimicrobial and antioxidant activities.
The study recorded that investigated lichen species have significant
cytotoxic effect on cancer cell.
Grujicic et al. (2014) and Rankovic et al. (2014) evaluated the extracts
of lichen Cetraria islandica and Stereocaulon passchale, respectively. The
genotoxic, antioxidant, anticancer and antimicrobial potentials of the
extracts were evaluated and strong anticancer activities in the methanolic
extracts were observed. Kumar et al. (2014 b) collected fourteen species of
saxicolous lichen from Ladakh. The methanol extracts of two species L.
alphoplaca and M. disjuncta were recorded for strong cytotoxic effect against
the growth of cancer cell. Nguyen et al. (2014) investigated the cytotoxic
effects of 17 species of lichens against human cancer cells. One lichen
Flavocetraria cucullata among these tested lichen species was recorded to
exhibited strong cytotoxic effect against several cancer cells. Similarly,
Kasimogullari et al. (2014) investigated the anticancer activity of lichen
31
Usnea filipendula by evaluation of cytotoxic effect of the lichen extract
against breast cancer cell.
Emsen et al. (2015) investigatied antitumor activity of different
lichens compound isolated from two lichen species Pseudoevernia furfuraceae
and Rhizoplaca melanopthalma. The study reported positive activity in
investigated lichen metabolites.
32
Chapter 3
MATERIALS AND METHODS
3.1 Field Survey
For the collection of lichen specimens and field observation, regular
field visits were conducted in Mansehra District on monthly basis between
October 2012 and July 2015. Lichen specimens were collected from
different altitudes and from various substrates or habitats/micro habitats.
Field collected lichen samples were carefully collected alongwith some part
of substrate (part of rock in rock dwelling, part of twig/bark in epiphytic
lichens) and placed in separate papers bags, alloted a separate collection
number and recorded attributes of the taxa; habitat/ substrate and altitude
as field notes. Habitat /substrate and altitude of each collected specimen
were recorded as field notes.
Samples were dried under normal room temperature by changing
the papers at suitable intervals (1-3 days). The dried specimens along with
their substrate were mounted on a cardboard paper (4x6) and covered with
thick brown packets. The basic data related to each specimen was typed
and pasted on each specimen packets (Butler, 1950).
3.2 Characterization
All specimens were studied in the laboratory for morphological,
anatomical, chemical and molecular (DNA barcoding) characterization.
3.2.1 Morphological Characters
Morphological characters (upper and lower surface) of the lichen
specimen were examined under dissection microscope (make,
magnification: e.g. Olympus, 40X). The colour of thallus, texture, presence
or absence of apothecia or other vegetative structures such as isidia,
33
soredia, pruina and pseudocyphellae were noted. In case of foliose lichen,
branching pattern, length/ width of lobes, and presence/ absence of cilia
were recorded. For fruticose lichen length of thallus and branching pattern
were recorded. Morphology of lower surface, like colour and
presence/absence of rihizines (colour, branching and distribution) was
recorded.
3.2.2 Anatomical Characters
A thin section of apothecia was prepared by sharp blade and was
mounted in distilled water and examined under microscope (40x, 100x).
Colour of epihymenium, hymenium, hypothecium, asci; ascospore shape/
numbers/ ascus and ascospore size were recorded in notebook for proper
further documentation.
3.2.3 Chemical Characters
The chemical studies of collected lichen specimens were carried out
by spot tests and thin layer chromatography by following Culberson and
Kristinsson (1970) and Culberson (1972).
3.2.3.1 Spot Tests
Spot test or chemical colour tests were carried out by direct
application of different reagents for different tests (K-test: 10-25% aqueous
solution of potassium hydroxide; C-test: freshly prepared aqueous solution
of bleaching powder or calcium hypochloride; KC-test: K solution applied
on thallus immediately flowed by C solution; Pd-test: paraphenylene-
diamine in ethanol used the same day) on the lichen thallus and apothecia
under microscope and each specimen categorized as test positive or
negative (Orange et al., 2001; Vinayaka, 2011).
34
3.2.3.2 Thin Layer Chromatography
Thin layer chromatography (TLC) was used for identification of
lichen compounds and lichen species identified with the help of tables
(Culberson and Kristinsson, 1970; Culberson, 1972; Orange et al., 2001; Elix
2014); using Parmelia sulcata as reference material.
3.2.3.2.1 Extraction of Lichen Substance
Lichen substances were extracted by taking small fragment of lichen
thallus (specimens and reference material) in small test tubes to which 2-4
drops of acetone were added and tubes left for 30 min at room
temperature.
3.2.3.2.2 Preparation of Solvent Mixtures
Lichen substances were separated in three different organic solvent
systems i.e., Solvent mixture A {toluene 180 mL, 1,4 dioxan 45 mL, glacial
acetic acid 5 mL), solvent B (cyclohexane 117 mL, tert-butyl methyl ether 90
mL, formic acid 18 mL) and solvent C (toluene 85 mL, glacial acetic acid 15
mL). TLC plates that were used in solvents B and solvent System C were
first treated with pre B (distilled water 38 mL, formic acid 60 mL) and pre
C (distilled water 50 mL, glacial acetic acid 50 mL) solvents for 5 and 10
min respectively in horizontal pre B and pre C chambers.
3.2.3.2.3 Load TLC Plates
Eight acetone lichen extracts and a reference sample were applied to
on each TLC plates using capillary.
First pre-chamber was used before putting the TLC plates in
chamber B and C. The pre-chambered were filled with 4 mL of the relevent
solvent. TLC plate B kept in pre-chambered B for 5 min and in TLC plate C
sin in pre-chamber C for 10 min. Then 12 mL of solvent mixtures (A, B and
35
C) was loaded with the help of pipette in middle of the chambers (A, B and
C) and closed the chambers with big glass for 5 min. TLC plates were run
in chambers A, B and C and in 20-30 min solvent almost reached the end of
TLC the plates.
3.2.3.2.4 View of the TLC Plates under UV Light
TLC plates were then studied under UV light at two different wave
lengths. Under 365 nm wavelengths, all visible dots were marked as dotted
line with soft pencil and colour were recorded on top right-hand of the
spot. Then TLC plates were visualized at 254 nm UV light and bordered
additional appearing spot with continuous line.
3.2.3.2.5 Spraying with Dilute Sulfuric Acid and Baking on Heating Plate
To visualize lichen substance, dilute sulfuric acid (10%) was sprayed
on plates and marked the spot which have not turned into a wet grey and
remained white. Then plats were heated at 120 ºC for 5 min until strongly
coloured dot are visible.
3.2.3.2.6 View of TLC Plates under UV Light
Under 365 nm UV light, newly appearing spot were marked with
central, X, and colour (new/changed) were labeled on lower right side of
the dots.
3.2.4 DNA Barcoding
3.2.4.1 Genomic DNA Extraction
A small fragment of fungal tissue was grinded in liquid nitrogen to
a fine powder using a mortar and pestle. The tissue powder and liquid
nitrogen were transfered to an appropriately sized tube and allowed the
liquid nitrogen to evaporate. Then added 400 μL of Buffer AP1 and 4 μL of
RNase to the sample, vortexed vigorously and incubated the mixture for 10
36
min at 65 °C and the samples was mixed by inverting the tube 2-3 times. To
precipitate detergent, proteins and polysaccharides, 130 μL of buffer AP2
was added to the lysate, mixed and incubated for 5 min on ice. Then lysate
was centrifuged for 5 min at 14000 rpm. After that the lysate was pipette
into QIA shredder mini spin column in a 2 mL collection tubes and then
centrifuged for 2 min at 14000 rpm. Then added 1.5 volumes of buffer
AP3/E to the lysate and mixed by pipetting. 650 µm of mixture were
pipette from the lysate into the DNeasy mini spin column placed in a 2 mL
collection tube, centrifuged at 8000 rpm for 1 min and discarded the flow
through. The collection tubes were reused for remaining sample by
repeating the step. Then DNeasy column were placed in a new 2 mL
collection tube and added 500 μL of Buffer AW. The flow-through was
discarded after centrfigutaion at 8000 rpm for 1 min and added 500 μL
more buffer AW to the DNeasy column and again centrifuged for 2 min at
maximum speed to dry the membrane. Then DNeasy column were transfer
to 1.5 mL microcentrifuge tube and pipette 50 μL of preheated (65 °C)
Buffer AE directly onto the DNeasy membrane. Incubated the tubes for 5
min at room temperature and then centrifuged for 1 min at 8000 rpm to
elute the genomic DNA.
3.2.4.2 Gel Electrophoresis
The extracted DNA was confirmed by gel electrophoresis and for
this purpose 1% agarose gel was used. Stock solution of 5X TBE buffer (tris-
base 44.5 mM, boric acid 44.5 mM, EDTA 1mM) was prepared and then 1g
agarose was dissolved in 100 mL of 0.5X Tris-Borate EDTA buffer diluted
from stock solution. This solution was heated in oven until it started
boiling and agarose powder was completely dissolved and then cooled at
room temperature. In the next step, ethidium bromide (8 µL of 10 mg/mL;
Serva Electrophoresis, Germany) was added to the agarose gel as staining
dye. After cooling to about 50-55 °C, the gel was poured into gel casting
37
tray having already inserted comb into it and then solidified at room
temperature. When the gel completely solidified, comb was removed and
then loaded the gel into gel tank containing 0.5X TBE buffer. Each extracted
DNA sample (5 µL) was mixed with 3 µL of 6X loading dye (bromophenol
blue 0.25%, glycerol 30%, cyanol 0.25%) and loaded into wells of agarose
gel. Horizontal electrophoresis apparatus (Labnet International, Inc. USA)
at 110 volts were used for running the gel. After 35-40 min the band of
DNA were visualized under UV trans-illuminator using Gel
Documentation System (Alpha Innotech, Taiwan).
3.2.4.3 Polymerase Chain Reaction (PCR)
The PCR was performed to amplify the Internal Transcribed Spacer
(ITS) regions of fungal ribosomal DNA (rDNA).
3.2.4.3.1 Primer Selection
The ITS region has been used extensively in the study of lichenized
fungi. This gene was amplified with the specific pair of fungal‐ specific
primers (Tabl 3.1).
Table 3.1: List of Primer used for PCR Amplification.
Primer Name
Primer Sequence (5-3) Ta
(°C) Refferences
ITS 1F CTTGGTCATTTAGAGGAAGTAA 55 Gardes and Bruns, 1993;
White et al., 1990 ITS4 TCCTCCGCTTATTGATATGC 53
3.2.4.3.2 Primers Dilution
Stock solution of lyophilized form of primers was prepared by
adding appropriate amount of deionized (double distilled) water (Serva
Electrophoresis, Germany) according the manufacturer’s protocols. The
38
primers were thoroughly mixed by shaking the tubes and giving short
spin.
3.2.4.3.3 Reaction Mixture
In PCR reaction 0.2 mL hinged tube with cap PuReTaq Ready-To-Go
PCR Beads (GE Healthcare Life Sciences, UK) were used. To obtain a final
volume of 25 µL, addeded 1 µL of each forward and reverse primers, 18 µL
deionized water (Serva Electrophoresis, Germany) and 5µL of DNA sample
in PCR tube.
3.2.4.3.4 Amplification Process
The amplification process was completed in 35 cycles of
denaturation, annealing and extension step. Thermoprofile of whole
amplification process has been shown in Table 3.2.
Table 3.2: Thermoprofile of PCR reaction, showing each step with number of cycles and corresponding temperature for each step.
Cycle condition Stages Temperature
(°C) Time No of Cycle
Initial Denaturation
1 94 1 min 1
Denaturation
2
94 1 min
35 Anealing 51 1 min
Extension 72 1 min
Final Extension 3 72 8 min 1
Final Hold 4
3.2.4.3.5 Analysis of PCR Product
Gel electrophoresis was used to analyze the PCR product by
staining with 10 µL ethidium bromide and running it on agarose (1.5%) gel.
DNA ladder (4 µL) was run with PCR product for comparison of size on
39
agarose gel at 110 volts for 45 min in gel electroporation chamber. The gel
was then analyzed under UV florescence in gel documentation system.
3.2.4.3.6 Extraction of PCR Products
QIAquick gel extraction kit was used for extraction of PCR product
in the following steps; in first step DNA fragment from agarose gel were
excised by sharp and clean scalpel and gel slice was weighed in colourless
tube and then added 3 volume of QG buffer to 1 volume of gel. The tube
was then incubated for 10 min or until the gel has completely dissolved at
50 °C. After that added isopropanol in same quantity as gel and mixed
thoroughly. To bind DNA, the sample was applied to QIAquik column and
centrifuged for min at 8000 rpm. Then the flow through was discarded and
QIAquik column was placed back into same collecting tube. QG buffer (0.5
mL) was added to the column and centrifuged for 1 min at 8000 rpm. For
washing of QIAquik column, added 0.75 mL of PE buffer and centrifuged
for 1 min at 8000 rpm, discarded the flow through and again centrifuged
for 1 min. To elute DNA, QIAquik column was placed in a clean 1.5 mL
micro centrifuge tube and added 50 µL of EB buffer in the center of
QIAquik membrane and then centrifuged for 1 min.
3.2.4.3.7 Squencing of PCR Products
The PCR products were sequenced in Bik-F Labortry Frankfurt,
Germany. The sequence was then aligned using NCBI’s BLAST at
http://www.ncbinlmnih.gov/ and compared with other lichenized fungi
sequence in the nucleotide database in order to find out the similarity and
differences with lichens.
3.3 Identification and Documentation
Each lichen specimen was identified using keys /diagnostic
charactersfollowing Flora of India, Flora of Turkey, Flora of China, Flora of
40
Iran, Flora of Australia and Flora of Great Sonoran Desert, and dodtful
cases confirmed by international experts in relevant families.
3.4 Distribution Pattern Studies
Distribution pattern (s) of the particular taxa was analyzed in
relevance to habitat/substrate, altitude, number of localities, and
distribution for proper mapping GPS coordinates obtained during field
surveys were arranged using Microsoft Excel and and GPS coordinates of
each species were plotted using Arc GIS software (Esri). A separate map
was developed for each family. Different taxa were arranged on the basis
of substrate and growth form.
Voucher specimens were deposited in Hazara University Herbarium
(HUP), Hazara University.
3.5 Biological Activities
Biological activities like antibacterial, antifungal, antioxidant,
anticancer and cyototoxicty of ten selected lichens were studied at
Bioresource Reserarch Center (BRC), Islamabad (Pakistan).
3.5.1 Preparation of Lichen Extracts
The lichen extracts were prepared in conical flasks using solvents
acetone and methanol. The weighed quantity (10 g) of lichen thallus
powder was homogenized with 50 mL of respective solvents. The top of
conical flasks was covered by aluminum foil and kept in orbital shaker for
3-4 days at room temperature. The supernatant, containing the lichen
extract was filtered through Whattman filter paper No. 1 and the extract
obtained by evaporating the solvent at room temperture. The crude extract
was weighed and dissolved in a known volume of DMSO to obtain final
concentrations (0.05 mg/mL, 0.01 mg/mL, and 0.001 mg/mL).
41
3.5.1.1 Antimicrobial Assays
Six bacterial strains, Escherichia coli (ATCC_39111), Enterococcus
faecalis (ATCC-19433), Bacillus subtilis (ACTT 6633), Pseudomonas aeroginosa,
(ATCC_10145), S. aureus (ATCC_33591), S. epidermidis (ATCC -700587) and
four fungal strains Aspergillus niger (ATCC_16888), A. fumigatus
(ATCC_16424), Fusarium solani (ATCC_46492) and F. oxysporium
(ATCC_10913), were used in antimicrobial assays. For each tests 24 hour
old culture were used.
Antimicrobial activities of the lichen extracts were tested by disc
diffusion assay. For this purpose Muller Hinton agar (for bacteria) and
Sabourad dextrose agar (for fungi) were seeded with appropriate
inoculums. Paper discs (6 mm diameter) were impregnated with different
concentrations of lichen extract and placed on organism seeded petri dish.
Blank disc was impregnated with dimethyl sulphoxide (DMSO) and used
as negative control while roxithromycin (for bacteria) and ketoconazole
(for fungi) were used as positive controls. The petri dish were incubated for
24 hour at 37 ℃ and for 48 hour at 35 ℃ for bacteria and fungi, respectively
and the zones of inhibition around each disc were measured
(Karthikaidevic et al., 2009; Cobanoglu et al., 2010; Kumar et al., 2010; Sati
and Joshi, 2011;Tiwari et al., 2011 a.b; Sharma et al., 2012; Prabhu and
Sudha, 2015).
3.5.1.2 Cytotoxicity Assay
Cytotoxicity of lichen extracts were tested by Brine shrimp
cytotoxicity assay, most widely used tool for detection of bioactive
compound. A container filled with Brine solution was used for hatching of
Brine shrimps eggs. Brine solution was prepared by dissolving 32 g of sea
salt and 1.5% agar in distilled water. Ten shrimps were transferred to each
tube containing brine solution (4.5 mL/tube) and different concentration of
42
lichen extracts prepared in acetone and methanol (0.05 mg/mL,
0.01mg/mL and 0.001mg/mL). After 24 hour of incubation the number of
surviving shrimps was counted by magnifying glass. The lethal
concentrations (LC50) were calculated by plotting percentage of shrimp
killed against the logarithm of sample concentrations (Pisuthanan et al.,
2004; Paudel et al., 2012; Thadhani et al., 2012).
3.5.1.3 Anticarcinogenic Activity on Plants
Potatoes taken from local market were surface sterilized with 20%
bleach solution. The experiments were performed in two groups, extract of
lichen species and positive control. Stock solution of 0.05 mg/mL in DMSO
was further diluted with sterilized water to achieve 0.01mg/mL and
0.001mg/mL concentration. Same concentration of positive control
(Vincrystien) was also prepared. Potato disc were made by cork borer and
placed on 2% agar petri dish (6 disc/ petri dish). Agrobacterium tumefacien
(PTA-5577) culture of 48 hours was transfered on the surface of each potato
disc (50 µL). Same concentration (0.05 mg/mL, 0.01 mg/mL and 0.001
mg/mL) of the lichen extract and positive control were applied to each
disc. The discs were then stained with lugol’s solutions (10% KI, 50% I)
after 21 days of incubation at 28 ̊C. Number of tumors were counted under
dissecting microscope and magnifying glass. Percentage inhibition was
counted by following formula.
Percentage inhibition: 100 – No of tumor per sample
Number of tumor per control x 1000
3.5.1.4 Antioxidant Assay
DPPH radical scavenging assays were used to investigate
antioxidant activity of lichen extracts. DPPH solution was prepared by
dissolving 24 mg of DPPH in 100 mL of methanol. Stock solutions of lichen
samples having concentrations of 1 mg/mL were prepared in methanol
and then diluted to the concentrations of 500 μg/mL, 250 μg/mL, 125
43
μg/mL. Diluted solutions of each concentration were mixed with 3 mL of
DPPH solution in methanol. The solutions were incubated for 30 min at
23°C and then the absorbance was measured at 517 nm. For positive
control ascorbic acid was used. Each concentration was taken in triplicate
(Rankovic et al., 2014).
The percent radical scavenging activity was calculated using the following
equation:
Percent scavenging effect: Control absorbance−Sample absorbance
Control absorbance x 1000
44
Chapter 4
RESULTS
4.1 Lichen Biodiversity
We identified 110 lichen species, belonging to 27 families and 56 genera
(Table 4.1 and 4.2). Parmeliaceae was recorded as dominant family
consisting of 12 genera, followed by Physciaceae (7 genera), Verrucariaceae
(4 genera), Lecanoraceae, Ramalinaceae and Teloschistaceae (3 genera
each), Candelariaceae, Collemataceae and Megasporaceae (2 genera each).
The remaining families; Acarosporaceae, Arthoniaceae, Arthopyreniaceae,
Catillariaceae, Cladoniaceae, Graphidaceae, Hymeneliaceae, Lecidaceae,
Mycoblastaceae, Nephromataceae, Peltigeraceae, Peltulaceae,
Pertusariaceae, Psoraceae, Rhizocarpaceae, Stereocaulaceae,
Thelotremataceae, Trapeliaceae and Umbilicariaceae were represented by a
single genus (Table 4.3). The maximum number of species was recorded for
Parmeliaceae (17 species) followed by Lecanoraceae (15 species),
Physciaceae (13 species), Teloschistaceae and Collemataceae (7 species
each), Candelariaceae (6 species), Cladoniaceae and Megasporaceae (5
species each), Verrucariaceae (4 species), Acarosporaceae, Peltigeraceae,
Ramalinaceae, Rhizocarpaceae and Thelotremataceae (3 species each),
Arthopyreniaceae, Graphidaceae and Hymeneliaceae (2 species each) and
Arthoniaceae, Catillariaceae, Lecidaceae, Nephromataceae, Peltulaceae,
Pertusariaceae, Psoraceae, Stereocaulaceae, Trapeliaceae and
Umbilicariaceae having single species (Table 4.4).
45
Table 4.1. List of lichen species from District Mansehra, Pakistan.
Sr. No.
Species Specimen Collection No. Families Growth Form
Substrate Host
1 Acarospora heufleriana Korb., HUP 15,199, 289 Acarosporaceae Crustose Saxicolous Rock
2 Acarospora impressula Th. Fr HUP 71, 236, 294, 327, 758 Acarosporaceae Crustose Saxicolous Rock
3 Acarospora veronensis A. Massal., HUP 396, 465, 505, 556 Acarosporaceae Crustose Saxicolous Rock
4 Amandinea punctata (Hoffm.) Coppins & Scheid
HUP 389, 489, 684 Physciaceae Crustose Corticolous Bark
5 Anaptychia crinalis (Schaer.) Veˇzda HUP 467, 689, 737 Physciaceae Foliose Corticolous Bark
6 Anaptychia runcinata (With.) J.R. Laundon
HUP 48 Physciaceae Foliose Saxicolous Rock
7 Arthonia radiata (Pers.) Ach HUP 104, 352, 701 Arthoniaceae Crustose Corticolous Bark
8 Arthopyrenia cinereopruinosa (Schaerer) A. Massal.
HUP 130, 765 Arthopyreniaceae Crustose Corticolous Bark
9 Arthopyrenia punctiformis (Pers.) A. Massal.,
HUP 373 Arthopyreniaceae Crustose Corticolous Bark
10 Aspicilia cinerea (L.) Korber HUP 110, 433, 504, 527 Megasporaceae Crustose Saxicolous Rock
11 Aspicilia desertorum (Krempelh.) Mereschk
HUP 05, 108, 225, 283, 326 Megasporaceae Crustose Saxicolous Rock
46
12 Bacidia laurocerasi (Delise ex Duby) Zahlbr
HUP 13, 673 Ramalinaceae Crustose Corticolous Bark
13 Bacidia rosella (Pers.) De Not. HUP 22, 143, 296, 674 Ramalinaceae Crustose Corticolous Bark
14 Bacidia rubella (Hoffm.) A. Massal. HUP77, 258, 361, 708 Ramalinaceae Crustose Corticolous Bark
15 Buellia stellulata (Taylor) Mudd HUP 19 Physciaceae Crustose Saxicolous Rock
16 Caloplaca cirrochroa (Ach.) Th. Fr. HUP 85 Teloschistaceae Crustose Saxicolous Rock
17 Caloplaca decipiens (Arnold) Blomb. & Forss.
HUP 498, 530 Teloschistaceae Crustose Saxicolous Rock
18 Caloplaca teicholyta (Ach.) J. Steiner HUP 595 Teloschistaceae Crustose Saxicolous Rock
19 Candelaria concolor (Dicks) B. Stein., HUP 36, 135, 354, 474, 665 Candelariaceae Foliose Corticolous Bark
20 Candelariella aurella (Hoffm.) Zahlber., HUP 402, 446, 525, 583 Candelariaceae Crustose Saxicolous Rock
21 Candelariella efflorescens R.C. Harris & W.R. Buck,
HUP 133, 355, 442, 644, 707 Candelariaceae Crustose Corticolous Bark
22 Candelariella reflexa (Nyl.) Lettau, HUP 138, 178, 229, 439 Candelariaceae Crustose Corticolous Bark
23 Candelariella vitellina (Hoffim.) Mull. Arg.,
HUP 480, 507, 526, 580 Candelariaceae Crustose Saxicolous Rock
24 Candelariella xanthostigma (Ach.) Lettau,
HUP 444, 696 Candelariaceae Crustose Corticolous Bark
47
25 Canoparmelia texana (Tuck.) Elix & Hale HUP 382, 457, 675, 718 Parmeliaceae Foliose Corticolous Bark
26 Catapyrenium cinereum (Pers.) Korber HUP 31 Verrucariaceae Squamulose Tericolous Soil
27 Catillaria lenticularis (Ach.) Th. Fr., HUP 76, 206 Catillariaceae Crustose Saxicolous Rock
28 Cladonia caespiticia (Pers.) Florke HUP 74, 358, 448, 553 Cladoniaceae Fruticose Tericolous Soil
29 Cladonia fimbriata (L.) Fr., HUP 10, 450, 551, 585 Cladoniaceae Fruticose Corticolous Wood
30 Cladonia floerkeana (Fr.) Florke HUP 79, 375, 478, 588, 714 Cladoniaceae Fruticose Tericolous Soil
31 Cladonia pocillum (Ach.) Grognot, HUP 84, 495, 546, 587 Cladoniaceae Fruticose Tericolous Soil
32 Cladonia pyxidata (L.) Hoffm. HUP 29, 58, 360,540, 650 Cladoniaceae Fruticose Tericolous Soil
33 Collema flaccidum (Ach.) Ach HUP 356, 370, 440, 700 Collemataceae Foliose Corticolous Bark
34 Collema furfuraceum (Arnold) Du Rietz, HUP 351, 379, 451, 661, 702 Collemataceae Foliose Corticolous Bark
35 Collema subflaccidum Degel., HUP 21, 98, 221, 329, 441 Collemataceae Foliose Corticolous Bark
36 Dermatocarpon miniatum (L.) W. Mann HUP 01, 99, 403, 515 Verrucariaceae Foliose Saxicolous Rock
37 Diploschistes diacapsis (Ach.) Lumbsch HUP 73, 404 Thelotremataceae Crustose Tericolous Soil
48
38 Diploschistes muscorum (Scop.) R. Sant. HUP 07, 155, 223 Thelotremataceae Crustose Tericolous Soil
39 Diploschistes scruposus (Schreber) Norman
HUP 139, 475, 502, 601 Thelotremataceae Crustose Saxicolous Rock
40 Endocarpon pusillum Hedwig HUP 40 Verrucariaceae Squamulose Tericolous Soil
41 Flavoparmelia caperata (L.) Hale HUP 38, 458, 586, 677 Parmeliaceae Foliose Corticolous Bark
42 Flavopunctelia flaventior (Stirton) Hale HUP 80, 141, 487 Parmeliaceae Foliose Saxicolous Rock
43 Flavopunctelia soredica (Nyl.) Hale HUP 301, 384, 476, 668 Parmeliaceae Foliose Corticolous Bark
44 Graphis elegans (Borrer ex Sm.) Ach. HUP 453 Graphidaceae Crustose Corticolous Bark
45 Graphis scripta (L.) Ach. HUP 443, 705 Graphidaceae Crustose Corticolous Bark
46 Heterodermia japonica (Sato) Swinscow & Krog
HUP 390, 407, 490, 685 Physciaceae Foliose Corticolous Trunk
47 Heterodermia obscurata (Nyl.) Trevisan HUP467, 707 Physciaceae Foliose Corticolous Trunk
48 Hypogymnia tubulosa (Schaerer) Hav. HUP 142, 331, 459, 645 Parmeliaceae Foliose Corticolous Bark
49 Lasallia papulosa (Ach.) Llano HUP 06 Umbilicariaceae Foliose Saxicolous Rock
50 Lecania cyrtella (Ach.) Th. Fr. HUP 653, 742 Ramalinaceae Crustose Corticolous Bark
49
51 Lecania naegelii (Hepp) Diederich & v. d. Boom
HUP 746 Ramalinaceae Crustose Corticolous Bark
52 Lecanora albella (Pers.) Ach. HUP 179, 449, 667 Lecanoraceae Crustose Corticolous Bark
53 Lecanora allophana Nyl. HUP 97, 180, 377, 481, 669 Lecanoraceae Crustose Corticolous Bark
54 Lecanora argentata (Ach.) Malme HUP 378, 455, 752 Lecanoraceae Crustose Corticolous Bark
55 Lecanora cenisia Ach. HUP 37, 106, 231, 281 Lecanoraceae Crustose Saxicolous Rock
56 Lecanora chlarotera Nyl. HUP 380, 497, 626, 674 Lecanoraceae Crustose Corticolous Bark
57 Lecanora dispersa (Pers.) Sommerf. HUP 295, 350 Lecanoraceae Crustose Saxicolous Rock
58 Lecanora polytropa (Hoffm.) Rabenh. HUP 23, 256, 405, 501, 591 Lecanoraceae Crustose Saxicolous Rock
59 Lecanora pseudistera Nyl. HUP 11, 140, 257 Lecanoraceae Crustose Saxicolous Rock
60 Lecanora pulicaris (Pers.) Ach. HUP 454, 671, 709 Lecanoraceae Crustose Corticolous Bark
61 Lecanora rupicola (L.) Zahlbr. HUP 406, 484, 605, 766 Lecanoraceae Crustose Saxicolous Rock
62 Lecidella euphorea (Florke) Hertel HUP 381, 672 Lecanoraceae Crustose Corticolous Bark
63 Lecidella stigmatea (Ach.) Hertel & Leuckert
HUP 08, 332 Lecanoraceae Crustose Saxicolous Rock
50
64 Lepraria elobata Toensberg HUP 1750, 700 Stereocaulaceae Leprose Corticolous Wood
65 Leptogium burnetiae C. W. Dodge, HUP 371, 443, 582, 662, 710 Collemataceae Foliose Corticolous Bark
66 Leptogium cyanescens (Rabenh.) Korb., HUP 445, 663, 713 Collemataceae Foliose Corticolous Bark
67 Leptogium hildenbrandii (Garov.) Nyl. HUP 75, 330, 375, 509, 589 Collemataceae Foliose Corticolous Trunk
68 Leptogium saturninum (Dicks.) Nyl., HUP 376, 452, 715 Collemataceae Foliose Corticolous Bark
69 Lobothallia alphoplaca (Wahlenb.) Hafellner
HUP 205, 509, 666 Megasporaceae Crustose Saxicolous Rock
70 Lobothallia praeradiosa (Nyl.) Hafellner HUP 374, 409, 711 Megasporaceae Crustose Saxicolous Rock
71 Melanelia disjuncta (Erichsen) Essl., HUP 508 Parmeliaceae Foliose Saxicolous Rock
72 Melanohalea elegantula (Zahlbr.) O. Blanco et al.
HUP 725 Parmeliaceae Foliose Corticolous Bark
73 Nephroma parile (Ach.) Ach. HUP 464, 628, 682, 739 Peltigeraceae Foliose Saxicolous Rock
74 Parmelia sulcata Taylor HUP 385, 460, 482, 731 Parmeliaceae Foliose Corticolous Trunk
75 Parmelina quercina (Willd.) Hale HUP 144, 461, 679 Parmeliaceae Foliose Corticolous Bark
76 Parmelina tiliacea (Hoffm.) Hale HUP 386, 415, 462, 734 Parmeliaceae Foliose Corticolous Bark
51
77 Parmeliopsis ambigua (Wulfen) Nyl HUP 81, 145, 260, 297 . Parmeliaceae Foliose Corticolous Bark
78 Peltigera horizontalis (Hudson) Baumg. HUP 466 Peltigeraceae Foliose Tericolous Soil
79 Peltigera polydactylon (Necker) Hoffm. HUP 488 Peltigeraceae Foliose Tericolous Soil
80 Peltigera rufescens (Weiss) Humb. HUP 727 Peltigeraceae Foliose Tericolous Soil
81 Peltula obscurans (Nyl.) Gyelnik HUP 18 Peltulaceae Squamulose Saxicolous Rock
82 Pertusaria leioplaca DC. HUP 147, 728 Pertusariaceae Crustose Corticolous Bark
83 Phaeophyscia ciliata (Hoffm.) Moberg HUP 20, 410, 593, 733 Physciaceae Foliose Corticolous Bark
84 Phaeophyscia endococcina (Korber) Moberg
HUP 388, 483, 712 Physciaceae Foliose Saxicolous Rock
85 Phaeophyscia orbicularis (Necker) Moberg
HUP 362, 510 Physciaceae Foliose Corticolous Bark
86 Physcia aipolia (Ehrh. ex Humb.) Furnr. HUP 392, 412, 599 Physciaceae Foliose Corticolous Trunk
87 Physcia dubia (Hoffm.) Lettau HUP 399. 688 Physciaceae Foliose Saxicolous Rock
88 Physcia stellaris (L.) Nyl. HUP 391, 717 Physciaceae Foliose Corticolous Trunk
89 Physconia muscigena (Ach.) Poelt HUP 560 Physciaceae Foliose Muscicolous Mosses
52
90 Porpidia crustulata (Ach.) Hertel & Knoph
HUP 438, 511 Lecidaceae Crustose Saxicolous Rock
91 Psora decipiens (Hedwig) Hoffm. HUP 594 Psoraceae Squamulose Tericolous Soil
92 Punctelia subrudecta (Nyl.) Krog HUP 16, 387, 417, 680, 736 Parmeliaceae Foliose Corticolous Trunk
93 Ramalina sinensis Jatta HUP 393, 468, 554, 683, 722 Ramalinaceae Foliose Corticolous Bark
94 Rhizocarpon geographicum (L.) DC. HUP 394, 423, 494, 512 Rhizocarpaceae Crustose Saxicolous Rock
95 Rhizocarpon lecanorinum Anders HUP 435, 528 Rhizocarpaceae Crustose Saxicolous Rock
96 Rhizocarpon viridiatrum (Wulfen) Korber
HUP 434 Rhizocarpaceae Crustose Saxicolous Rock
97 Rhizoplaca chrysoleuca (Sm.) Zopf HUP 486, 535 Lecanoraceae Foliose Saxicolous Rock
98 Rhizoplaca melanophthalma (DC.) Leuckert & Poelt
HUP 456, 506 Lecanoraceae Foliose Saxicolous Rock
99 Rhizoplaca peltata (Ramond) Leuckert & Poelt
HUP 592 Lecanoraceae Foliose Saxicolous Rock
100 Tephromela atra (Hudson) Hafellner HUP 413, 493 Mycoblastaceae Crustose Saxicolous Rock
101 Trapeliopsis granulosa (Hoffm.) Lumbsch
HUP 151, 395 Trapeliaceae Crustose Corticolous Wood
102 Usnea florida (L.) F. H. Wigg. HUP 463 Parmeliaceae Fruticose Corticolous Bark
53
103 Usnea fulvoreagens (Rasanen) Rasanen HUP 730 Parmeliaceae Fruticose Corticolous Trunk
104 Verrucaria muralis Ach. HUP 597 Verrucariaceae Crustose Saxicolous Rock
105 Xanthomendoza fallax (Hepp ex Arn.) Soechting, KSrnefelt & S. Kondratyuk
HUP 398, 459 Teloschistaceae Foliose Corticolous Bark
106 Xanthomendoza fulva (Hoffm.) Søchting, Kärnefelt & S. Kondr
HUP 408, 732 Teloschistaceae Foliose Corticolous Tree
107 Xanthoparmelia conspersa (Ehrh. ex Ach.) Hale
HUP 82, 584, 598 Parmeliaceae Foliose Saxicolous Rock
108 Xanthoparmelia tinctina (Maheu & A. Gillet) Hale
HUP 04, 419 Parmeliaceae Foliose Saxicolous Rock
109 Xanthoria parietina (L.) Th. Fr. HUP 499, 600, 691, 745 Teloschistaceae Foliose Corticolous Twings
110 Xanthoria sorediata (Vainio) Poelt HUP 514, 609 Teloschistaceae Foliose Saxicolous Rock
54
Table 4.2: List of families with genera and number of species from District Mansehra.
Sr. No. Familes Genus No. of species
1 Acarosporaceae Acarospora 3
2 Arthoniaceae Arthonia 1
3 Arthopyreniaceae Arthopyrenia 2
4 Candelariaceae Candelaria 1
Candelariella 5
5 Catillariaceae Catillaria 1
6 Cladoniaceae Cladonia 5
7 Collemataceae Collema 3
Leptogium 4
8 Graphidaceae Graphis 2
9 Lecanoraceae
Lecanora 10
Lecidella 2
Rhizoplaca 3
10 Lecidaceae Porpidia 1
11 Megasporaceae Aspicilia 2
Lobothallia 2
12 Mycoblastaceae Tephomela 1
13 Nephromataceae Nephroma 1
14 Parmeliaceae
Canoparmelia 1
Flavoparmelia 1
Flavopunctelia 2
Hypogymnia 1
Melanelia 1
Melanohalea 1
Parmelia 1
Parmelina 2
Parmeliopsis 1
55
Punctelia 1
Usnea 2
Xanthoparmelia 2
15 Peltigeraceae Peltigera 3
16 Peltulaceae Peltula 1
17 Pertusariaceae Pertusaria 1
18 Physciaceae
Amandinea 1
Anaptychia 2
Buellia 1
Heterodermia 2
Phaeophyscia 3
Physcia 3
Physconia 1
19 Psoraceae Psora 1
20 Ramalinaceae
Bacidia 3
Lecania 2
Ramalina 1
21 Rhizocarpaceae Rhizocarpon 3
22 Stereocaulaceae Lepraria 1
23 Teloschistaceae
Caloplaca 3
Xanthomendoza 2
Xanthoria 2
24 Thelotremataceae Diploschistes 3
25 Trapeliaceae Trapeliopsis 1
26 Umbilicariaceae Lasallia 1
27 Verrucariaceae
Catapyrenium 1
Dermatocarpon 1
Endocarpon 1
Verrucaria 1
56
Table 4.3: Number of families and genera in District Mansehra.
Sr. No. Families No. of Genera
1 Parmeliaceae 12
2 Physciaceae 7
3 Verrucariaceae 4
4 Teloschistaceae 3
5 Ramalinaceae 3
6 Lecanoraceae 3
7 Candelariaceae 2
8 Collemataceae 2
9 Megasporaceae 2
10 Acarosporaceae 1
11 Arthoniaceae 1
12 Arthopyreniaceae 1
13 Catillariaceae 1
14 Cladoniaceae 1
15 Graphidaceae 1
16 Lecidaceae 1
17 Mycoblastaceae 1
18 Peltigeraceae 1
19 Peltulaceae 1
21 Pertusariaceae 1
22 Psoraceae 1
23 Rhizocarpaceae 1
24 Stereocaulaceae 1
25 Thelotremataceae 1
26 Trapeliaceae 1
27 Umbilicariaceae 1
57
Table 4.4: List of dominant families by number of species in District Mansehra.
Sr. No. Families No. of species
1 Parmeliaceae 17
2 Lecanoraceae 15
3 Physciaceae 13
4 Teloschistaceae 7
5 Collemataceae 7
6 Candelariaceae 6
7 Cladoniaceae 5
8 Ramalinaceae 5
9 Megasporaceae 4
10 Verrucariaceae 4
11 Peltigeraceae 3
12 Acarosporaceae 3
13 Rhizocarpaceae 3
14 Theltremataceae 3
15 Arthopyreniaceae 2
16 Graphidaceae 2
17 Arthoniaceae 1
18 Catillariaceae 1
19 Lecidaceae 1
20 Mycoblastaceae 1
21 Nephromataceae 1
22 Peltulaceae 1
23 Pertusariaceae 1
24 Psoraceae 1
25 Stereocaulaceae 1
26 Trapeliaceae 1
27 Umbilicariaceae 1
58
Fig. 4.1: Families having more than two genera in District Mansehra.
4.1.1 Lichens Species Recorded as New to Pakistan
Among total recognized species, 12 species belong to 10 genera and
10 families were new records to Pakistan. These species include Acarospora
veronensis A. Massal., Anaptychia crinalis (Schleich.) Vezda, Candelariella
efflorescens R.C. Harris & W.R. Buck, Cladonia caespiticia (Pers.) Flörke,
Cladonia floerkeana (Fr.) Flörke, Lecanora chlarotera Nyl., Lecanora pulicaris
(Pers.) Ach., Lepraria elobata Tønsberg, Nephroma parile (Ach.) Ach., Punctelia
subrudecta (Nyl.) Krog, Rhizocarpon lecanorinum Anders and Trapeliopsis
granulosa (Hoffm.) Lumbsch (Table 4.5).
12
7
43 3 3
2 2 2
0
2
4
6
8
10
12
14
59
Table 4.5: The new record of species to Pakistan from District Mansehra.
Sr. No. Lichen species Family
1 Acarospora veronensis A. Massal. Acarosporaceae
2 Anaptychia crinalis (Schleich.) Vezda Physciaceae
3 Candelariella efflorescens R.C. Harris & W.R. Buck
Candelariaceae
4 Cladonia caespiticia (Pers.) Flörke Cladoniaceae
5 Cladonia floerkeana (Fr.) Flörke Cladoniaceae
6 Lecanora chlarotera Nyl. Lecanoraceae
7 Lecanora pulicaris (Pers.) Ach. Lecanoraceae
8 Lepraria elobata Tønsberg Stereocaulaceae
9 Nephroma parile (Ach.) Ach. Nephromataceae
10 Punctelia subrudecta (Nyl.) Krog Parmeliaceae
11 Rhizocarpon lecanorinum Anders Rhizocarpaceae
12 Trapeliopsis granulosa (Hoffm.) Lumbsch Trapeliaceae
4.1.2 Species Recorded as New to District Mansehra
Fifty nine lichen species belong to 35 genera and 17 families were
reported first time for District Mansehra (Table 4.6). The maximum number
of genera was recorded in family Parmeliaceae (8 genera) followed by
Lecanoraceae, Physciaceae and Teloschistaceae (3 genera each),
Candelariaceae, Collemataceae, Graphidaceae, Megasporaceae and
Verrucariaceae (2 genera each) while the remaining families have single
genus (Fig. 4.2). By number of species, Lecanoraceae (10 species) was
recorded as dominant family followed by Parmeliaceae (8 species),
Teloschistaceae (7 species), Candelariaceae, (5 species), Physciaceae and
Collemataceae (4 species each), Megasporaceae and Theloremataceae (3
species each), Acarosporaceae, Cladoniaceae, Graphidaceae,
Rhizocarpaceae and Verrucariaceae (2 species each) and Arthoniaceae,
Catillariaceae, Pertusariaceae, Ramalinaceae and Mycoblastaceae all having
single species (Fig. 4.3).
60
Table 4.6: List of species with families new to District Mansehra.
Sr. No. Families Lichen species
1
Acarosporaceae Acarospora heufleriana Korb.
Acarospora impressula Th. Fr.
2 Arthoniaceae Arthonia radiata (Pers.) Ach.
Candelariaceae
Candelaria concolor (Dicks.) Arnold
Candelariella aurella (Hoffm.) Zahlbr.
Candelariella reflexa (Nyl.) Lettau
Candelariella vitellina (Hoffm.) Müll. Arg.
Candelariella xanthostigma (Pers. ex Ach.) Lettau
3 Catillariaceae Catillaria lenticularis (Ach.) Th. Fr.
4 Cladoniaceae Cladonia fimbriata (L.) Fr.
Cladonia pocillum (Ach.) O.J. Rich.
5 Collemataceae
Collema flaccidum (Ach.) Ach.
Collema furfuraceum (Schaer.) Du Rietz
Collema subflaccidum Degel.
Leptogium burnetiae C.W. Dodge
6 Graphidaceae Graphis elegans (Borrer ex Sm.) Ach.
Graphis scripta (L.) Ach.
Lecanora albella (Pers.) Ach.
Lecanora cenisia Ach.
7 Lecanoraceae
Lecanora polytropa (Ehrh.) Rabenh.
Lecanora pseudistera Nyl.
Lecanora rupicola (L.) Zahlbr.
Lecidella euphorea (Flörke) Hertel
Lecidella stigmatea (Ach.) Hertel & Leuckert
Rhizoplaca chrysoleuca (Sm.) Zopf
Rhizoplaca melanophthalma (DC.) Leuckert
Rhizoplaca peltata (Ramond) Leuckert & Poelt
8 Megasporaceae Aspicilia desertorum (Kremp.) Mereschk.
9 Mycoblastaceae Tephromela atra (Huds.) Hafellner
10 Parmeliaceae Canoparmelia texana (Tuck.) Elix & Hale
Flavoparmelia caperata (L.) Hale
61
Flavopunctelia flaventior (Stirt.) Hale
Hypogymnia tubulosa (Schaer.) Hav.
Melanelia disjuncta (Erichsen) Essl.
Melanohalea elegantula (Zahlbr.) O. Blanco, A. Crespo, Divakar, Essl., D. Hawksw. & Lumbsch
Usnea fulvoreagens (Räsänen) Räsänen
Xanthoparmelia conspersa (Ehrh. ex Ach.) Hale
11 Pertusariaceae Pertusaria leioplaca DC.
12 Physciaceae
Amandinea punctate (Hoffm.) Coppins & Scheid.
Heterodermia japonica (M. Satô) Swinscow & Krog
Heterodermia obscurata (Nyl.) Trevis.
Physcia aipolia (Ehrh. ex Humb.) Fürnr.
13 Ramalinaceae Bacidia laurocerasi (Delise ex Duby) Zahlbr.
Bacidia rosella (Pers.) De Not.
Ramalina sinensis Jatta
14 Rhizocarpaceae
Rhizocarpon geographicum (L.) DC.
Rhizocarpon viridiatrum (Wulfen) Körb.
15 Teloschistaceae
Caloplaca cirrochroa (Ach.) Th. Fr.
Caloplaca decipiens (Arnold) Blomb. & Forssell
Caloplaca teicholyta (Ach.) J. Steiner
Xanthomendoza fallax Søchting, Kärnefelt & S.Y. Kondr.
Xanthomendoza fulva (Hoffm.) Søchting, Kärnefelt & S.Y. Kondr.
Xanthoria parietina (L.) Th. Fr.
Xanthoria sorediata (Vain.) Poelt
16 Thelotremataceae
Diploschistes diacapsis (Ach.) Lumbsch
Diploschistes muscorum (Scop.) R. Sant.
Diploschistes scruposus (Schreb.) Norman
17 Verrucariaceae Catapyrenium cinereum (Pers.) Körb.
Dermatocarpon miniatum (L.) W. Mann
62
Fig. 4.2: Families with number of genera of species new to District Mansehra.
Fig. 4.3: Dominant families by number of genus of species new to District Mansehra.
8
3 3 32 2 2 2
1 1 1 1 1 1 1 1 1 1
0123456789
Genera
10
87
54 4
3 32 2 2 2 2
1 1 1 1 1
0
2
4
6
8
10
12
63
4.1.3 Distribution Pattern
4.1.3.1 Growth Form
The data on growth forms of different lichentaxa has been presented
in Fig 4.4. Crustose (46.36%) was the dominant growth form followed by
Foliose (42.72%), Fruticose (6.36%), Squamulose (3.63%) and Leprose
(0.9%).
Fig. 4.4: Relative (%) of different growth forms of species in District Mansehra.
4.1.3.2 Substrate
Relative distribution of lichen on different substrates has been
summarized in Fig. 7.1. Four types of associations were recognized viz., on
trees, rocks, soil and mosses. The maximumt number of species was
recorded on bark (39.09%), followed by rock (38.18%), soil (10.9%), trunks
(7.27%), wood (2.72%) and mosses and twinges (0.9%) (Fig. 4.6).
46.36%42.72%
6.36%3.63%
0.90%
0.00%
5.00%
10.00%
15.00%
20.00%
25.00%
30.00%
35.00%
40.00%
45.00%
50.00%
Crustose Foliose Fruticose Squamulose Leprose
Pe
rce
nta
ge
of
Sp
eci
es
Lichen Growth Form
64
Fig. 4.5: Realtive (%) of species in different habitat in District Mansehra.
Fig. 4.6: Relative (%) of lichens on basis of hosted substrate in District Mansehra.
Saxicolous, 38.18%
Corticolous, 50%
Tericolous, 10.90%
Muscicolous, 0.90%
0.00%
5.00%
10.00%
15.00%
20.00%
25.00%
30.00%
35.00%
40.00%
45.00%
Rocks Bark Soil Wood Trunk Mosses Twings
Series1
65
4.1.3.3 Locality-Wise Distribution
Distribution of lichen species at different localities (Table 4.7)
suggest that Candelaria concolor was recorded from maximum number of
localities (6 localities) followed by Acarospora impressula, Candelariella
efflorescens, Cladonia floerkeana, Collema furfuraceum, Collema subflaccidum,
Leptogium burnetiae, Leptogium hildenbrandii, Lecanora allophana, Lecanora
polytropa, Aspicilia desertorum, Parmelia sulcata, Punctelia subrudecta,
Phaeophyscia ciliate, Bacidia rosella and Ramalina sinensis (5 localities each).
Twenty three (23) taxa were recorded from a single locality (Table 4.8).
Table 4.7: List of taxa found at more than one locality in District Mansehra.
Sr. No.
Lichen Species No. of
localities
1 Candelaria concolor (Dicks.) Arnold 6
2 Acarospora impressula Th. Fr. 5
3 Candelariella efflorescens R.C. Harris & W.R. Buck 5
4 Cladonia floerkeana (Fr.) Flörke 5
5 Collema furfuraceum (Schaer.) Du Rietz 5
6 Collema subflaccidum Degel. 5
7 Leptogium burnetiae C.W. Dodge 5
8 Leptogium hildenbrandii (Garov.) Nyl. 5
9 Lecanora allophana (Ach.) Nyl. 5
10 Lecanora polytropa (Ehrh.) Rabenh. 5
11 Aspicilia desertorum (Kremp.) Mereschk. 5
12 Parmelia sulcata Taylor 5
13 Punctelia subrudecta (Nyl.) Krog 5
14 Phaeophyscia ciliata (Hoffm.) Moberg 5
15 Bacidia rosella (Pers.) De Not. 5
16 Ramalina sinensis Jatta 5
17 Acarospora heufleriana Korb. 4
66
18 Acarospora veronensis A. Massal. 4
19 Candelariella aurella (Hoffm.) Zahlbr. 4
20 Candelariella reflexa (Nyl.) Lettau 4
21 Candelariella vitellina (Hoffm.) Müll. Arg. 4
22 Cladonia caespiticia (Pers.) Flörke 4
23 Cladonia fimbriata (L.) Fr. 4
24 Cladonia pocillum (Ach.) O.J. Rich. 4
25 Cladonia pyxidata (L.) Hoffm. 4
26 Collema flaccidum (Ach.) Ach. 4
27 Lecanora argentata (Ach.) Röhl. 4
28 Lecanora cenisia Ach. 4
29 Lecanora chlarotera Nyl. 4
30 Aspicilia cinerea (L.) Körb. 4
31 Nephroma parile (Ach.) Ach. 4
32 Canoparmelia texana (Tuck.) Elix & Hale 4
33 Flavoparmelia caperata (L.) Hale 4
34 Flavopunctelia soredica (Nyl.) Hale 4
35 Hypogymnia tubulosa (Schaer.) Hav. 4
36 Parmelina tiliacea (Hoffm.) Hale 4
37 Parmeliopsis ambigua (Wulfen) Nyl. 4
38 Heterodermia japonica (M. Satô) Swinscow & Krog
4
39 Bacidia rubella (Hoffm.) A. Massal. 4
40 Rhizocarpon geographicum (L.) DC. 4
41 Xanthoria parietina (L.) Th. Fr. 4
42 Diploschistes scruposus (Schreb.) Norman 4
43 Dermatocarpon miniatum (L.) W. Mann 4
44 Arthonia radiata (Pers.) Ach. 3
45 Leptogium cyanescens (Rabenh.) Körb. 3
46 Leptogium saturninum (Dicks.) Nyl. 3
67
47 Lecanora albella (Pers.) Ach. 3
48 Lecanora pseudistera Nyl. 3
49 Lecanora pulicaris (Pers.) Ach. 3
50 Lecanora rupicola (L.) Zahlbr. 3
51 Lecidella stigmatea (Ach.) Hertel & Leuckert 3
52 Rhizoplaca chrysoleuca (Sm.) Zopf 3
53 Lobothallia alphoplaca (Wahlenb.) Hafellner 3
54 Lobothallia praeradiosa (Nyl.) Hafellner 3
55 Flavopunctelia flaventior (Stirt.) Hale 3
56 Parmelina quercina (Willd.) Hale 3
57 Xanthoparmelia conspersa (Ehrh. ex Ach.) Hale 3
58 Amandinea punctate (Hoffm.) Coppins & Scheid. 3
59 Anaptychia crinalis (Schleich.) Vezda 3
60 Phaeophyscia endococcina (Körb.) Moberg 3
61 Physcia aipolia (Ehrh. ex Humb.) Fürnr. 3
62 Diploschistes muscorum (Scop.) R. Sant. 3
63 Arthopyrenia cinereopruinosa (Schaerer) A. Massal.
2
64 Candelariella xanthostigma (Pers. ex Ach.) Lettau 2
65 Catillaria lenticularis (Ach.) Th. Fr. 2
66 Graphis scripta (L.) Ach. 2
67 Lecanora dispersa (Pers.) Röhl. 2
68 Lecidella euphorea (Flörke) Hertel 2
69 Rhizoplaca melanophthalma (DC.) Leuckert 2
70 Porpidia crustulata (Ach.) Hertel & Knoph 2
71 Tephromela atra (Huds.) Hafellner 2
72 Xanthoparmelia tinctina (Maheu & A. Gillet) Hale 2
73 Pertusaria leioplaca DC. 2
74 Heterodermia obscurata (Nyl.) Trevis. 2
75 Phaeophyscia orbicularis (Neck.) Moberg 2
68
76 Physcia dubia (Hoffm.) Lettau 2
77 Physcia stellaris (L.) Nyl. 2
78 Bacidia laurocerasi (Delise ex Duby) Zahlbr. 2
79 Lecania cyrtella (Ach.) Th. Fr. 2
80 Rhizocarpon lecanorinum Anders 2
81 Lepraria elobata Tønsberg 2
82 Caloplaca decipiens (Arnold) Blomb. & Forssell 2
83 Xanthomendoza fallax Søchting, Kärnefelt & S.Y. Kondr.
2
84 Xanthomendoza fulva (Hoffm.) Søchting, Kärnefelt & S.Y. Kondr.
2
85 Xanthoria sorediata (Vain.) Poelt 2
86 Diploschistes diacapsis (Ach.) Lumbsch 2
87 Trapeliopsis granulosa (Hoffm.) Lumbsch 2
69
Table 4.8: List of taxa recorded from single locality in District Mansehra.
Sr. No. Lichen Species Locality Altitude
(m)
1 Anaptychia runcinata (With.) J.R. Laundon
Mandagucha 1866
2 Arthopyrenia punctiformis (Pers.) A. Massal.
Naran 2242
3 Buellia stellulata (Taylor) Mudd Dader 1223
4 Caloplaca cirrochroa (Ach.) Th. Fr. Dader 1343
5 Caloplaca teicholyta (Ach.) J. Steiner Lalazar 2855
6 Catapyrenium cinereum (Pers.) Körb. Dader 1215
7 Endocarpon pusillum Hedw. Dader 1209
8 Graphis elegans (Borrer ex Sm.) Ach. Manoor Valley
2552
9 Lasallia papulosa (Ach.) Llano Dader 1215
10 Lecania naegelii (Hepp) Diederich & van den Boom
Paras 1994
11 Melanelia disjuncta (Erichsen) Essl. Jalkhad 2700
12 Melanohalea elegantula (Zahlbr.) O. Blanco, A. Crespo, Divakar, Essl., D. Hawksw. & Lumbsch
Shogran 2350
13 Peltigera horizontalis (Huds.) Baumg. Manoor Valley
2560
14 Peltigera polydactylon (Neck.) Hoffm. Manoor Valley
2700
15 Peltigera rufescens (Weiss) Humb. Shogran 2610
16 Peltula obscurans (Nyl.) Gyeln. Dader 1205
17 Physconia muscigena (Ach.) Poelt Lalazar 2913
18 Psora decipiens (Hedw.) Hoffm. Lalazar 3089
19 Rhizocarpon viridiatrum (Wulfen) Körb.
Lake Saif-ul-Maluk
2740
20 Rhizoplaca peltata (Ramond) Leuckert & Poelt
Lalazar 2600
21 Usnea florida (L.) Weber ex F.H. Wigg.
Manoor Valley
2505
22 Usnea fulvoreagens (Räsänen) Räsänen
Shogran 2438
23 Verrucaria muralis Ach. Lalazar 2600
70
4.2 Taxonomic Description
Details about families and taxonomic description of genera and species
are given below:
1. Acarosporaceae
Thallus crustose, foliose or squamulose, developed sometimes scarcely.
Algal cells: Protococcaceae. Apothecia with or without thalline margin;
asci many spored; spores simple or septate. Habitat: soil, rocks.
Distribution: arctic to temperate.
Genera in Study Area: The present study recorded one genus from
District Mansehra (Fig. 4.1)
Acarospora A. Massal
Thallus: crustose, areolate, verruculos or placodioid; areoles scattered to
contiguous, angular to rounded; upper surface yellow or blackish, brown,
pale, dull or glossy, pruinose or epruinose, smooth to wrinkled, often
developing fissure; lower surface ecorticate, subcorticate or eucorticate,
white or pigmented; attachment, rhizohyphae and pseudorhizines;
apothecia aspiciliod, usually immersed, rarely sessile, one or more per
areole; disc red brown to brown black, round, pruinose or epruinose,
smooth or rough; hymenium 75-195 µm; epihymenium; hyaline,
paraphyses; usually not branched; subhymenium hyaline or pale yellow;
asci more than 100-ascospores/ascus, narrow or clavate; ascospores simple,
hyaline globose to ellipsoid, sometimes contains oil drops. Secondary
metabolites: mostly none detected. Substrate: on rocks, soil or on other
lichens. World distribution: cosmopolitan.
This genus is cosmopolitan; there are 200 species of the genus distributed
worldwide. Previously ten species were recorded from Pakistan and two
71
from District Mansehra. Present study reported three species; two species
new to District Mansehra and one to Pakistan (Plat 3.1).
Key to species
1a. Thallus K+ red, norstictic acid present………………….. A. heufleriana
1b. Thallus K- , norstictic acid absent ……………………………………...2
2a. Thallus pale brown, apothecia with thalline
margin........................................................................Acarospora veronensis
2b. Thallus brown to black, apothecia without thalline margin…............3
3a. Thallus wide spreading, areoles subsquamulose............Acarospora sp.
3b. Thallus forming discrete patches, aerole plane,
smooth……………………………………………………….A. impressula
1. Acarospora heufleriana Körb., Parerga lichenol. (Breslau) 1: 57
(1859)
Thallus areolate; areoles angular, dispersed to contiguous, up to 1.7 mm in
diameter, up to 0.6 mm thick, rim down turned, concolorus with thallus,
corticated, concolorous; upper surface plane to convex, yellow, smooth to
rough, epruinose or pruinose; attachment broad, thick, elevating the
areoles, without stipe; lower surface outer edge corticated and yellow,
inner edge ecorticated and white pale brown; apothecia immersed,
punctiform to dilate; disc round to irregular, reddish brown; epihymenium
11-14 µm thick, yellow; hymenium 85-105 µm tall, pale yellow above to
hyaline below; subhymenium up to 40 µm thick, pale yellow; asci clavate,
12-16 µm wide; ascospores simple, hyaline, ellipsoid.
Habitat: Rocks (Saxicolous)
Spot tests: Medulla K+ red
72
Secondary Metabolites (TLC): Norstictic acid, rhizocarpic acid.
Specimen Examined: Dader, alt. 1,184 m, 10.10.13, Asmat Ullah, Amir
Khan Afridi and Syed Muhammad 15 (HUP), Ghari Habib Ullah, 986 m,
25.3.14, Asmat Ullah and Amir Khan Afridi 199 (HUP), Oghi top, alt. 1,564 m,
14.4.14, Asmat Ullah, Amir Khan Afridi and Kaleem Shah 226 (HUP), Balakot,
alt. 1,051 m, 25.04.14, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah
286 (HUP).
World Distribution: Asia (Pakistan), North America, Europe.
Note: New record to the study area.
2. Acarospora impressula Th. Fr., Lich. Scand. (Upsaliae) 1(1): 214
(1871)
Thallus crustose, form small patches or areolate, up to 2 cm in diameter;
areoles 0.5.5 - 1.5 mm in diameter, contiguous, red brown to black brown,
smaller at edge of thallus, epruinose; apothecia present, dark, 0.2-0.5 mm in
diameter, punctiform, immersed and concave; disc concolorous with
thallus, margin darker, angular to circular; hymenium 60-75 µm tall;
asci 100-spored; ascospores ellipsoid, 2.5- 4.5 X 1.5 2.0-2.5 µm in diameter.
Habitat: Rock (Saxicolous)
Spot tests: All negative
Secondary Metabolites (TLC): None detected
Specimen Examined: Near Dadar, alt. 1,331 m, 08.11.2013, Asmat
Ullah, Amir Khan Afridi and Syed Muhammad 71 (HUP), Oghi top, alt. 1,465
m, 14.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleem Shah 236 (HUP),
Balakot, alt. 1,100 m, 26.04.15, Asmat Ullah, Amir Khan Afridi and Syed
Mushraf Shah 294 (HUP), Paras, alt. 2,232 m, 27.07.15, Asmat Ullah, Amir
73
Khan Afridi and Syed Mushraf Shah 327 (HUP), Khaki, 1,166 m, 20.08.15,
Asmat Ullah and Amir Khan Afridi 758 (HUP).
World Distribution: Asia, Europe, North America, Africa (Egypt,
Morocco).
Note: New record to the study area.
3. Acarospora veronensis A. Massal., Ric. auton. lich. crost. (Verona):
29, tab. 48 (1852)
Thallus crustose, dispersed areolate, overall up to 4 cm wide; areoles 0.2-0.5
mm in diameter, dispersed or contiguous, rounded or angular, matt or
shiny, flat or slightly convex, light brown or black when dry; lower surface
narrow, corticated, white, sometimes dark or light brown; apothecia
numerous, immersed, 1-3 per areoles, rounded to angular, 0.1-0.4 mm in
diameter; disc concolorous, or dull reddish brown to blackish brown,
smooth to rough; hymenium colourless; epihymenium yellow or reddish
browm; asci 100+ spore , cylindrical, 70-85 x 15-23 µm; ascospores
colourless, simple, ellipsoid, 3.0 -5.0 x 1.0-2.0 µm.
Habitat: Rock (Saxicolous)
Spot Tests: All negative
Secondary Metabolites (TLC): None detected
Specimen Examined: On way to lake Saif-ul-Maluk, alt. 2,970 m,
27.07.2014, Asmat Ullah, Amir Khan and Syed Juneed Shah 396 (HUP),
Manoor Valley, alt. 3,380 m, 03.08.2014, Asmat Ullah, Mazhar-ul-Islam and
Ashfaq Ahmad 465 (HUP), Jalkhad, alt. 3,358 m, 10.08.2014, Asmat Ullah,
Mazhar-ul-Islam and Ashfaq Ahmad 505 (HUP) Lalazar, alt. 2,909 m,
10.09.2014, Asmat ullah, Amir Khan and Syed Juneed Shah 556 (HUP).
74
World Distribution: Asia, Europe, N. America, C. America (Mexico),
Australasia (New Zealand), Africa (Morocco).
Note: A new recorded to Pakistan.
Fig. 4.7: Distribution of Acarosporaceae in District Mansehra; 1. Jalkhad
2. Lalazar, 3. On the the way to Saif-ul-Maluk, 4. Manoor
Valley, 5. Paras, 6. Mahandri, 7. Balakot, 8. Daader, 9. Ghari
Habibullah, 10. Khaki, 11. Ooghi top.
75
Plate 3.1: A. Acarospora heufleriana, B. Acarospora impressula, C. Acarospora
veronensis (scale= 1 cm) in District Mansehra.
76
2. Arthoniaceae
Thallus crustose poorly differentiated to parasymbiotic; spores colorless or
brownish, septate to muriform. Habitat: trees Distribution: temperate to
tropical.
Genera in study area: The present study recorded single genus from
District Mansehra (Fig. 4.8). (Plat 3.2).
Arthonia Ach.
Thallus crustose, immersed or superficial, rudimentary but sometimes well
developed; ascomata apothecia-like, rounded, elongate or branched, flat to
convex; disc red-brown to black, occasionally with white or pale red
pruina; epihymenium conspicuous; hymenium with densely to widely
spaced asci, usually I+ red or blue; subhymenium indistinct to distinct in
structure and color; asci clavate, subglobose to globose, semi-fissitunicate,
usually 8-spored; ascospores colourless to brown, smooth, transversely
septate to muriform, ovoid to oblong- ovoid; seconday metabolites no
lichen metabolites detected; substrate on bark, wood, leaves, rocks or
lichens.
There are 500 species of above genus distributed worldwide; previously
one species and one variety have been reported from Pakistan. The present
study recorded one species as new to District Mansehra (Plate 3.2).
1. Arthonia radiata (Pers.) Ach., K. Vetensk-Acad. Nya Handl. 29: 131
(1808)
Thallus crustose, inconspicuous, immersed; upper surface pale grey,
occasionally with a brown or olive tinge, specific structures absent;
ascomata apothecia, black, variable shaped, rounded to substellate, flat or
77
slightly convex, 0.15-0.75 mm in diameter; disc black, epruinose;
epihymenium brown; hymenium hyaline, 35-50 µm tall; paraphyses with
dark apical cell; asci fissitunicate – bitunicate; ascospores oblong-ovoid to
oblong, 3-septate, 16-20 x 4.5-5 µm in diameter.
Habitat: On bark (Tericolous)
Spot Test: All negative
Secondary Metabolites (TLC): None detected
Specimen Examined: Mandagucha alt. 1,840 m 14.11.2014, Asmat
Ullah and Mazhar-ul-Islam 104 (HUP), Paras, alt. 1,677 m, 28.07.2014, Asmat
Ullah, Amir Khan Afridi and Syed Mushraf Shah 352 (HUP), Shogran, alt.
1,900 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 701
(HUP).
World Distribution: Asia, Europe, Africa (Guinea, Morocco), C.
America (Mexico), N. America, S. America (Colombia, Chile), Australisia
(Australia, New Zealand), Pacific (Hawaii).
Note: New to the study area.
78
Fig. 4.8: Distribution of Arthoniaceae in District Mansehra; 1. Mandagucha. 2. Shogran, 3. Paras.
Plate 3.2: Arthonia radiata (scale= 1 cm) in District Mansehra.
79
3. Arthopyreniaceae
Thallus crustose, poorly differentiated, perithecia sessile or immersed,
simple or rarely grouped, asci 1-8 spored, ovate or cylindrical, spores
colourless or sometimes brown, 1-many septate or muriform. Habitat:
trees, rocks. Distribution: temperate to tropical.
Genera in study area: The present study recorded single genus from
District Mansehra (Fig. 4.9).
Arthopyrenia A. Massal.
Thallus crustose, immersed; ascomata circular to ellipsoid, perithecial;
involucrellum: dark brown, clypeate, composed of bark cell and compact
hyphae; exciple colorless, thin; asci 8-spored, bitunicate, pyriform to
clavate; ascospores hyaline or brownish, pyriform, 1-2 septate, 5-14 x 14-45
µm; secondary metabolites absent; substrate bark or sometimes on non-
calcareous rocks.
The genus has a total of 50 species reported world and two species from
Pakistan and study area. The present study also recorded two species from
Distrcit Mansehra (Plate 3.3).
Key to species
1a. Mature spores with distinct contriction at center of
cell……………...………………………………………..A. cinereopriunosa
1b. Mature spores cells slightly or not constricted………….......................2
2a. Spores with distinct perispore, paraphyses persistent
……………………………………………………………....A. punctiformis
2b. Spores with no perispore, paraphysis
disappearing…………………………………………………Arthopyrenia sp.
80
1. Arthopyrenia cinereopruinosa (Schaer.) A. Massal., Symmict. Lich:
117 (1855)
Thallus inconspicuous; ascomata perthecia, circular or ellipsoid, 0.3-0.4 x
0.2-0.3 mm in diameter, white pruinose; involucrellum brown;
pseudoparaphysis slender; asci cylindrical clavate, 60-75 x 11-18 µm;
ascospores:1-sepatate, clavate, apices rounded, 14-21 x 5.5-8 µm.
Habitat: Bark (Corticolous)
Spot Test: All negative
Secondary Metabolites (TLC): None detected
Specimen Examined: Mandagucha, alt. 1,872 m, 14.11.2013, Asmat
Ullah and Mazhar-ul-Islam 130 (HUP), Kiwai, alt. 1,770 m, 22.08.2015, Asmat
Ullah and Amir Khan Afridi 765 (HUP).
World Distribution: Asia (Pakistan, Taiwan); Europe (Britain and
Ireland); Australisia (Australia).
2. Arthopyrenia punctiformis A. Massal., Ric. auton. lich. crost.
(Verona): 168, fig. 335 (1852)
Thallus absent; upper surface smooth, gray; ascomata perithecia, black,
hemispherical; asci dark brown or black, 0.1-0.3 mm in diameter, 8-spored,
irregularly arranged; ascospores hyaline, elongated-ellipsoid, 1-septate, 16-
21 x 4.4-6 µm.
Habitat: Bark (Corticolous)
Spot Tests: All negative
Secondary Metabolites (TLC): None detected
Specimen Examined: On way to Naran from Paras, alt. 2,242 m,
29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 373 (HUP).
81
World Distribution: Asia (Pakistan, Palestine, Taiwan, Russia),
Europe, Africa (Morocco), C. America (Mexico), N. America, S. America
(Argentina, Chile), Australasia (Australia, New Zealand), Pacific (Hawaii).
Fig. 4.9: Distribution of Arthopyreniaceae in District Mansehra; 1. On
way to Naran from Paras, 2. Mahandri (Kaghan), 3. Kiwai, 4.
Shogran, 5. Mandagucha.
82
Plate 3.3: A. Arthopyrenia cinereopruinosa, B. Arthopyrenia punctiformis (scale= 2 cm) in District Mansehra.
83
4. Candelariaceae
Thallus crustose, foliose rarely fruticose, yellow; apothecia lecanorine type;
asci 8 or many spored; ascospores colourless, 1-2 celled. Habitat: rocks and
trees. Distribution: Boreal, subtropical.
Genera in study area: In the present study two genus of the family were
recorded from District Mansehra (Fig. 4.10).
Key to genera
1a. Thallus Fruticose or small foliose, lower surface white to
yellow…………………………………………………………....Candelaria
1b. Thallus Crustose to Squamulose………………………………………..2
2a. Epihymenium granular, yellow brown, hymenium, 50-75µm
tall…...………………………………………………………...Candelariella
2b. Not as above
Candelaria A. Massal.
Thallus fruticose or small foliose, loosely adnate to adnate, circular to
irregular in outline, lobate; lobes flat to convex, apices: horizontal, eciliate;
upper surface yellow green to chrome yellow, corticated, dull to
somewhat shiny, isidia or soredia present or absent, with or without
pruina; lower surface white to yellow, corticated, smooth to wrinkled,
rhizinate; rhizines simple or branched; apothecia laminal, sessile; disc dark
yellow than Thallus; epihymenium granular, yellow brown; hymenium
colorless below; asci clavate, Candelaria-type; ascospores: ellipsoid,
colorless, simple or thinly 1-septate. Substrate: on bark, rocks, mosses or
soil. Secondary metabolites: pulvinic acid derivatives.
84
A total of seven species of the genus are reported from the world and
previously one species from Pakistan. The present study recorded one
species as new to District Mansehra (Plate 3.4)
1. Candelaria concolor (Dicks.) Arnold, Flora, Regensburg 62: 364 (187
Thallus small foliose, up to 1cm wide, closely appressed, lobate; lobes 0.1 -
0.4 mm wide, dorsiventral, flattened, finely divided, loosely imbricate,
narrow, 0.2 -0.5 mm wide; upper surface bright yellow green, smooth,
sorediate; soredia: granular; lower surface white, rhizinate; rhizine white,
simple, scattered; apothecia rare, sessile; disc greenish orange; hymenium
65-90 µm tall; paraphysis simple; asci clavate; ascospores colourless,
biguttulate, 6.5 – 14 x 4-6 µm.
Habitat: On bark (Corticolous)
Spot Tests: K- or K+ deep yellow
Secondary Metabolites (TLC): Calycin
Specimens Examined: Dader, alt. 1,221 m, 11.10.2013, Asmat Ullah,
Amir Khan Afridi and Malik Zahir 36 (HUP), Mandagucha, 1,827 m,
14.11.2013, Asmat Ullah and Mazhar-ul-Islam 135 (HUP), Paras, alt. 1,477 m,
28.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 354 (HUP),
Manoor Valley, alt. 2,560 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and
Mazhar-ul-Islam 474 (HUP), Lalazar, 2,980 m, 11.09.2014, Asmat Ullah, Juneed
Khan and Amir Khan Afridi 581 (HUP), Shogran, alt. 2,322 m, 26.07.2015,
Asmat Ullah, Syed Juneed Shan and Amir Afridi 665 (HUP).
World Distribution: Asia, Europe, Africa, C. America (Guatemala,
Mexico), N. America; S. America; Australasia; Pacific (Hawaii).
Note: New to the study area.
85
Candelariella Mull. Arg., Bull. Herb. Boissier 2, app. 1: 11 (1894).
Thallus crustose to squamulose, areolate, granular, pulvinate, rosulate to
placodioid, lobate; upper surface yellow, yellow-orange, yellow-green;
ascomata apothecia, sessile; disc bright yellow, rounded, flat to convex;
epihymenium yellow-brown, granular; hymenium hyaline, 50-75 µm tall;
hypothecium colourless; asci 8-32 spored, clavate, Candelaria-type;
ascospores hyaline, ellipsoid, oblong, ovoid, straight or curved, simple’
Secondary metabolites: calycin and pulvinic dilacton. Distribution: world-
wide. Substrate: on wood, bark, soil, rocks, other lichens or mosses.
The above genus has a total of 50 species reported from world. Previously
four species were reported from Pakistan while the present study recorded
five species, one species as new to Pakistan and four species are new
District Mansehra (Plate 3.5 and Plate 3. 6)
Key to species
1. Thallus sorediate………………………………………………...C. reflexa
1. Thallus esorediate………………………………………………………...2
2. Thallus inconspicuous, apothecia scattered……………….….C. aurella
2. Thallus distinct, granular, apothecia absent…………………………...3
3. Thallus granule spherical………………………………..C. xanthostigma
3. Thallus granules flattened……………………………………….………4
4. Upper surface bright golden yellow…………………...Candelariella sp.
4. Upper surface dull yellow orange………………………..…..C. vitellina
86
1. Candelariella aurella (Hoffm.) Zahlbr., Cat. Lich. Univers. 5: 790
(1928)
Thallus crustose, thin, composed of small scattered areoles, 0.5-1.5 mm in
diameter; areoles convex, rounded to somewhat elongated, convex, 0.1-0.3
mm long, occasionally becoming lobe like; upper surface yellow, smooth;
apothecia lecanorine, abundant, 0.25-0.9 mm wide; disc round, flat or more
slightly convex, occasionally strongly convex, concolourous or dark
yellow than thallus; epihymenium yellow-brown; hymenium colourless,
60-75 µm tall; hypothecium colourless, 65 µm tall; paraphyses simple or
branched near tips, cylindrical or apically swollen; asci: 8-spored, clavate;
ascospores: hyaline, ellipsoid, 12.5-16.5 x 4-5 µm.
Habitat: On rocks (saxicolous)
Spot Tests: K- to K+ reddish, C-, KC-
Secondary Metabolites (TLC): Calycin, pulvinic acid. Pulvinic dilacton
Specimen Examined: Lake Saif-ul-Maluk, alt. 3,293 m, 30.07.2014,
Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 402 (HUP), Manoor
Valley, alt. 3,513 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-
Islam 446 (HUP), Behsal, alt. 3,368 m, 11.08.2014, Asmat Ullah, Ashfaq Ahmad
and Mazhar-ul-Islam 525 (HUP), Lalazar, alt. 3,001 m, 11.09.2014, Asmat
Ullah, Amir Khan Afridi and Syed Juneed Shah 583 (HUP).
World Distribution: Asia, Europe, Africa (Egypt, Morocco), C.
America (Mexico), N. America, S. America (Argentina), Australasia (New
Zealand, Australia) and Antarcatica.
Note: New to the study area.
2. Candelariella efflorescens R.C. Harris & W.R. Buck, Michigan Bot.
17(4): 155 (1978)
87
Thallus crustose, areolate to minutely Squamulose; areoles up to 0.4 mm
wide, convex, rounded to elongated, occasionally somewhat raised from
substrate; upper surface green to green yellow, sorediate; soredia 0.02-0.05
mm wide, yellow, powdery, on areoles margin and spreading inwards;
ascomata apothecia, lcanorine, upto 0.65 mm wide; disc flate, dark yellow;
epihymenium yellow-brown; hymenium 50-60 µm tall, colourless;
hypothecium hyaline; paraphyses simple; asci 16-spored, clavate;
ascospores colourless, simple, ellipsoid, 11-14 x 4-5 µm.
Habitat: On bark (Corticolous)
Spot Tests: K- to K+ reddish, C-, KC-,
Secondary Metabolites (TLC): Calycin, pulvinic acid, and pulvinic
dilactone.
Specimen Examined: Mandaghucha, alt. 1,961 m, 14.11.2013, Asmat
Ullah and Mazhar-ul-Islam 133 (HUP), Paras, alt. 1,615 m, 28.07.2014, Asmat
Ullah, Amir Khan Afridi and Syed Mushraf Shah 355 (HUP), Manoor Valley
near forest rest house, alt. 2,566 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad
and Mazhar-ul-Islam 442 (HUP), Paras, alt. 1,768 m, 05.07.2015, Asmat Ullah,
Amir Khan Afridi and Syed Mushraf Shah 644 (HUMP), On track to Saripya
Shogran, alt. 2,528 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed
Juneed Shah 707 (HUP).
World Distribution: North America, Europe.
Note: A new record to Pakistan.
3. Candelariella reflexa (Nyl.) Lettau, Hedwigia 52: 196 (1912)
Thallus: dispersed, contiguous granules or small Squamulose; squamules
smaller, up to 1 mm in diameter, rounded or lobed, flattened; upper
surface dull yellow green, sorrediate; soredia spherical, bright yellow, 0.04-
0.06mm in diameter; apothecia rare, 0.5-1.00 mm in diameter, margin
88
smooth or sorediate; asci 8-spored; ascospores simple, oblong ellipsoid, 9-
14.5 x 4-5 µm.
Habitat: On bark (Corticolous)
Spot Test: All negative
Secondary Metabolites (TLC): None detected
Specimen Examined: Mandagucha, alt. 1,859 m, 14.11.2013, Asmat
Ullah and Mazhar-ul-Islam 138 (HUP), Batal, alt. 1,810 m, 02.02.2014, Asmat
Ullah, Amir Khan Afridi and Kaleem Shah 178 (HUP) Oghi top, alt. 1,360 m,
14.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleem Shah 229 (HUP), On
way to Manoor Valley, alt. 2,157 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad
and Mazhar-ul-Islam 439 (HUP).
World Distribution: Asia, Europe, Africa (Algeria), Australasia
(Tasmania, New Zealand).
Note: New to the study area.
4. Candelariella vitellina (Hoffm.) Müll. Arg., Bull. Herb. Boissier
2(app. 1): 47 (1894)
Thallus areolate to subsquamulose; areoles flat to convex, granular to
irregular; upper surface yellow, orange to brown orange, smooth to
uneven; apothecia frequent, lecanorine, 0.5-1.5 mm in diameter; disc flat to
convex, rounded, dark yellow than thallus; epihymenium yellow-brown;
hymenium colourless, 55-70 µm tall; hypotheicum colourless, 55-110 µm
tall; paraphyses cylindrical or with swollen tip, simple or branched; asci 16-
24 spored, clavate; ascospores hyaline, oblong to ellipsoid, simple to 1-
septate, 8.5-11.5 x 3-4.5 µm.
Habitat: On rocks (Saxicolous)
Spot Tests: Thallus K- or K+ reddish, C-, KC-
89
Secondary Metabolites (TLC): Calycin, pulvinic acid, and pulvinic
dilactone.
Specimen Examined: Manoor Valley near Ansoo lake, alt. 3,198 m,
4.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 480 (HUP),
Jalkhad, alt. 3,199 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-
Islam 507 (HUP), Bahsal, alt. 3,359m, 11.08.2014, Asmat Ullah, Ashfaq Ahmad
and Mazhar-ul-Islam 526 (HUP), Lalazar, alt. 3,316 m, 11.09.2014, Asmat
Ullah, Amir Khan Afridi and Syed Juneed Shah 580 (HUP).
World Distribution: Asia, Europe, Africa (S. Africa, Morocco,
Algeria), C. America (Mexico), S. America, N. America, Australasia and
Antarctica.
Note: New to the study area.
5. Candelariella xanthostigma (Pers. ex Ach.) Lettau, Hedwigia 52: 196
(1912)
Thallus crustose, granules, dispersed evenly on substrate, occasionally
aggregate into thicker crust; granules 0.05-0.1 mm in diameter, rounded,
sometimes becomes elongate; upper surface smooth, green to yellow;
apothecia lecanorine, 0.4-0.7 mm wide; disc flat, dark yellow than thallus;
epihymenium yellow-brown; hymenium colourless, 60-70 µm tall;
hypothecium colourless; paraphyses cylindrical or swollen apically,
simple; asci: 16-24 spored, clavate; ascospores hyaline, ovoid to oblong,
simple to 1-septate, 7-11 x 3.0-4.0 µm.
Habitat: On bark (corticolous)
Spot Tests: K+ reddish, C-, KC-,
Secondary Metabolites (TLC): Calycin, pulvinic acid, and pulvinic
dilactone.
90
Specimen Examined: Manoor Valley near forest rest house, alt. 3,399
m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 444 (HUP),
Shogran, alt. 2,118 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed
Juneed Shah 696 (HUP).
World Distribution: Asia (Iran, Turkey, Mongolia), Europe (Spain
and Greece).
Note: New to the study area.
Fig. 4.10: Distribution of Candelariaceae in District Mansehra; 1. Behsal,
2. Jalkhad, 3. Lalazar, 4. Lake Saif-ul-Maluk, 5. Manoor Valley,
6. Paras, 7. Sharan, 8. Shogran, 9. Mandaghucha, 10. Dader, 11.
Batal, 12. Ooghi top.
Plate 3.4: Candelaria concolor (scale= 2 cm) in District Mansehra.
91
Plate 3.5: A. Candelariella aurella (scale= 1 cm), B Candelariella efflorescens, C. Candelariella reflexa (scale= 2 cm) in District Mansehra.
92
Plate 3.6: A. Candelariella vitellina (scale= 1 cm), B. Candelariella xanthostigma (scale= 2 cm) in District Mansehra.
93
5. Catilariaceae
Thallus Crustose; ascomata sessile, dark, with no thalline margin; asci 8 or
16 spored; ascospore colourless, aseptate or transversely septate. Habitat:
bark or rocks.
Genus in study area: The present study recorded single genus of the
family from District Mansehra (Fig. 4.11)
Catillaria A. Massal.
Thallus crustose, immersed, rimose, warted, areolate, or granular; upper
surface white, gray, green, or black, isidia and soredia absent; ascomata
apothecia, immersed to sessile, small, solitary or clustered; disc variously
coloured, round, concave to plane or convex, usually epruinose;
epihymenium colourless to black; hymenium colourless, 35-70 µm tall;
paraphyses simple or sparingly branched, septate; asci 8-spored, in some
species multispores, calvate to cylindrical, unitunicate, rather thick walled;
ascospores colourless, oblong-ellipsoid, ovoid or bean-shaped, 1-septate,
thin walled. Secondary metabolites: not detected. Substrate: on bark, rocks
or soil.
A total of 150 species of above genus was reported from the world.
Previously one species was reported from Pakistan while the present study
recorded one species as new to District Mansehra (Plate 3.7).
1. Catillaria lenticularis (Ach.) Th. Fr., Lich. Scand.: 567 1874
Thallus crustose, inconspicuous, thin to immersed; upper surface white, or
white gray, occasionally dark brown or olivaceous; apothecia numerous,
scattered or in small groups, sessile, 0.15-0.4mm in diameter; disc reddish
to dark brown, rarely black, flat to convex, usually epruinose;
epihymenium: pale to dark brown, granular, 6-15 µm thick; hymenium
94
colourless, 35-65 µm tall; hypothecium colourless; paraphyses simple,
rarely forked, apices capitate with dark brown cap; asci Catillaria type,
subcylindrical, 8-spored; ascospores hyaline, oblong or oblong-ellipsoid, 1-
septate, 7.5-10.5 x 2-3.5 µm.
Habitat: On rocks (Saxicolous)
Spot Tests: Thallus K-, C-, KC-, P,
Secondary Metabolites (TLC): None detected
Specimen examined: Dader, alt. 1,335 m, 08.11.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad 76 (HUP), Ghari Habibullah, alt. 932
m, 26.03 2014, Asmat Ullah and Amir Khan Afridi 206 (HUP).
World Distribution: Asia (Turkey, Palestine), Europe, Africa (S.
Africa, Algeria, Morocco), N. America (USA) S. America (Argentina),
Australasia (Australia).
Note: New to the study area.
Fig. 4.11: Distribution of Catillariaceae in District Mansehra; 1. Ghari Habibullah, 2. Dader.
95
Plate 3.7: Catillaria lenticularis (scale= 2 cm) in District Mansehra.
96
6. Cladoniaceae
Thallus crustose to squamulose (primary thallus), podetia hollow, erect
(secondary thallus); apothecia biatorine; ascospores colourless, unicellular.
Habitat: soil, wood, rocks Distribution: cosmopolitan in distribution.
Genus in study area: The present study recorded single genus
Cladonia from District Mansehra (Fig. 4.12).
Cladonia P.Browne
Thallus squamulose, or fruticose with inconspicuous squamules or foliose
with large squamules; squamules conspicuous to inconspicuous; upper
surface of squamules green, gray green or brown, not pruinose; lower
surface of squamules white, decaticate, smooth, without rhizines; ascomata
apothecia, at the apices of podetia, or on rims of cups, larger than
supporting stalk, red, pale or dark brown; hymenium red or dark
brown,30-70 µm tall; hypothecium pale to reddish; paraphysis slender,
simple or branched; asci 8-spored, cylindrical to clavate; ascospores
hyaline, simple, fusiform, oblong or ovoid. Secondary metabolites:
depsides, depsidones, dibenzofurans, aliphatic acid. Substrate: on soil,
wood, bark, over mosses.
The genus has a total of 450 species from world; previously eight species
are reported from Pakistan and four species from study area. The present
study recorded five species from District Mansehra (Plate 3.8 and Palte 3.9).
97
Key to species
1a. Podetia absent, only basal squamules present………………………...2
1a. Podetia present like erect points, branching or cup like……………...3
2a. Squamules, cushion forming, K-, Pd + red..........................C. caespiticia
2b Squamules tiny, P+ yellow, Pd+ orange...............................Cladonia sp.
3a. Upper urface covered in granules, poditia with
squamules………………………………………………...…..C. floerkeana
3b. upper Surface covered in flour like powder, podetia without
squamules…………………………………………………..…Cladonia sp.
4a. Podetia Cups simple, rarely proliferating,..............................................5
4b. Podetia Cups tapering, proliferating.......................................................6
5a. Cups often taller, up to 15mm in diameter…………………C. fimbriata
5b. Cup small, up to 5-7mm in diameter....................................Cladonia sp.
6a. Basal squamules small, separate, rounded often erect........C. pyxidata
6b. Basal squamules, spreading, overlapping, to form a
rosett………………………………………………………………..C. pocillum
98
1. Cladonia caespiticia (Pers.) Flörke, Clad. Comm.: 8 (1828)
Primary Thallus squamulose, 2-6.5 mm long, often irregularly incised and
erect; upper surface gray or brownish green; lower surface; white,
esorediate; podetia colourless or with a yellowish tinge, to 0.25 cm tall,
decorticate; apothecia inconspicuous, single, brown, sessile or on short pale
stalks, rounded or tuberculate, sessile or on short, broad pale stalks.
Habitat: On soil (tericolous)
Spot Tests: Thallus Pd+ red,
Secondary Metabolites (TLC): Fumarprotocetraric acid,
Specimen Examined: Dader, alt. 1,229 m, 08.11.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad 74 (HUP), Paras, alt. 1,467 m,
28.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 358 (HUP),
Manoor Valley near forest rest, alt. 2,600 m, 03.08.2014, Asmat Ullah, Ashfaq
Ahmad and Mazhar-ul-Islam 448 (HUP), Lalazar, alt. 3,162 m, 10.09.2014,
Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 553 (HUP).
World Distribution: Asia, Europe, Africa (S. Africa, Morocco,
Tanzania, Uganda), C. America (Mexico), N. America (Canada, USA) S.
America (Brazil, Guyana).
Note: A new record to Pakistan.
2. Cladonia fimbriata (L.) Fr., Lich. eur. reform. (Lund): 222 (1831)
Primary Thallus, squamulose, persistent, irregularly lobed, crenate to
sinuate; upper surface olive green; lower surface esorediate, or granular
sorediate, white; podetia green to whitish gray, 10-20 mm tall, unbranched,
at apices forming trumpet-shaped cup; cup 2-5 mm wide, surface ecorticate
or corticated at the base, soredia abundant, farinose; apothecia uncommon,
upto 1.5 mm diameter, brown; ascospores oblong, 7.5-13.5 x 3-4 µm.
99
Habitat: Rotten wood and tree (Corticolous)
Spot Tests: Cortex Pd+ red.
Secondary Metabolites (TLC): Fumarprotocetraric acid
Specimens Examined: Dader; alt. 1,200 m, 10.10.2013, Asmat Ullah, Syed
Muhammad and Amir Khan Afridi 10 (HUP), Manoor Valley near Forest rest
house, alt. 2,568 m, 03.08.2014, Asmat Ullah, Mazhar-ul-Islam and Ashfaq
Ahmad 450 (HUP), Lulusar lake, alt. 3,575 m, 11.08.2014, Asmat Ullah,
Mazhar-ul-Islam and Ashfaq Ahmad 541 (HUP), Lalazar Naran, alt. 3,100 m,
11.09.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 585 (HUP).
World Distribution: Asia, Europe, Africa (Morocco, S. Africa), C.
America (Mexico), N. America, S. America, Australasia, Pacific (Hawaii),
Caribbean (Bahamas, Bermuda, Guadeloupe), Antarctica.
Note: New to the study area.
3. Cladonia floerkeana (Fr.) Flörke, De Cladonia's uit de sectie
Cocciferae in België (morfologie, chemie, ecologie, sociologie,
verspreiding en systematiek) 2. Ph.D. Thesis (Wilrijk): 99 (1828)
Primary thallus squamulose, persistent, small to 1.8 mm long; upper
surface olive gray, lower surface white, esorediate; podetia pale to dark
grey, to 2 cm tall, often shorter, simple or sometimes sparingly branched
near apices, completely corticated or becoming partially decorticate
particularly toward apices; apothecia abundant.
Habitat: On soil (Tericolous)
Spot Test: Thallus K-, P-,
Secondary Metabolites (TLC): Barbatic acid
100
Specimen Examined: Dader, alt. 1,233 m, 08.11.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad 79 (HUP), Kaghan, alt. 2,509 m,
29.07. 2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 375 (HUP),
Manoor Valley, alt. 2,605 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and
Mazhar-ul-Islam 478 (HUP), Lalazar, alt. 3,053 m, 11.09.2014, Asmat Ullah,
Amir Khan Afridi and Syed Juneed Shah 588 (HUP), Shogran, alt. 2,540 m,
26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 714 (HUP).
World Distribution: Asia, Europe (Denmark, Finland, Greenland,
Iceland), Africa, Australasia (Australia, New Zealand) N. America, S.
America.
Note: A new to Pakistan.
4. Cladonia pocillum (Ach.) O.J. Rich., Catal. Lich. Deux-Sèvres: 8
(1877)
Primary thallus squamulose; squamules well developed, imbricate or
contiguous, rosette; upper surface green, green brown sometimes dark
brown; lower surface white, not sorediate; podetia to 20 mm tall, cup
forming, at the center of thallus, simple not proliferating; cups wider than
podetia, 0.8-4.5 mm in diameter; apothecia on margin of cups, brown.
Habitat: On thin soil (Tericolous)
Spot Tests: Cortex Pd + red
Secondary Metabolites (TLC): Fumarprotocetraric acid, atranorine
Specimen Examined: Dader, alt. 1,221 m, 08.11.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad 84 (HUP), Manoor valley near Bahari
guset house, alt. 2,572 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and
Mazhar-ul-Islam 495 (HUP), Lolosar lake, alt. 3,544 m, 11.08.2014, Asmat
Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 546 (HUP), Lalazar Naran, alt.
101
3,042 m, 11.09.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 587
(HUP).
World Distribution: Asia, Europe, Africa (S. Africa, Algeria,
Morocco), C. America (Mexico, Guatemala), N. America, S. America,
Australasia (New Zealand), Antarctica.
Note: New to the study area.
5. Cladonia pyxidata (L.) Hoffm., Deutschl. Fl., Zweiter Theil
(Erlangen): 121 (1796) [1795]
Primary thallus squamulose, persistent, up to 2-4.5 mm long, irregularly
lobed or incised, lobes, mostly ascending; upper surface pale olive green;
lower surface white, esorediate; podetia gray toolive green or brown, 2.5 -
22 mm tall, forming cup; cup 8-11.5 mm wide, usually simple, surface
corticated or ecorticate; apothecia common, brown, up to 8 mm wide, on 3
mm long stalk; ascospores oblong-ellipsoid, 12-16 x 3-4 µm.
Habitat: On soil (Tericolous).
Spot Test: Cortex K-, KC-, Pd+ red.
Secondary Metabolites (TLC): Fumarprotocetraric acid
Specimens Examined: Dader, alt. 1,210 m, 10.10.13, Asmat Ullah, Syed
Muhammad and Amir Khan Afridi 29 (HUP), Paras, alt. 1,838 m, 28.07.2014,
Asmat Ullah, Syed Mushraf Shah and Amir Khan Afridi 360 (HUP), Lulusar
Lake, alt. 3,487 m, 11.08.2014, AsmatUllah, Mazhar-ul-Islam and Ashfaq
Ahmad 540 (HUP), Lalazar Naran, alt. 2,983 m, 10. 09. 2014, Asmat Ullah,
Syed Juneed Shah, Amir Khan Afridi 58 (HUP), Paras (other side of river
Kunhar), alt. 1,765 m, 08.07.2015, Asmat Ullah, Syed Juneed Shah and Amir
Afridi 650 (HUP).
102
World Distribution: Asia, Europe, Africa, C. America (Guatemala,
Mexico), N. America, A. America, Australasia (Australia, New Zealand),
Pacific (Marquesas) Antarctica.
Fig. 4.12: Distribution of Cladoniaceae in District Mansehra: 1. Lulusar lake. 2. Lalazar, 3. Kaghan, 4. Manoor Valley, 5. Shogran, 6. Paras, 7. Sharan.
103
Plate 3.8: A. Cladonia caespiticia, B. Cladonia fimbriata, C. Cladonia floerkeana (scale= 2 cm) in District Mansehra.
104
Plate 3.9: A. Cladonia pocillum, B. Cladonia pyxidata (scale= 2cm) in District Mansehra.
105
7. Collemataceae
Thallus foliose or squamulose, rarely shrubby or crustose, gelatinous when
wet, corticated or pseudo-corticated, sometime with rhizine; apothecia,
immersed or sessile, partly closed or open, thalline margin present
sometimes; ascus usually 4-8 spores; spores muriform, septate or rarely
simple. Secondary metabolites not detected. Habitat: rocks, bark and soil.
Didtribution: widespread.
Genus in study area: The present study recorded two genus; Collema
and Leptogium from District Mansehra (Fig. 4.13).
Key to genera
1a. Thallus with true cortex, not swells much when moist………...Leptogium
1b. Thallus with pseudocortex, swell much …………………………...Collema
Collema F. H. Wigg.
Thallus gelatinous, mainly foliose or squamulose lobate; lobes rounded,
branched to elongated, deeply divided or indistinct; upper surface dark
olive to brown black, smooth, or wrinkled to pustulose, occasionally
pruinose, isidia: present or absent, soredia absent; lower surface olive or
paler than upper surface, smooth, attached to substratum by hapters or
rarely by white rhizines; ascomata absent or present; apothecia, immersed,
laminal or marginal, orbicular; disc red brown, pale brown or black brown;
hymenium hyaline; paraphyses straight, simple or branched, clavate to
globose, apical cell usually thickened, occasionally yellow to reddish
brown; asci 4-8 spored, narrowly clavate to clavate; ascospores hyaline,
submuriform or muriform, sometimes spirally, ellipsoid, broad ellipsoid,
globose. Secondary metabolites none detected. Substrate: bark, wood,
rocks, plant debris, soil and mosses.
106
The genus has a total of 82 species recorded from world. Previously seven
species are reported from Pakistan while the present study recorded three
species as new to District Mansehra (Plate 3.10).
Keys to species
1a. Thallus ridged and/or postulate………………………………………..2
1b. Thallus not ridged, not postulate……………………………………….3
2a. Isidia rounded scale like, thallus ridged………………..….C. flaccidum
2b. Isidia cylindrical, thallus ridged and postulate………...C. furfuraceum
3a. Thallus lobes appressed, spreading, slightly or not ascending, isidia
small…………………………………………………….….C. subflaccidum
3b. Thallus lobes ascending, crowded, isidia large…………….Collema sp.
1. Collema flaccidum (Ach.) Ach., Lich. univ.: 647 (1810)
Thallus foliose, 2.5-5.5 cm wide, loosely attached, thin, membrane like,
lobate; lobes rounded, few, thin, not swollen, imbricate, radially or
irregularly folded, 0.5-1.5 cm wide; upper surface black, usually dull, not
pruinose, smooth to slightly postulate, isidia numerous, crowded on
surface and margins, concolourous, flattened or scale; lower surface brown
black, without rhizines or hairs; apothecia rare, sessile, laminal, 1.5-2.0 mm
diameter; disc flat, brown; hymenium colourless, 95-130 µm tall; asci 8-
spored, clavate; ascospores colourless, ellipsoid to fusiform, 23-32 x 5-6 µm.
Habitat: On bark (Corticolous)
Spot Tests: All negative.
Secondary Metabolites (TLC): None detected
107
Specimens Examined: Paras, alt. 1,655 m, 28.07.2014, Asmat Ullah, Syed,
Mushraf Shah and Amir Khan Afridi 356 (HUP), Kaghan on way Naran, alt.
2,081 m, 29.07.2014, Asmat Ullah, Syed Juneed Shah and Amir Khan Afridi 370
(HUP), Manoor Valley near forest rest house, alt. 2,564 m, 03.08.2014, Asmat
Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 440 (HUP), Shogran on track to
Saripya, alt. 2,617 m, 27.07.2015, Asmat Ullah, Syed Juneed Shah and Amir
Khan Afridi 700 (HUP).
World Distribution: Asia, Europe, Africa (Mozambique, Socota), N.
America (USA, Canada), S. America, Caribbean, Pacific (Tahiti, Hawaii),
Australia and Antarctica.
Note: New to the study area.
2. Collema furfuraceum (Arnold) Du Rietz, Ark. Bot. 22A, 13: 3 (1929).
Thallus foliose, spreading, closely adnate, thin, membrane like, 3-7 mm in
diameter, deeply and broadly lobate; lobes 0.3-0.7 cm broad, thin, 65-95 µm
thick, rounded or extended, overlapping; upper surface dark olivaceous to
brownish black, markedly ridged; isidia cylindrical, 0.05-0.1 mm broad, up
to 0.3 mm long, simple or branched; lower surface paler than upper surface
or dark olive green to black, smooth; apothecia rare, 0.5-1.5 mm in
diameter, laminal; disc brown, flat; hymenium; asci 8-spored, clavate;
ascospores 4-5 sepatate, colourless, fusiform to acicular, 40-75- x 3-5.5 µm.
Habitat: On bark (Corticolous)
Spot Tests: All negative.
Secondary Metabolites (TLC): None detected
Specimens Examined: Paras, alt. 1,622 m, 28.07.2014, Asmat Ullah, Amir
Khan Afridi and Syed Mushraf Shah 351 (HUP), Naran, alt. 2,565 m,
29.07.2014, Asmat Ullah, Amir Afridi and Syed Juneed Shah 379 (HUP),
108
Manoor Valley near forest rest house, alt. 2,696 m, 03.08.2014, Asmat Ullah,
Ashfaq Ahmad and Mazhar-ul-Islam, 451 (HUP), Shogran, alt. 2,316 m,
26.07.2015, Asmat Ullah, Amir Afridi and Syed Juneed Shah, 661 (HUP); on
track to Saripaya, alt. 2,600 m, 27.07.2015, Asmat Ullah, Amir Afridi and Syed
Juneed Shah 702 (HUP).
World Distribution: Asia, Europe, Africa (E. Africa, Morocco), N.
America, S. America (Chile, Brazil), Hawaii.
Note: New to the study area.
3. Collema subflaccidum Degel., Symb. bot. upsal. 20(no. 2): 140 (1974)
Thallus foliose, loosely attached, 3.0-5.5 cm wide, thick, lobate; lobes few,
rounded, imbricate, 0.7-1.5 cm wide, thin; upper surface dark olive-green,
black, dull, smooth, epruinose; isidia spreading over lobes, numerous,
laminal, simple, globose to cylindrical; lower surface grey to black;
apothecia rare, scattered, laminal, upto 2mm in diameter; disc reddish
brown, flat; hymenium colourless, 85-125 µm tall; asci: 8-spored, clavate;
ascospores colourless, fusiform, 5-7-septate, 40-60 x 4-6 µm.
Habitat: Mostly on bark (Corticolous)
Spot Tests: All negative.
Secondary Metabolites (TLC): None detected
Specimens Examined: Dader, alt. 1,233 m, 11.10.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad 21 (HUP), Shinkiari, alt. 1,121 m,
10.11.2013, Asmat Ullah Shinkiari Amir Khan Afridi 98 (HUP), Oghi top, alt.
1,574 m, 14.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleen Shah 221
(HUP), Near Paras, alt. 1,610 m, 28.07.2014, Asmat Ullah, Amir Afridi and
Syed Mushraf Shah 329 (HUP), on way to Manoor Valley, 1,823 m,
03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 441 (HUP).
109
World Distribution: Asia (India), Europe, Africa, C. America
(Mexico). N. America, Australasia (Australia, New Zealand), Hawaii
Note: New to the study area.
Leptogium Gray,
Thallus foliose to squamulose, rarely shrubby, gelatinous, lobate; lobes
variable, separate or occasionally imbricate, elongate or short, 3-15 mm
wide; apices rotund to oblong; upper surface blue gray to brown or black,
dull or shiny, smooth or often strongly wrinkled, occasionally with isidia,
phyllidia or lobules, but pseudocyphellae and soredia absent; lower surface
smooth or wrinkled, hair present, sometimes with scattered tufts of
rhizines or hapters; ascomata apothecia, laminal, sessile to shortly stalked;
disc brown or red brown, concave to flat, not pruinose; epihymenium
colourless to reddish brown; hymenium colourless; hypothecium
colourless or pale yellowish. Secondary metabolites: none. Substrate: on
bark, rocks sometimes on soil, often among mosses.
The genus has a total of 180 species from world while previously seven
species are reported from Pakistan and five species from study area. The
present study recorded four species from District Mansehra (Plate 3.11).
Key to species
1a. Thallus isidiate……………………………………………………............2
1b. Thallus not isidiate……………………………………………..……...…4
2a. Lobes lower surface without white gray tomentum…….L. cyanescens
2b. Lobes lower surface with white gray tomentum………………...……3
3a. Isidia granular, thallus oliveoues black…………………...L. saturnium
3b. Isidia cylindrical coroliod, thallus blue gray…………….....L. burnetiae
110
4a. Spores ellipsoid, thallus slightly wrinkled…………...…L. hildenbrandi
4b. Spores fusiform, thallus strongly wrinkled…………...…Leptogium sp.
1. Leptogium burnetiae C.W. Dodge, Beih. Nova Hedwigia 12: 120
(1964)
Thallus foliose, loosely adnate, lobate, 3-9.5 cm in diameter; lobes 3-12 mm
wide, elongate, plane, separate, apices rotund; upper surface gray to bluish
gray, dull to shiny, isidiate; isidia usually laminal to marginal, scattered to
dense, concolourous or darker than thallus, simple or branched, often
clustered; lower surface smooth, with dense white tomentum of cylindrical
hairs; apothecia rare, 0.5-2.0 mm in diameter, laminal; disc brown, plane to
convex; hymenium 95-130 µm tall; paraphysis unbranched; asci 8-spored,
clavate; ascospores colourless, ellipsoid to subfusiform, 28.5-43.5 x 11-17.5
µm in diameter.
Habitat: On bark (Corticolous)
Spot Test: All negative
Secondary Metabolites (TLC): None detected
Specimens Examined: Naran, alt. 2,815 m, 29.07.2014, Asmat Ullah,
Amir Khan Afridi and Syed Juneed Shah 371 (HUP), Manoor Valley, alt. 2,488
m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Isalam 443 (HUP),
Lalazar, alt. 2,863 m, 11.09.2014, Asmat Ullah, Amir Khan Afridi and Syed
Juneed Shah, 582 (HUP), Shogran, alt. 2,390 m, 26.07.2015, Asmat Ullah, Amir
Khan Afridi and Syed Juneed Shah 662 (HUP), on way to Saripaya, alt. 2,568
m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 710
(HUP).
World Distribution: Europe, Africa, Asia, North America.
Note: New to the study area.
111
2. Leptogium cyanescens (Rabenh.) Körb., Syst. lich. germ. (Breslau):
420 (1855)
Thallus foliose, adnate, 2.5-7.0 cm in diameter, lobate; lobes irregular,
elongate, surface smooth, separate, 2-3.5 mm wide, apices: rotund, entire,
occasionally upturned;, upper surface pale bluish gray, smooth to
somewhat wrinkled, isidia abundant, laminal to marginal, cylindrical or
flattened, concolourous with thallus; lower surface pale gray, smooth, with
scattered tuft of white hairs; apothecia rare, sessile or shortly stalked; disc
brown, concave to plane; hymenium 90-120 µm tall; asci 8-spored, clavate;
ascospores colourless, ellipsoid to fusiform, 17-22 x 6.5-9.5 µm. not seen in
study specimen.
Habitat: On bark (Corticolous)
Spot Test: All negative
Secondary Metabolites (TLC): None detected
Specimens Examined: On way to Manoor Valley, alt. 2,568 m,
03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 445 (HUP),
Shogran, alt. 2,319 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed
Juneed Shah 663 (HUP), on way to Saripaya, alt. 2,520 m, 27.07.2015, Asmat
Ullah, Amir Khan Afridi and Syed Juneed Shah, 713 (HUP).
World Distribution: Asia, Europe, Africa, N. America, C. America
(Panama, Mexico, Guatemala), N. America, Australasia, Pacific.
3. Leptogium hildenbrandii (Garov.) Nyl., Act. Soc. linn. Bordeaux 21:
272 (1856)
Thallus foliose, 5-8.5 cm in diameter, rosette-forming, lobate; lobes to 0.5
mm, more or less imbricate, partly overlapping rather thick, apices round;
upper surface deep blue or black gray, irregularly wrinkled and striate;
lower surface white, tomentose with thick rhizine tufts; apothecia 2-2.5 mm
112
in diameter, abundant, laminal, immersed when young, become emergent;
disc red brown; exciple: thin, brown-grayish; ascospores 15-23.5 x 8-10 µm,
muriform.
Habitat: On trees trunk (Corticolous)
Spot Tests: All negative
Secondary Metabolites (TLC): None detected
Specimen Examined: Dader, alt. 1,257 m, 08.11.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad, 75 (HUP), Near Paras, alt. 1,543 m,
27.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 330
(HUP), Naran, alt. 2,791 m, 29.07.2014, Asmat Ullah, Amir Afridi and Syed
Juneed Shah 375 (HUP), on way from Naran to Jalkhad, alt. 2,547 m,
10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 509 (HUP),
Lalazar, alt. 2,922 m, 11.09.2014, Asmat Ullah, Amir Khan Afridi and Syed
Juneed Shah 589 (HUP).
World Distribution: Asia, Europe (Scotland), North America, Africa
4. Leptogium saturninum (Dicks.) Nyl., Act. Soc. linn. Bordeaux 21: 272
(1856)
Thallus foliose, orbicular, 2-7.5 cm in diameter, lobate; lobes 2-8.5 mm
wide, regularly rounded; upper surface dark olive-black, usually dull,
isidia: laminal scattered to dense, usually granular; lower surface paler,
with white tomental hairs; apothecia rare, to 1.5-2.0 mm diameter;
ascospores ellipsoid, colourless, muriform, 19-23.5 x 8-10 µm.
Habitat: On bark (Corticolus)
Spot Tests: All negative
Secondary Metabolites (TLC): None detected
113
Specimen Examined: Naran, alt. 2,550 m, 29.07.2014, Asmat Ullah,
Amir Khan Afridi and Syed Juneed Shah 376 (HUP), Manoor Valley, alt. 2,572
m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 452 (HUP),
on way to Saripya, alt. 2,622 m, 02.04.2015, Asmat Ullah, Amir Khan Afridi
and Syed Juneed Shah 715 (HUP).
World Distribution: Asia, Europe (Scotland), N. America, Africa (S.
Africa, Morocco), C. America (Mexico), N. America, S. America (Chile),
Caribbean, Australasia, Pacific (Hawaii).
Fig. 4.13: Distribution of Collemataceae in District Mansehra: 1. Lalazar, 2. Naran, 3. Manoor Valley near forest rest house, 4. Kaghan on way Naran, 5. Paras, 6. Shogran on track to Saripya, 7. Dader, Ooghi top.
114
Plate 3.10: A. Collema flaccidum B. Collema furfuraceum, C. Collema subflaccidum (scale= 2 cm) in District Mansehra.
115
Plate 3.11: A. Leptogium burnetiae, B. Leptogium cyanescens, C. Leptogium hildenbrandii, D. Leptogium saturninum
(Scale= 2cm) in District Mansehra.
116
8. Graphidaceae
Thallus crustose, cortex absent or amorphous, attached to the substratum
by hyphae. Apothecia simple or branched, usually more or less immersed,
lirellifom or roundish, single or aggregate, spores colourless or brown,
septate to muriform. Habitat: trees, Distribution: Temperate to tropical.
Genus in study area: The present study reported single genus of
family from District Mansehra (Fig. 4.14).
Graphis Adans.
Thallus crustose, continuous, immersed, rimose to areolate; upper surface
white, pale gray, dull, occasionally pale yellow to olive green, without
isidia or soralia; ascomata apothecia, immersed, lirellate, simple,
branched or stellate; disc dark brown, smooth, often with whitish pruina
true exciple usually black, opaque, prominent and well developed;
hymenium colourless, 55-285 µm tall; paraphyses parallel, tip pale brown,
weakly branched, rarely hyaline; asci clavate to subcylindrical, 1-8-spored;
ascospores colourless but sometimes pale brown, submuriform or
muriform, oblong with rounded end. Secondary metabolites: none
detected. Substrate: On bark but sometimes on rocks or other substrats.
The genus has a total of 320 species from world and previously three
species are reported from Pakistan. The present study recorded two species
as new to District Mansehra (Plat 3.12).
Keys to species
1a. Thallus K+ red, spore thin walled…………………………...G. eleganas
1b. Thallus K-, spore thin walled……………………………………………2
2a. Lirellate black, disc narrow…………………………………….G. scripta
117
2b. Lirellat white, disc slit like……………………………………Graphis sp.
1. Graphis elegans (Borrer ex Sm.) Ach., Syn. meth. lich. (Lund): 85
(1814)
Thallus crustose, continuous; surface whitish green to green gray, dull or
slightly shiny, smooth to uneven, without isidia and soralia; apothecia
lirellate, raised from thallus, simple or branched, straight or curved;
lirellae 1-3.5 x 0.25-5; disc slit like, mostly narrow and not visible;
epihymenium brown, 5-8.5µm high; hymenium colourless, not inspersed,
90-110 µm thick; asci clavate, 8-spored, 90-125 x 20-30 µm; ascospores
colourless, fusiform-cylindrical, transversel septate, 10-13 locular, 32-65 x 8-
15 µm in diameter.
Habitat: On bark (Corticolous)
Spot test: Thallus K+ red, Pd+ orange,
Secondary metabolites (TLC): Connorstictic acid, Norstictic acid,
Specimen examined: Manoor Valley, alt. 2,552 m, 03.08.2014, Asmat
Ullah, Ashfaq Ahmad and Mazhar-ul-Isalm 453 (HUP).
World Distribution: Asia (Pakistan), Europe, Papa New Guinea
Note: New to study area
2. Graphis scripta (L.) Ach., K. Vetensk-Acad. Nya Handl. 30: 145
(1809)
Thallus crustose, smooth or slightly uneven; upper surface whitish green to
green-gray, dull; apothecia lirellate, raised from the thallus; lirellae 1-2.5 x
0.1-0.3 mm, oblong, flexuous and branched; disc narrow, dark gray to
brown, whitish pruinose; exciple: poorly developed; epihymenium brown,
4-9 µm thick; hymenium 80-95 µm tall, not inspersed; paraphyses 1.0-1.5
118
thick, tip brown or yellowish brown; asci clavate, 8-spored, 80-90 x 15-20
µm; ascospores fusiform-cylindrical, 25-55 x 6.5-10 µm, 7-10 septate.
Habitat: On bark (Corticolous)
Spot tests: K-, C-, KC-, Pd-,
Secondary metabolites (TLC): None detected,
Specimen examined: Manoor Valley, alt. 2,659 m, 03.08.2014, Asmat
Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 447 (HUP); On track to Saripaya,
alt. 2,708 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah
705 (HUP).
World distribution: Asia, Europe, N. America, S. America, Africa,
Note: New to study area.
Fig. 4.14: Distribution of Graphidacea in District Mansehra; 1.Manoor Valley, 2. On track to Saripaya.
119
Plate 3.12: A. Graphis elegans, B. Graphis scripta (Scale= 2 cm) in District Mansehra.
120
9. Lecanoraceae
Thallus crustose or squamulose, corticated or non-corticated, attached to
substratum by hyphae; apothecia lecanorine; asci 8-spored; spores
colourless, unicellular or septate. Habitat: rocks, soil and trees.
Distribution: cosmopolitan.
Genera in study area: In the present study three genus of family were
recorded from District Mansehra (Fig. 4.15).
Key to Genera
1a. Thallus Squamulose, apothecia rounded to irregular, immersed to
sessile……………………………………………………………Rhizoplaca
1b. Thallus Crustose or Leprose…………………………………………….2
2a. Apothecia sessile or rarely immersed, disc variously colored,
pruinose or epruinose…………………………………………....Lecanora
2b. apothecia sessile, constricted at base, disc brown-black, plane to
strongly convex…………………………………………………...Lecidella
Lecanora Ach.
Thallus crustose, granular, areolate, or placodioid or peltate, rarely
immersed; prothallus: blackish brown, whitish gray, or not visible; surface
white, gray, yellow or brown, with or without soredia, isidia absent;
ascomata apothecia, sessile or rarely immersed; disc variously coloured,
pruinose or epruinose; hypothecium colourless or pigmented;
epihymenium pigmented, with or without crystal; hymenium colourless;
hypothecium colourless or pale; paraphyses simple or apically branched,
apices slightly swollen to capitate; asci Lecanora-type, clavate, 8-spored;
ascospores colorless, simple, ellipsoid to subglobose, rounded at apices.
121
Secondary metabolites: usnic acid, atranorin, xanthones. Substrate: rock,
barks
This lichen genus is cosmopolition in distribution consisting of 600 member
species from world. Previously 32 species are reported from Pakistan
while the present study reported 10 species from District Mansehra (Plate
3.13 and Plate 3.14).
Key to species:
1a. Thallus K+ yellow, whitish gray or yellow green…………………......2
1b. Thallus K-, whitish or yellowish green …………………………….......7
2a. Apothecia disc pruinose…………………………………………………3
2b. Apothecia dis epruinose or slightly pruinose…………………..……..4
3a. Apothecia disc whitish or grayish pruinose, apothecia
sessile………………………………………………………...…...L.rupicola
3b. Apothecia disc bluish pruinose, apothecia constricted at
base………………………………………………………….…Lecanora sp.
4a. Epihymenium brown, crystal abundant…………..……...…..L. censisia
4b. Epihymenium red brown or dark brown ……………………...………5
5a. Apothecia disc dark brown, epihymenium with few
crystals…………………..……………………………………..L. argentata
5b Apothecia sisc red brown, epihymenium lacking crystal…………….6
6a. Thallus dispersed areolate…………………………………L. pseudistera
6b. Thallus granular verrucose…………………………………Lecanora sp
7a. Apothecia lecanorine, sporee broadly ellipspoid…….……L. polytrapa
122
7b. Apothecia biatorine, spores narrowly ellipsoid……….….Lecanora sp.
8a. on calciferous rock………………………………………….……,………9
8b. On soil, bark or mosses……………………………………...……….…10
9a. Apothecia margin thick, often discontinuous……………Lecanora sp.
9b. Apothecia margin thin or thick, not discontioous……….….L. dispersa
10a. Apothecia Pd+ red orange…………………………………...…………11
10b. Apothecia Pd-…………………………………………………..………..12
11a. Apothecia 0.4-1.5 mm in diameter………………………….......L. albella
11b. Apothecia 0.7-3.0 mm in diameter………………………….Lecanora sp.
12a. Epihymenium egranulose…………………………………...…………13
12b. Epihymenium granulose…………………………………….…………14
13a. Apothocia large, constricted at base………………………..L. allophana
13b. Apothecia small, adnate……………………………………..Lecanora sp.
14a. Epihymenium with fine granules……………………………...………15
14b. Epihymenium with coarse gtanules……………………………..……16
15a. Apothecia dark brown to red brown………………………...L. pulicaris
15b. Apothecia orange brown …………………………………....Lecanora sp.
16a. Thallus smooth to verrucose, apothecia margin
smooth……………………………………….………………...L. chlarotera
16b. Thallus verrucose to granulose, apothecia margin
verrucose………………………………………………………….Lecanora sp.
123
1. Lecanora albella (Pers.) Ach., Lich. univ.: 369 (1810)
Thallus crustose, continous or rimose-areolate; prothallus present, white;
areoles flat, opaque, thin, ecorticate; upper surface pale to medium gray,
smooth, epruinose, esorediate; apothecia lecanorine, sessile, dispersed to
closely aggregate, 0.4-1.5 mm in diameter; disc yellowish brown or pale
pink, flat to convex, pruinose; epihymenium brown to dark brown,
interspersed with granules dissolving in K; hymenium colourless, clear, 60-
80 µm tall; paraphyses apically slightly thickened, not pigmented;
hypothecium colourless, without oil droplets; asci 8-spored, clavate;
ascospores colourless, ellipsoid, simple, 10-13.5 x 6.5-8.5 µm.
Habitat: On bark (Corticolous)
Spot Tests: K+ yellow, Pd+ orange to red,
Secondary Metabolites (TLC): Atranorine, Chloroatranorin, Norstictic
acid, Protocetraric acid, Salazinic acid,
Stictic acid,
Specimen Examined: Batal, alt. 1,700 m, 02.02.2014, Asmat Ullah and
Mazhar ul Islam 179 (HUP), Manoor Valley near forest rest house, alt. 2,549
m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-islam 449 (HUP),
Shogran, alt. 2,289 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed
Juneed Shah 667 (HUP).
World Distribution: Asia, Europe, Africa (S. Africa, Algeria,
Morocco), C. America (Mexico), N. America (USA), S. America (Chile,
Brazil), Hawaii.
Note: New to the study area.
2. Lecanora allophana (Ach.) Nyl., Flora, Regensburg 55: 250 (1872)
124
Thallus crustose, continuous or verrucose-areolate; areoles flat or
verruculose, opaque, thin or thick, ecorticate; surface yellowish white to
yellowish gray, smooth or rough, epruinose; apothecia lecanorine, 0.6-2.5
mm in diameter; disc red brown, plane, epruinose; epihymenium red-
brown to orange-brown, without crystals; hymenium colourless;
paraphyses slightly thickened apically; hypothecium colourless, without
oil droplets; asci 8-spored, clavate; ascospores colourless ellipsoid, simple,
15.5- 19.5 x 8.0-11.0 µm.
Habitat: On wood and bark (Corticolous)
Spot Tests: K+ yellow, Pd- or Pd+pale yellow
Secondary Metabolites (TLC): Atranorin, Chloroatranorin.
Specimens Examined: Shinkari near forest college rest house, alt. 1,352
m, 10.11.13, Asmat Ullah and Amir Khan Afridi 97 (HUP), near Batal, alt.
1,555 m, 02.02.2014, Asmat Ullah and Mazhar-ul-Islam 180 (HUP), Kaghan,
alt. 2,339 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah
377 (HUP), Manoor Valley, alt. 2,600 m, 04.08.2014, Asmat Ullah, Ashfaq
Ahmad and Mazhar-ul-Islam , 481 (HUP), Shogran, alt. 2,368 m, 26.07.2015,
Asmat Ullah, Amir Afridi and Syed Juneed Shah 669 (HUP).
World Distribution: Asia, Europe, Africa (S. Africa, Morocco), C.
America (Mexico), N. America (Canada, USA), S. America (Argentina),
Pacific (Hawaii, Tuamotu)
3. Lecanora argentata (Ach.) Röhl., Deutschl. Fl. (Frankfurt) 3(2): 82
(1813)
Thallus crustose, continuous or rimose-areolate; prothallus white, well
developed; areoles flat, thin, opaque, ecorticate; surface yellow-to green-
white, smooth, epruinose; apothecia lecanorine, sessile, 0.5-1.5 mm in
diameter; disc red brown, plane, epruinose; epihymenium red-brown to
125
orange-brown, without crystals; hymenium colourless, clear; paraphyses
red-brown to orange-brown, thickened or capitate apically; hypothecium
colourless, without oil droplets; asci 8-spored, clavate, 44-50 x 18-21 µm;
ascospores colourless, ellipsoid, simple, 11-15 x 6.5-8.6 µm.
Habitat: On wood and bark (Corticolous)
Spot Test: Thallus K+ yellow, Pd+ yellow.
Secondary Metabolites (TLC): Atranorin, Chloroatranorin,
Specimens Examined: On way to Naran, alt. 2,478 m, 29.07.2014, Asmat
Ullah, Amir Khan Afridi and Syed Juneed Shah 378 (HUP), On way to Manoor
Valley, alt. 2,395 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-
Islam 455 (HUP), Shogran, alt. 2,313 m, Asmat Ullah, Amir Khan Afridi and
Syed Juneed Shah 670 (HUP), Saripaya, alt. 2,531 m, Asmat Ullah, Amir Afridi
and Syed Juneed Shah 752 (HUP).
World Distribution: Asia, Europe, Africa (S. Africa, Algeria), C.
America (Mexico, Guatemala), N. America (USA), S. America (Brazil),
Australasia (New Zealand, Australia).
4. Lecanora cenisia Ach., Lich. univ.: 361 (1810)
Thallus crustose, continous or verrucose-areolate; areoles flat or verrucose,
thin or thick, ecorticate; upper surface yellowish whitish to yrllowish gray,
smooth or rough, epruinose; apothecia lecanorine, sessile, strongly
constricted below, 0.5-1.2 mm in diameter; disc red brown or dark brown
to gray-brown, plane, sometimes white pruinose; epihymenium red-brown
to orange-brown, with granules dissolving in K; hymenium clear, 60-90 µm
tall; paraphyses apically slightly swollen, not pigmented; hypothecium
colourless, without oil droplets; asci 8-spored, clavate; ascospores
colourless, broadly ellipsoid, simple, 9-17 x 6.5-8.5 µm.
126
Habitat: On rocks (Saxicolous)
Spot Tests: K+ yellow, C-, KC-, Pd-
Secondary Metabolites (TLC): Atranorine, Chloroatranorine
Specimen Examined: Dader, alt. 1,360 m, 11.10.2013, Asmat Ullah,
Amir Khan Afridi and Malik Zahir 37 (HUP), Mandagucha, alt. 1,309 m,
13.11.2013, Asmat Ullah and Mazhar-ul-Islam, 106 (HUP), Oghi, alt. 1,586 m,
14.04.2014, Asmat Ullah, Amir Afridi and Kaleem Shah 231 (HUP), Hasa
Balakot, alt. 1,152 m, 25.05.2014, Asmat Ullah, Amir Khan Afridi and Syed
Mushraf Shah 281 (HUP).
World Distribution: Asia, Europe, Africa (Morocco), C. America
(Mexico), N. America, S. America (Argentina), C. America (Mexico)
Hawaii.
Note: New to the study area
5. Lecanora chlarotera Nyl., Bull. Soc. linn. Normandie, sér. 2 6: 274
(1872)
Thallus crustose, continuous or rimose-areolate or verrucose-areolate;
areoles flat, thin or thick, ecorticate; upper surface pale gray or sometimes
yellow gray, smooth or rough, epruinose; apothecia lecanorine, often
aggregated, sessile, 0.4-1.0 mm diameter; disc red-brown or orange-brown,
flat, epruinose; epihymenium red-brown to orange-brown; hymenium
colourless, clear; paraphyses simple or sparsely branched, thickened
apically, not pigmented; hypothecium colourless, without oil droplets; asci:
8-spored, subcylindrical to elongate-clavate, 65-80 x 10-15 µm; ascospores
colourless, ellipsoid or broadly ellipsoid, simple, 12.5-14.5 5.5-7 µm.
Habitat: On bark, wood (Corticolous)
127
Spot Tests: Thallus K+yellow, Pd- or Pd + orange to
red
Secondary Metabolites (TLC): Atranorine, Chloroatranorin,
Specimen Examined: Kaghan, alt. 2,192 m, 29.07.2014, Asmat Ullah,
Amir Khan Afridi and Syed Juneed Shah 380 (HUP), On way to Ansoo Lake,
alt. 2,914 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 497
(HUP), near Batakundi, alt. 2,866 m, 01.10.2014, Asmat Ullah, Amir Khan
Afridi and Syed Juneed Shah 626 (HUP), Shogran, alt. 2,331 m, 26.07.2015,
Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 674 (HUP).
World Distribution: Asia, Europe, Africa (S. Africa, Morocco), C.
America (Mexico), N. America, S. America, Caribbean, Hawaii.
Note: A new record to Pakistan.
6. Lecanora dispersa (Pers.) Röhl., Deutschl. Fl. (Frankfurt) 3(2): 96
(1813)
Thallus crustose, immersed or occasionally consisting of scattered granules;
upper surface white to pale gray; apothecia scattered or aggregated into
group, sessile, constricted below, 0.2-1.0 mm in diameter; disc pale brown,
dark brown, smooth, epruinose; epihymenium yellow or brown, densely
interspersed with granule; hymenium colourless, 65-95 µm tall; paraphyses
branched, apices swollen, brownish; hypothecium colourless; asci 8-
spored, clavate; ascospores colourless, ellipsoid, simple, 7.5-11.5 x 3.5-5.5
µm.
Habitat: On rocks (Saxicolous)
Spot Tests: Apothecial disc K-, C-, KC-, Pd-
Secondary Metabolites (TLC): 2, 7-dichlorlichexanthone
128
Specimen Examined: Balakot, alt. 1,183 m, 26.04.2014, Asmat Ullah,
Amir Khan Afridi and Syed Mushraf Shah 295 (HUP), Paras, alt. 1,600 m,
28.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Mushraf Shah 350 (HUP).
World Distribution: Asia, Europe, Africa (S. Africa, N. Africa), C.
America (Mexico), N. America, S. America (Chile, Bolivia, Argentina),
Pacific, Antarctica.
7. Lecanora polytropa (Ehrh.) Rabenh., Deutschl. Krypt.-Fl. (Leipzig)
2: 37 (1845)
Thallus crustose, immersed or dispersed granules or areoles, occasionally
forming a continuous areolate crust; prothallus black when present; areoles
irregular, weakly convex, ecorticate, 0.1-0.3 mm in diameter; upper surface
yellow-green, occasionally gray green, esorediate; apothecia scattered or
often clustered, rounded to irregular, sessile, constricted below, 0.3-1.0 mm
in diameter; disc pale yellow to pale yellow green, convex; epihymenium
colourless to red-brown, with granular crystals; hymenium colourless to
pale yellow, 45-60 µm tall; paraphyses colourless, weakly branched, apices
slightly thickened; hypothecium pale yellow, 45-50 µm thick; asci 8-spored,
clavate, 30-50 x 11.5-16 µm; ascospore colourless, ellipsoid, simple, 9.5-13.5
x 5-6.5 µm.
Habitat: On rocks (Saxicolous)
Spot Tests: Thallus KC+ yellow
Secondary Metabolites (TLC): Usnic acid and Zeorine
Specimen Examined: Dader, alt. 1,220 m, 11.10.2013, Asmat Ullah,
Amir Khan Afridi and Malik Zahir 23 (HUP), Oghi top, alt. 1,464 m,
15.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleen Shah 256 (HUP), on
way to lake Saif-ul-Maluk, alt. 2,795 m, 30.07.2014, Asmat Ullah, Amir Khan
Afridi and Syed Juneed Shah 405 (HUP), Jalkhad, alt. 3,171 m, 10.08.2014,
129
Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 501 (HUP), Lalazar, alt.
2,873 m 11.09.2014, Asmat Ullah, Amir Afridi and Syed Juneed Shah 591
(HUP).
World Distribution: Asia, Europe, C. America (Mexico), N. America,
S. America, Australasia (Australia, New Zealand), Pacific (Hawaii),
Antarctica.
Note: New to the study area.
8. Lecanora pseudistera Nyl., Flora, Regensburg 55: 354 (1872)
Thallus crustose, verrucose-areolate or dispersed-areolate; areoles thin or
thick, ecorticate; upper surface whitish gray to gray, smooth, epruinose,
esorediat; apothecia lecanorine, sessile, 0.5-1.5 mm in diameter; disc red
brown, plane, epruinose; epihymenium red brown to orange-brown,
without crystals; hymenium clear, colourless; paraphyses slightly
thickened or capitate apically, red-brown to orange-brown; hypothecium
colourless, without oil droplets; asci: 8-spored, clavate; ascospores:
colourless, ellipsoid, simple, 9-13 x 6-7 µm.
Habitat: On rocks (Saxicolous)
Spot Tests: C-, K+ yellow, KC-, Pd-,
Secondary Metabolites (TLC): Atranorin, Chloroatranorin
Specimens Examined: Dader, alt. 1,234 m, 10.10.2013, Asmat Ullah,
Amir Afridi and Syed Muhammad 11 (HUP), Mandaguch, alt. 1,914 m,
14.11.2013, Asmat Ullah and Mazhar-ul-Islam 140 (HUP), Oghi top, alt. 1,527
m, 15.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleen Shah 257 (HUP).
World Distribution: Asia, Europe, Africa, N. America, Australisia.
Note: New to the study area.
130
9. Lecanora pulicaris (Pers.) Ach., Syn. meth. lich. (Lund): 336 (1814)
Thallus crustose, verrucose-areolate; prothallus present, white; areoles
thin, opaque, flat, ecorticate; upper surface yellowish white or whitish
gray to gray, smooth or rough, epruinose, esorediate; apothecia lecanorine,
0.35-1.6 mm in diameter sessile or adnate; disc brown or dark brown,
plane, epruinose; epihymenium red-brown to orange-brown; hymenium
colourless; hypothecium without oil droplets colourless; asci 8-spored,
clavate; ascospores simple, colourless ellipsoid or broadly ellipsoid, 10-14 x
6.5-9.0 µm.
Habitat: On bark or wood (Corticolous)
Spot Tests: K+ Pd+ orange to red or Pd-
Secondary Metabolites (TLC): Atranorin, Chloroatranorin,
Fumarprotocetraric acid
Specimen Examined: Manoor Valley, alt. 2,499 m, 03.08.2014, Asmat
Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 454 (HUP), Shogran, alt. 2,330 m,
26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 671 (HUP),
On track to Saripya, alt. 2,544 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi
and Syed Juneed Shah 709 (HUP).
World Distribution: Asia, Europe, Africa (N. Africa, S. Africa), N.
America, Pacific.
Note: A new recode to Pakistan.
10. Lecanora rupicola (L.) Zahlbr., Cat. Lich. Univers. 5: 525 (1928)
Thallus crustose, continous, areolate to warted-areolate; prothallus
ocassionally present, white; areoles opaque or glossy, thin or thick, flat,
subrounded to angular, ecorticated; upper surface pale gray or pale yellow,
131
smooth, epruinose; apothecia present, 0.5-1.5 mm in diameter,
subimmersed to sessile; disc brown or black, flat, sometimes convex,
densely pruinose; epihymenium brown-gray; hypenium colourless, 55-60
µm tall; paraphysis simple, not capitate; hypothecium colourless, 95 µm
tall, without oil droplets; asci: lecanora-type, 8-spored, clavate; ascospores
colourless, ellipsoid, simple, 9-14 x 5-7 µm in diameter.
Habitat: On rocks (Saxicolous)
Spot tests: ThallusK+ yellow, C-, KC-, Pd-.
Secondary metabolites: (TLC): Atranorine, Chloroatranorine, Roccellic
acid, Thiophanic acid
Specimen Examined: On way to lake Saif-ul-Maluk, alt. 2,892 m,
30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 406 (HUP),
Manoor Valley, alt. 2,851 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and
Mazhar-ul-Islam 484 (HUP), Barhawai, alt. 2,989 m, 01.10.2014, Asmat Ullah,
Amir Khan Afridi and Syed Juneed Shah 605 (HUP), Kiwai, alt. 1,378 m,
22.08.2015, Asmat Ullah and Amir Khan Afridi 766 (HUP).
World Distribution: Asia, Europe, Africa (S. Africa, Morocco), S.
America (Argentina), N. America, New Zealand, Hawaii.
Note: New to the study area.
Lecidella Korb., Syst. Lich. Germ.: 233 (1855).
Thallus crustose, leprose or crustose, granulose or rimose; prothallus
absent or present, black to blue black; upper surface white, gray, green,
yellow, brownish yellow; ascomata apothecia, sessile, usually constricted at
base; disc brown-black plane to strongly convex; exciple colourless, yellow,
orange, green, gray, olivaceous; epihymenium green, bluish green, brown
to black; hymenium colourless; hypothecium colourless, yellow, orange to
132
brown; asci Lecanora-type, clavate, 8-spored; ascospores colourless, broadly
ellipsoid to ellipsoid, simple, lacking distinct perispore, 7-17 x 6-9 µm.
Secondary metabolites: atranorine, chloroatranorin, zeorin, xanthones.
Substrate: soil, wood, bark, rocks, bryophytes.
This genus represented 50 species from the world and previously five
species are reported from Pakistan. The present study recorded two species
from District Mansehra (Plate 3.15).
Key to Species
1a. On bark or wood…………………………………………………….…....2
1b. On rocks………………………………………………………………..….3
2a. Thallus K + yellow………………………………………..…...L. euphorea
2b. Thallus K-…………………………………………………...…Lecidella sp.
3a. On calcareous rocks, exciple blue green……………………L. stigmatea
3b. On siliceous rocks, exciple brown or green brown……….Lecidella sp.
1. Lecidella euphorea (Flörke) Hertel, in Hawksworth, James &
Coppins, Lichenologist 12(1): 107 (1980)
Thallus crustose, granulose, rimose to areolate, 0.25-0.45 mm thick; upper
surface yellowish to gray white, whitish to yellowish gray, smooth,
without soredia or isidia; apothecia abundant, orbicular, sessile, slightly
constricted at base, 0.7-1.0 mm in diameter; disc black, plane, epruinose;
exciple bluish to greenish black; epihymenium: blackish green to bluish
green, with or without crystals; hymenium colourless, 55-70 µm tall;
paraphyses simple; hypothecium reddish brown; asci Lecanora-type,
clavate, 8-spored; ascospores colourless, ellipsoid to ovoid, simple, 7.5-15.5
x 5-9.5 µm.
133
Habitat: On bark (Corticolous)
Spot Tests: Thallus KC+ yellow,
Secondary Metabolites (TLC): Usnic acid, Zeorin
Specimens Examined: On way to Kaghan, alt. 2,030 m, 29.07.2014,
Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 381 (HUP), Shogran, alt.
2,319 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 672
(HUP).
World Distribution: Asia, Europe, Africa, N. America (California,
Arizona), S. America (Venezuela, Peru, Chile), C. America (Mexico),
Australasia (Australia, New Zealand).
Note: New to the study area.
2. Lecidella stigmatea (Ach.) Hertel & Leuckert, Willdenowia 5: 375
(1969)
Thallus crustose, thin, strongly rimose to areolate; prothallus rarely
present, grayish black; upper surface white to pale gray, finely granulose,
without soredia or isidia; apothecia sessile, flat or rarely convex, 0.8-1.5
mm in diameter; disc black, plane, epruinose; exciple greenish black to
blackish green; epihymenium bluish green, hymenium colourless, 60-80
µm tall; paraphyses simple, slightly thickened apically; hypothecium
colourless or rarely brown; asci Lecanora-type, clavate, 8-spored; ascospores
colourless, ellipsoid to ovoid, simple, 10.5-16.5 x 5.5-9.0 µm,
Habitat: On rocks (Saxicolous)
Spot tests: Thallus K+ yellow, K-
Secondary Metabolites (TLC): Atranorin, Zeorin
134
Specimen Examined: Dader, alt. 1,221 m, 10.10.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad 08 (HUP), Oghi top, alt. 1,485 m,
14.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleen Shah 232 (HUP),
Naran, alt. 2,400 m, 29.07.2014, Asmat Ullah, Amir Afridi and Syed Juneed
Shah 383 (HUP).
World Distribution: Asia, Europe, Africa (S. Africa, Morocco), N.
America, S. America (Chile, Peru, Argentina, Venezuela), C. America
(Mexico), Pacific (Hawaii), Antarctica.
Note: New to study area.
Rhizoplaca Zopf, Mitt.
Thallus squamulose, pulvinate, or peltate-umbilicate, monophyllous or
polyphyllous, margins entire to lobed; upper surface pale greenish yellow,
to slightly brownish, or white, soredia, isidia absent; lower surface greenish
yellow brownish or white; ascomata apothecia, rounded to irregular,
laminal to marginal, immersed to sessile; exciple colourless; hymenium:
colourless or yellowish to orange; asci 8-spored, clavate, Lecanora-type;
ascospores ellipsoid, non-septate. Secondary metabolites: usnic acid,
aliphatic acid, β-orcinol depsidones, β-orcinol depsidones or triterpenoids.
Substrate: rock but some species occur on soil.
This genus has eight species from the world and three species from
Pakistan. The present study recorded three species from District Mansehra
(Plate 3.16).
Key to Species
1a. Thallus yellowish gray, apothecia disc orange red…….R. Chrysoleuca
1b. Thallus brown gray or yellowish brown, apothecia disc dark brown
to black or dark brown……………………………………..…………….2
135
2a. Thallus yellowish brown, apothecia disc blouish
brown…..........................................................................R. melanophthalma
2b. Thallus brown gray, apothecia disc dark brown.…..………...R. peltata
1. Rhizoplaca chrysoleuca (Sm.) Zopf, Justus Liebigs Annln Chem.
340: 291 (1905)
Thallus upto 2.0-3.0 cm across, umblicate, monophyllous, deeply lobed or
polyphylous; lobes plane to concave, crenate-incised; upper surface pale
greenish or light gray to whitish, smooth or powdery; apothecia numerous,
laminal or sub-marginal, adnate then sessile, constricted at base, 0.6-2.5
mm in diameter; disc reddish orange, plane to convex, weakly to densely
pruinose; hymenium yellow or orange, 45-60 µm tall; ascospores 9.0-12.5 x
3.5-6 µm, ellipsoid to oblong-ellipsoid.
Habitat: On rocks (Saxicolous)
Spot Tests: Medulla C-, C+ red, KC- or KC+ red, Pd-
or Pd+ yellow, upper cortex: K- or K+
yellow, KC+ yellow
Secondary Metabolites (TLC): Usnic acid, Placodiolic acid or Aliphatic
acid
Specimen Examined: Manoor Valley, alt. 2,682 m, 04.08.2014, Asmat
Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 486 (HUP), Jalkhad, alt. 3,233 m,
10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 503 (HUP),
Behsal, alt. 3,293 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-
Islam 535 (HUP).
World Distribution: Asia, Europe, N. America, C. America (Mexico).
Note: New to the study area.
136
2. Rhizoplaca melanophthalma (DC.) Leuckert, Nova Hedwigia 28: 72
(1977)
Thallus up to 0.5-2.0 cm wide, polyphyllous or rarely monophyllous,
deeply lobed; lobes coarsely crenate-incised, thin, plane to concave, edges
plane or turn down, upper surface greenish yellow, dull to shiny,
occasionally pruinose; lower surface blue black near edges, smooth to
uneven, umbilicus broad; apothecia 0.4-1.5 mm diameter, immersed then
sessile; disc yellowish brown, olive, or greenish, concave to plane or
undulate, epruinose or pruinose, hymenium: colourless, outermost parts
often covered with granules; paraphyses greenish brown, capitate;
ascospores 7.5-11 x 4.0-7.0 µm, ellipsoid to subglobose.
Habitat: On rocks (saxicolous)
Spot Tests: Medulla: C- or C+ red, Pd- or Pd+
yellow, cortex KC+ yellow
Secondary Metabolites (TLC): Usnic acid
Specimen Examined: Manoor Valley, alt. 2,584 m, 03.08.2014, Asmat
Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 456 (HUP), Jalkhad, alt. 3,173 m,
10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 506 (HUP).
World Distribution: Asia, Africa (Kenya, Morocco, Ethiopia),
Europe, North America, South America (Argentina, Venezuela), C.
America (Mexico), Antarctica.
Note: New to the study area.
3. Rhizoplaca peltata (Ramond) Leuckert & Poelt, Nova Hedwigia
28(1): 73 (1977)
Thallus upto 2.5 cm across, umbilicate, usually monophyllous, sometimes
strongly lobed; lobes plane to slightly concave, edges: turn downward;
137
upper surface greenish yellow to yellow, epruinose to partly pruinose;
apothecia usually common, upto 2-3 mm diameter, immersed to adnate;
disc orange yellow or reddish brown, concave, plane sometime convex;
hymenium colourless, inspersed with granules; paraphyses tips colourless,
capitate; ascospores 8-10.5 x 5.5-8.5 µm, ellipsoid to subglobose.
Habitat: On rocks (Saxicolous)
Spot Tests: Upper cortex KC+ yellow, medulla P+
orange.
Secondary Metabolites (TLC): Usnic acid, Zeorine
Specimen Examined: Lalazar, alt. 2,600 m, 11.10.2014, Asmat Ullah,
Amir Khan Afridi and Syed Juneed Shah 592 (HUP).
World Distribution: Asia, Africa, Europe, North America
Note: New to the study area.
Fig. 4.15: Distribution of Lecanoraceae in District Mansehra; 1. Jalkhad, 2. near Batakundi, 3. Lalazar, 4. Barawai, 5. Naran, 6. Manoor Valley, 7. Kaghan, 8. Shogran, 9. Kiwai, 10. Hasa Balakot, 11. Dader, 12. Mandagucha, 13. Ooghi.
138
Plate 3.13: A. Lecanora albella, B. Lecanora argentata, C. Lecanora cenisia (scale= 2cm) in District Mansehra.
139
Plate 3.14: A. Lecanora pseudistera, B. Lecanora pulicaris, C. Lecanora rupicola (scale= 2 cm) in District Mansehra.
140
Plate 3.15: A. Lecidella euphoria, B. Lecidella stigmatea (scale= 0.5 cm) in District Mansehra.
141
Plate 3.16: A. Rhizoplaca chrysoleuca, B. Rhizoplaca melanophthalma C. Rhizoplaca peltata (scale= 0.5 cm) in District Mansehra.
142
10. Lecidaceae
Thallus crustose or squamulose; apothecia biatorine, without a thalline
margin; ascospores colourless or brown, unicellular to muriform. Habitat:
trees, soil, rocks. Distribution: worldwide.
Genera in study area: The present study recorded single genus from
District Mansehra (Fig. 4.16).
Porpidia Körb.
Thallus crustose, thick, continuous to areolate-cracked; prothallus present
or absent, black or orange; areoles gray, white or orange, corticated;
ascomata apothecia, partially immersed to sessile, scattered or clustered,
up to 4 mm in diameter; disc black, flat sometime pruinose; epihymenium
olive gray or or brown; hymenium colourless, or below pale green;
hypothecium colourless; hypothecium dark brown; asi Porpidia-type, 8-
spored, clavate to subcylindrical; ascospores colourless, ellipsoid to
broadly ellipsoid, simple, perispore well developed, up to 7 µm thick.
Secondary metabolites: Stictic acid, norstictic acid, constictic acid or none.
Substrate: rocks rarely on wood.
A total of 16 species of the genus are reported from globe while two species
from Pakistan. The present study recorded one species from District
Mansehra (Plate 3.17).
1. Porpidia crustulata (Ach.) Hertel & Knoph, in Hertel, Beih. Nova
Hedwigia 79: 435 (1984)
Thallus crustose, effuse, thin, continous to areolate; prothallus occasionally
present, black to brown; areoles irregularly; upper surface white, greenish
gray, rarely tinged orange; apothecia abundant, small, round, sessile,
constricted at base, 02-1.0 mm in diameter; disc black, dull, plane to
convex, occasionally weakly pruinose; exciple thin, black; epihymenium
143
olivaceous to pale brown, hymenium: 60-85 µm tall, colourless below, dark
brown above; hypothecium pale brown to dark brown; asci 8-spored ,
clavate, 50-80 x 9.5-18 µm; ascospores colourless, ellipsoid, simple, 10-17 x
5-8.5 µm.
Habitat: On siliceous rocks (saxicolous)
Spot Tests: Thallus K- or K+yellow, Pd- or
Pd+orange
Secondary metabolites (TLC): Stictic acid, norstictic acid, constictic acid
Specimen Examined: Above lake Saif-ul-Maluk, alt. 3,465 m,
30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 438 (HUP),
Jalkhad, alt. 3,182 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-
Islam 511 (HUP).
World Distribution: Asia, Europe, N. America (Alaska), S. America
(Chile, Argentina, Venezuela), Africa (S. Africa, Morocco, Algeria),
Australasia (Australia, New Zealand).
Fig. 4.16: Distribution of Lecidaceae in District Mansehra; 1. Jalkhad, 2. above Lake Saif-ul-Maluk.
144
Plate 3.17: Porpidia crustulata (scale= 2 cm) in District Mansehra.
145
11. Megasporaceae
Thallus crustose, subfruticose, subfoliose; ascomata immersed; disc flat;
asci thicked walled, 1-6 spores/ascus; ascospores variable in size,
colourless, single cell and 2-layed wall. Habitat: rocks, soil, bark and wood.
Genera in study area: The present study recorded two genus; Aspicillia
Lobothalia from District Mansehra (Fig. 4.17)
Key to genera
1a. Apothecia disc black to brown black, white pruinose, epihymenium
green to olive or brown………………………………………… Aspicilia
1b. Apothecia disc redish brown, pruinose or not, epihymenium pale
brown…………………………………………………………….Lobothalia
Aspicilia A. Massal.
Thallus crustose, smooth to areolate, without marginal lobes; areoles
round, angular, or sometimes irregular, concave to flat convex to
verrucose; upper surface chalk white, gray, green or brown, in some
species soredia or isidia are present, cephalodia absent, sometimes
pseudocyphellae present; acomata apothecial, aspicilioid, one to several
per areole, normally immersed, sometimes becoming emergent or sessile
and rarely appearing lecanorine, round to angular, occasionally elongated
or irregular; disc flat to concave, black to brown black sometimes white
pruinose; epihymeniumgreen to olive or brown; hymenium hyaline,
usually more than 90 µm tall; hypothecium colourless, asci clavate, 2-8
spored; ascospoes hyaline, globose to ellipsoid, simple, 16-25 µm long.
Secondary metabolites: norstictic acid and stictic acid. Substrate: usually on
rocks, rarely on bark, wood and soil.
The genus has a total of 200 species from the world and six species from
Pakistan. The present study recorded two species from District Mansehra.
146
Key to species:
1a. On rocks, ascus 8 spored……………………………………………..….2
1b. On rocks, Ascus 2-6 spored……………………………..…A. desertorum
2a. Spores size larger than 20µm…………………………….…Aspicilia sp.
2b. Spores in size 15-20µm long…. ………………………….…….A.cinerea
1. Aspicilia cinerea (L.) Körb., Syst. lich. germ. (Breslau): 164 (1855)
Thallus crustose, warted-areolate, to 2.5 -7.5 cm in diameter, up to 0.55 mm
thick; areoles angular or occasionally irregular, flat to convex, somewhat
uneven, 0.5 1.0 mm in diameter, separated by distinct cracks; prothallus
absent; upper surface grey to white gray, or white, occasionally with
yellowish ting, dull or somewhat shiny; apothecia aspicilioid, slightly
concave to flat, 0.3-1.1 mm in diameter, 1-2 per areole; disc black, concave,
sometimes plane, without pruina; epihymenium brown to olive brown,
without crystals; hymenium hyaline, 90-125 µm tall; hypothecium
colourless, 75-110 µm tall; asci clavate, 8-spored, 50-95 x 15-28 µm;
ascospores hyaline, simple, ellipsoid, 11-19 x 8-12 µm in diameter.
Habitat: On exposed rocks (Saxicolous)
Spot Tests: Medulla K+ red, C-. Pd+ yellow-orange,
Secondary Metabolites (TLC): Norstictic acid
Specimen Examined: Mandaghucha, alt. 1,890 m, 13.11.2013, Asmat
Ullah and Mazhar-ul-Islam 110 (HUP), lake Saif-ul-Mulak, 3,236 m,
30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneedd Shah 433 (HUP),
Jalkhad, alt. 3,165 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-
Islam 504 (HUP), Bahsal, alt. 3,299 m, 11.08.2014, Asmat Ullah, Ashfaq Ahmad
and Mazhar-ul-Islam 527 (HUP).
147
World Distribution: Asia, Europe, Africa (S. Africa, Morocco),
Australasia (New Zealand, Australia), S. America (Brazil, Argentina) C.
America (Mexico).
2. Aspicilia desertorum (Kremp.) Mereschk., Trudi naturh. Ver. ksl.
Univ. Kasan 43: 36 (1911)
Thallus areolate to verrucose, 1-5 mm in diameter, 0.1-0.5 mm thick; areoles
angular to rounded, flat to convex, 0.3-1.7 mm in diameter; prothallus
rarely present, sparsely developed along the thallus edge, black or olive
black, 0.1-0.3 mm wide; upper surface brown to olive brown, sometimes
gray brown, gray white or gray, dull or shiny; apothecia aspicilioid, 0.3-0.6
mm in diameter,1-3 per areole, round elongated or irregular; disc black,
concave, occasionally flat, usually with white pruina; epihymenium olive
brown to brown, sometimes green, with crystals; hymenium hyaline, 125-
200 µm; asci clavate, 2-6 spored, 70-140 x 22-35 µm; ascospores hyaline,
globose to subglobose, simple, 20-32 x 17- 27 µm.
Habitat: On rocks (Saxicolous)
Spot Tests: Cortex and Medulla K-, P-, C-.
Secondary Metabolites (TLC): Aspicilin
Specimen Examined: Dader near Siran river, alt. 1,200 m, 10.10.2013,
Asmat Ullah, Amir Afridi and Syed Muhammad 05 (HUP), Mundaghucha, alt.
2,082 m, 13.11.2014, Asmat Ullah and Mazhar-ul-Islam 108 (HUP), Oghi top,
alt. 1,559 m, 14.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleem Shah 225
(HUP), Balakot, alt. 1,126 m, 25.04.2014, Asmat Ullah, Amir Khan Afridi and
Syed Mushraf Shah, 283 (HUP), Paras near the bank of Kunhar river, alt.
1,317 m, 27.07.14, Asmat Ullah, Syed Mushraf Shah and Amir Khan Afridi 326
(HUP).
148
World Distribution: Asia, Europe (Ukraine, Greece and Russia),
N. America and C. America (Mexico).
Note: New to study area.
Lobothallia (Clauzade & Cl. Roux) Hafellner, Acta Bot. Malacitana 16(1):
138 (1991).
Thallus placodioid, up to 2.5-6 cm or more across, lobate at margin; lobes
tightly attached, plane to convex; upper surface gray to white, brown, or
black, continuous to rimose; apothecia up to 2.0 mm in diameter, rounded
to irregular, immersed to sessile; disc redish brown, pruinose or not, plane
or convex; epihymenium: pale brown; hymenium colourless; paraphyses
unbranched; hypothecium colourless to pale gray or brown; asci 8-spored,
oblong ellipsoid; ascospores simple, colourless, ellipsoid or oblong, 8.5—
14.5 x 6-10.5 µm. Secondary metabolites: norstictic, constictic acid.
Substrate: on rocks.
The genus has four species from globe while previously three species from
Pakistan and two from study area. In the present study two species are
reported from District Mansehra.
Key to species
1a. Marginal lobes overlapping……………………………………….….…2
1b. Marginal lobes not overlapping………………………….Lobothallia sp.
2a. Marginal lobes flat, not easily separated from
substrate…………………………………………………......L. praeradiosa
2b. Marginal lobes convex easily separated from
substrate………………………………………….………..….L. alphoplaca
1. Lobothallia alphoplaca (Wahlenb.) Hafellner, Acta bot. Malac.
16(1): 138 (1991)
149
Thallus placcodioid, up to 2 cm in diameter, areolate in center; prothallus
absent or occasionally present, black; areoles to 1-1.5 mm wide, flat,
discrete, becoming crenate-lobed; lobes radiating and separarate, imbricate,
more often strongly convex, overlapping; uppers surface grayish brown,
smooth or wrinkled; lower surface pale or darker brown; apothecia
numerous, 0.7-1.5 mm in diameter, flat, sub sessile, not pruinose; disc dark
brown to black, shiny; epihymenium green; hymenium colourless, 65 µm
tall; hypothecium colourless; paraphyses simple; asci 55-70 x 18-23 µm,
oblong-ellipsoid; ascospores colourless, ellipsoid, 10-15 x 5.5-8.5 µm,
simple.
Habitat: On rocks (Saxicolous)
Spot Tests: Medulla, K+ red, Pd+ orange, cortex:
K+red or K-, Pd + orange or Pd-
Secondary Metabolites (TLC): Norstictic and constictic acid
Specimens Examined: Oghi top, alt. 1,347 m, 15-04-14, Asmat Ullah,
Amir Afridi and Kaleem Shah 205 (HUP), Lalazar, Naran, alt. 2,941 m, 11-09-
14, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 509 (HUP), Shogran,
alt. 2,313 m, 26-07-2015, Asmat Ullah, Amir Khan Afridi and Syed Muhammad
666 (HUP).
World Distribution: Asia, Europe, N. Africa (Morocco, Algeria), C.
America (Mexico), S. America (Argentina), N. America (Alaska),
Australisia (Australia).
2. Lobothallia praeradiosa (Nyl.) Hafellner, Acta bot. Malac. 16(1): 138
(1991)
Thallus pacodioid, areolate to areolate-granulose, rosettes, often irregular;
areoles up to 1 mm wide, contiguous to scattered, plane to convex, lobes
contiguous, plane, imbricate, closely attached, irregularly arranged; upper
150
surface brownish gray or reddish gray, epruinose, weakly maculate; lower
surface pale at lobes tips or not visible; apothecia numerous, 1-1.5 mm in
diameter, sessile, rounded; disc brown to black, plane to convex;
epihymenium pale brown; hymenium colourless, 65-75 µm tall; asci 60-70 x
15-20 µm, oblong ellipsoid; ascospores colourless, ellipsoid to ovoid, 10-
13.5 x 6.5-9.0 µm, simple.
Habitat: On rocks (Saxicolous)
Spot Tests: Medulla K+ red, Pd+ orange cortex:
K+Yellow-red, Pd +orange
Secondary Metabolites (TLC): Norstictic acid, constictic acid
Specimens Examined: On way to Naran, alt. 2,701 m, 29.07.2014, Asmat
Ullah, Amir Khan Afridi and Syed Juneed Shah 374 (HUP), on way to Lake saif
ul Maluk, alt. 2,680 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed
Juneed Shah, 409 (HUP), Shogran, alt. 2,355 m, 27.07.2015, Asmat Ullah, Amir
Khan Afridi and Syed Juneed Shah 711 (HUP).
World Distribution: Asia (Magnolia), Europe, North America (USA)
N. Africa, C. America (Mexico).
151
Fig. 4.17: Distribution of Megasporaceae in District Mansehra;
1. JalKhad, 2. Lake Saif-ul -Maluk, 3. Paras near the side of
Kunhar river, 4. Shogran, 5. Balakot, 6. Dader near Siran
river, 7. Mandaghucha, 8. Oghi top. 9. Kathai Oghi.
152
12. Mycoblastaceae
Thallus crustose; prothallus present sometime; ascomata apothecial,
lecanorine or aspicilliod-lecanoroid. Substrate: rocks, wood, barks and
lichen thalli.
Genera in study area: The present study recorded single genus from
District Mansehra (Fig. 4.18)
Tephromela Choisy, Bull. Soc. Bot. France 76: 522 (1929).
Thallus crustose, warted or rimose-cracked-areolate; surface pale gray or
yellow-green; ascomata apothecia, usually sessile, sometimes stipitat; disc
black, cup like to strongly convex; exciple thin; epihymenium usually with
purplish pigment; hymenium colourless below, purple to green above;
paraphyses simple or sparingly branched, apices not swollen but
pigmented hood; hypothecium ochraceous to brown below; asci 8-spored,
clavate, Bacidia-type; ascospores colourless, simple, ellipsoid, without a
distinct perispore. Secondary metabolites: atranorine in cortex, depsidones
in medulla. Substrate: rock, occasionally on bark and wood,
The genus has a total of 30 species from globe and single specie from
Pakistan. The present study recorded single specie from District Mansehra
(Plate 3.18).
1. Tephromela atra (Huds.) Hafellner, Lichenes Neotropici, Fascicle
VII (nos 251-300) (Neumarkt) 7: no. 297 (1983)
Thallus crustose, continuous to areolate, often warted; prothallus
occasionally present, black; areoles 0.2-1.3 mm wide, flat to convex,
subrounded to subangular; upper surface white to pale gray green,
smooth, not pruinose; apothecia abundant, round or irregular, immersed
or sessile, flat to slightly convex, 0.7-1.3 mm in diameter; disc black;
epihymenium dark red-brown; hymenium 50-120 µm tall, purple brown;
153
hypothecium colourless to pale brown, 100-145 µm tall; asci 8 spored,
narrowly clavate; ascospore colourless, ellipsoid, simple, 10.5-14.5 x 5.5-8
µm.
Habitate: On rocks
Spot Tests: Cortex K+ yellow, medulla Pd-
Secondary Metabolites (TLC): Atranorine, Alectoronic acid.
Specimen Examined: On way to Lake Saif ul maluk, alt. 2,767 m,
30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 413 (HUP),
Manoor valley, alt. 2,723 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and
Mazhar-ul - Islam 493 (HUP).
World Distribution: Asia, Europe, Africa, North America, South
America, Australasia, Pacific (Hawaii, Tuamotu), Antarctica.
Note: New to the study area
Fig. 4.18: Distribution of Mycoblastaceae in District Mansehra; 1. Manoor Valley, 2. on way to lake Saif-ul-Maluk.
154
Plate 3.18: Tephromela atra (scale= 0.5 cm) in District Mansehra.
155
13. Nephromataceae
Thallus foliose well developed cortex; ascomata apothecia, cup-shaped;
ascospores brown, aseptate. Substrate. On mossey ground, rocks and trees.
Distribution: wide spread in distribution.
Generain study area: The present investigation recorded single genus
from District Mansehra (Fig. 4.19).
Nephroma Ach.,
Thallus foliose, spreading, dorsiventral, , rosette forming or rarely
fragmented, loosely attached, 2-9.5 cm wide, lobate; lobes irregular,
broadly elongate; apices rounded to slightly elongate, often ascending at
margins, eciliated; upper surface gray brown to brown, with or without
isidia, soredia, pruinose or not; lower surface pale brownish to brown,
pubesent or tomentose; ascomata apothecia, sessile or rounded to
reniform,; disc pale brown to dark brown; epihymenium brown;
hymenium 55-85 µm tall, colourless; hypothecium colourless paraphyses
unbranched; asci Peltigera-type, 8-spored; ascospores pale brown,
subfusiform to fusiform, thin walled, 3-septate. Secondary metabolites:
hopane triterpenoids, and depsides. Substrate: on bark, rock or soil.
This genus has 36 species from the world while the present study recorded
one specie from District Mansehra (Plate 3.19).
1. Nephroma parile (Ach.) Ach., Lich. univ.: 522 (1810)
Thallus foliose, 3-8.5 cm wide, loosely adnate, forming rosettes or
fragmentary, lobate; lobes spreading, broad, elongate, thin; apices entire or
subcrenulate, rarely ascending; upper surface dark red brown, shiny or
pubescent, epruinose; soredia marginal or laminal, granular; lower surface
pale brown, smooth to regulose, nacked or weakly pubescent; apothecia
rare, up to 7.5 mm in diameter; disc light brown; exciple colourless or light
156
brown, 20-28 µm thick; epihymenium brown or brownish; hypothecium
colourless; asci 8-spored; ascospores light brown, subfusiform, 3-septate,
17.5-20 x 5.5-6.5 µm.
Habitat: On rocks (Saxicolous)
Spot Tests: Medulla K+ yellow
Secondary Metabolites (TLC): Hopane, Zeorine
Specimen Examined: Manoor Valley near forest rest house, alt. 2,566
m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 464 (HUP),
Batakundi, alt. 2,641 m, 01.10.2014, Asmat Ullah, Amir Khan Afridi and Syed
Juneed Shah 628 (HUP), Shogran, alt. 2,314 m, 26.07.2015, Asmat Ullah, Amir
Khan Afridi and Syed Juneed Shah 682 (HUP), Shogran on the side of track to
Saripaya, alt. 2,528 m ,27.7.2015, Asmat Ullah, Amir Khan Afridi and Syed
Juneed Shah 739 (HUP).
World Distribution: Asia, Europe, N. America (Alaska, USA), S.
America (Chile, Argentina) C. America (Mexico).
Note: A new record to Pakistan.
157
Fig. 4.19: Distribution of Nephromataceae in District Mansehra; 1. Batakundi, 2. Manoor Valley near forest rest house, 3.Shogran.
Plate 3.19: Nephroma parile (scale= 1 cm) in District Mansehra.
158
14. Parmeliaceae
Thallus foliose, dorsiventral; attached to substratum with rhizine;
apothecia, lecanorine; spores colourless, unicellular.Habitat: trees, rocks.
Distribution: Cosmopolitan
Genera in study area: The present study recorded 12 genera from
District Mansehra (Fig. 4.20).
Key to genera
1a. Thallus foliose…………………………………………………………….2
1b. Thallus Fruticose…………………………………………………....Usnea
2a. Growing mostly on barks rarely on rocks……………………….……..3
2b. Growing on barks, wood, rocks, soil……………………………...……6
3a. Rhizine absent………………………………………………..Hypogymina
3b. Rhizine present………………………………………………..………….4
4a. Upper surface with or without soredia, isidia maculae…..…..............5
4b. Upper surface yellow green or gray, without soredia, isidia,
maculae……….. ….…………………………………………..Parmeliopsis
5a. Ascospores ellipsoid or subglobose, 9-13 x 5-8 µm in
diameter……………………………………………………….…Parmelina
5b. Ascospore ellipsoid, thin walled, 5.5-20 x 4-12 µm in
diameter……………………………………………………….Melanohalea
6a. Rhizine simple, concolorous with lower surface…………….………..7
6b. Rhizine, simple, black brownish to pale, black, black to pale…….….8
159
7a. Lower surface shiny to dull, ascospores 9-18 x 4.5-10.5
µm………………………………………………………………...Melanelia
7b. Lower smooth to wrinkled, ascospores 6-16 x 4-10
µm……………………………………………………….…..Flavopunctelia
8a. Upper surface gray to gray green with or without soralia or
isidia………………………………………………………………………..9
8b. Not as above
9a. Disc pale to dark brown, ascospores 10-25 x 7-16 µm in
diameter…………………………………………………………..Punctelia
9b. Disc pale brown to black, ascospores 10-15 x 6-10 µm in
diameter…………………………………………………………...Parmelia
10a. Apothecia, sessile, orbicular, laminal, cup shaped…..…..Canoparmelia
10a. Apothecia, sessile to semi-stalked, laminal…………………………...11
11a. Ascospores, simple, thin walled, 12-20 x 6-10 µm in
diameter……………………………………………………..Flavoparmelia
11b. Ascospores, simple, 7-13 x 4-7 µm in diameter………..Xanthoparmelia
Canoparmelia Elix & Hale
Thallus foliose, 2.5-11.5 cm across, closely adnate to adnate, dorsiventral,
lobate; lobes sublinear to subirregular, narrow, 0.6-7.5 mm wide; apices
subrotund to rotund, eciliate; upper surface pale gray to greenish gray,
emaculate, with or without isidia, soredia, pseudocyphellae absent; lower
surface black, attachment by simple rhizines, lobe margin with a narrow,
pale erhizinate; rhizine simple, tufted or not; ascomata apothecia, laminal,
orbicular, cup-shaped, sessile; exciple gray or hyaline; hypothecium
hyaline; epihymenium brown or brownish yellow; asci lecanoral, 8-spored;
160
ascospores simple, ellipsoid, 7-20 x 4-9 µm in diameter. Secondary
metabobolites: atranorine, chloroatranorine, aliphatic acid, orcinol
depsides, anthraquinones. Substrate: mostly on bark or rocks.
A total of 45 species of the genera were reported from the world while one
specie from Pakistan. The present study recorded single specie from
District Mansehra (Plate 3.20).
1. Canoparmelia texana (Tuck.) Elix & Hale, in Elix, Johnston &
Verdon, Mycotaxon 27: 279 (1986)
Thallus foliose, closely adnate, 4-9 cm in diameter, lobate; lobes sublinear,
elongate, plane to subconvex, 2.5-4.5 mm wide; pices rotuned, eciliate;
upper surface mineral gray, smooth to rugose, dull, maculate,
sorediate; soredia granular, whitish, laminal to marginal; lower surface
black, rhizinate; rhizines black, simple, short, sparse to moderately dense;
apothecia rare, 2.0-4.5 mm in diameter, adnate, laminal on thallus; disc
brown, plane; epihymenium 10-12 µm thick; hymenium 35-40 µm tall; asci
8-spored clavate, 24-32 x 12-18 µm; ascospores colourless, ellipsoid, simple,
8-11 x 5-8 µm.
Habitat: On bark (Corticolous)
Spot Tests: Cortex K+ yellow, C-, KC-, Pd+ yellow,
medulla K-, C-, KC+ reddish, Pd- .
Secondary Metabolites (TLC): Atranorin, Divaricatic acid
Specimen Examined: On way to Kaghan, alt. 1,995 m,
29.07.2014,Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 382 (HUP),
Manoor valley near Forest rest house, alt. 2,572 m, 03.08.2014, Asmat Ullah,
Ashfaq Ahmad and Mazhar-ul-Islam 457 (HUP), Shogran, alt. 2,314 m,
26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 675 (HUP),
161
Saripaya, alt. 2,810 m, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah
718 (HUP).
World Distribution: Asia (India, Thailand, Sumatra, Japan,
Taiwan) Africa, South America, Thailand, Java, Sumatra, Japan, India,
Australia,
Note: New to the study area
Flavoparmelia Hale
Thallus foliose, dorsiventral, 2.5-20 cm wide, loosely to closely appressed to
substrum, lobate; lobes irregular, roughly rounded, ascending imbricate to
confluent, cilia absent; upper surface yellow green to green, smooth, plane
to rouglose, often with soredia or pustules, epruinose; lower surface black,
rhizinate, frequently with brown margin; rhizines simple, sparse to
moderately abundant, black or pale towards lobes apices; ascomata
apothecial, laminal, up to 10 mm wide, sessile or semi-stalked; disc red-
brown; exciple gray or colourless; epihymenium brown or brownish
yellow; hypothecium colourless; asci lecanoral, 8-spored; ascospores
simple, 12-20 x 6-10 µm, ellipsoid, wall thin, colourless. Secondary
metabolites: usnic acid, protiocetraric acid rarely atranorin,
chloroatranorin, antraquinones. Substrate: bark, rocks, dead wood.
A total of 35 species of the genus are reported from the world while one
specie from Pakistan. The present study recorded single specie from
District Mansehra (Plate 3.21).
1. Flavoparmelia caperata (L.) Hale, Mycotaxon 25(2): 604 (1986)
Thallus foliose, 5-20 cm in diameter, adnate to loosely adnate, irregularly
lobate; lobes 5-12 mm wide, subirregular, elongate, separate, contiguous to
somewhat imbricate; apices rotund, crenate; upper surface yellow green or
sometimes green gray, dull to somewhat shiny, epruinose, sorediate;
162
soredia granular to wart like, laminal; lower surface black centrally, brown
at apices, rhizinate; rhizines simple, black, somewhat brown or white
tipped; apothecia not seen in the study specimen.
Habitat: On bark (Corticolous)
Spot tests: Medulla K+ yellow, Pd+ red,
Secondary Metabolites (TLC): Usnic acid, Protocetraric acid,
Caperatic acid.
Specimen examined: Dader, alt. 1,199 m, 11.10.2013, Asmat Ullah,
Amir Khan Afridi and Malik Zahir 38 (HUP), Manoor Valley near forest rest
house, alt. 2,562 m, 03.08.14, Asmat Ullah, Mazhar-ul-Islam and Ashfaq Ahmad
458 (HUP), Lalazar, alt. 2,935 m, 11.09.14, Asmat Ullah, Amir Khan Afridi
and Syed Juneed Shah 586 (HUP), Shogran, alt. 2,333 m, 26.07.15, Asmat
Ullah, Amir Khan Afridi and Syed Juneed Shah 677 (HUP).
World Distribution: Asia (Nepal, India, Tiawan, Japan) Europe,
North America, C. America (Mexico, South America, Africa, Australasia.
Note: New to the study area
Flavopunctelia (Krong) Hale
Thallus foliose, up to 15 cm in diameter, dorsiventral, adnate to loosely
adnate, lobate; lobes linear to broadly rounded, eciliate, plane, contiguous,
up to 7.5 mm in diameter; upper surface greenish yellow to yellowish-
green, smooth to wrinkled pseudocyphellae punctiform, with or without
isidia or soredia; lower surface pale tan to black, smooth to wrinkled,
rhizinate; rhizines simple, generally concolorous with lower surface, absent
in broad marginal zone; ascomata apothecia, laminal, sessile to substipitate;
disc pale to dark brown; asci lecanora-type, 8-spored; ascospores colourless,
163
round to ellipsoid, simple, 6-16 x 4-10 µm, Secondary metabolites: usnic
acid, lecanoric acid. Substrate: on bark, rocks.
The genus has six species from the world and previosly two species are
recorded from Pakistan.The present study reported two species from
District Mansehra (Plate 3.22).
Key to species:
1a. Pseudocyphellae present, soralia marginal or laminal……………….2
2a. Pseudocyphellae absent, soralia marginal…………………...F. soredica
2a. Soralia marginal or submarginal capitate……………….....F. flaventior
2b. Soralia laminal…………………………………………..Flavpunctelia sp.
1. Flavopunctelia flaventior (Stirt.) Hale, Mycotaxon 20(2): 682 (1984)
Thallus foliose, 4-9.5 cm in diameter, closely adnate, lobate; lobes 2-6 mm
wide, sublinear to subirregular, plane, contiguous; upper surface yellowish
green to gray, to yellow-green, rugulose in centre, smooth ,
pseudocyphellate and sorediat; soralia marginal or submarginal,
sometimes with white maculae; lower surface blacked to dark brown,
rhizinate; rhizines black, few, sparse, tips white; apothecia rare, 2.5-6.5 mm
in diameter, constricted at base; disc dark brown; epihymenium brown;
hymenium 30-40 µm tall; asci 8-spored, clavate, 32-34 x 16-19 µm;
ascospores simple, colourless, oval-ellipsoid, 14-18 x 6.5-9 µm.
Habitat: On bark (corticolous)
Spot Tests: Medulla C+ red, KC+ red,
Secondary Metabolites (TLC): Lecanoric acid, Usnic acid, Atranorin
164
Specimen Examined: Dader, alt. 1,196 m, 08.11.2013, Asmat Ullah,
Amir Khan Afridi, Syed Muhammad 80 (HUP), Manda Ghucha, alt. 1,854
m,14.11.2013, Asmat Ullah and Mazhar-ul-Islam 141 (HUP), Manoor Valley
near Forest rest house, alt. 2,572 m, 04.08.2014, Asmat Ullah, Mazhar-ul-Islam
and Ashfaq Ahmad 487 (HUP).
World Distribution: India, Nepal, Europe, South America, North
America.
Note: New to the study area.
2. Flavopunctelia soredica (Nyl.) Hale, Mycotaxon 20(2): 682 (1984)
Thallus foliose, up to 11 cm wide, closely adnate, lobate; lobes linear,
sublinear or subirregular, plane, 3-7 mm with apices rounded, contiguous;
upper surface pale green, yellowish green to greenish yellow, smooth to
weakly wrinkled and rugose, soredia white, farinose to granular; lower
surface dark brown to black, rhizinate; rhizines simple, black, short,
occasionally with white tips, absent in marginal zone; apothecia rare, up to
2.5mm in diameter, constricted at base; disc dark brown, concave;
epihymenium brown; hymenium 30-50 µm tall; asci 8-spored, clavate, 24-
30 x 16-20 µm; ascospores colourless, simple8-12 x 5-6.5 µm.
Habitat: On bark and wood
Spot Tests: Medulla C+ red, KC+ red
Secondary Metabolites (TLC): Lecanoric acid, Usnic acid
Specimen Examined: On the side of Naran road from Batakundi, alt.
2,333 m, 05.07.2014, Asmat Ullah, Amir Khan and Syed Juneed Shah 301
(HUP), Kaghan, alt. 2,098 m, 29.07.2014, Asmat Ullah, Amir Khan Afridi and
Syed Juneed Shah 384 (HUP), Manoor Valley, alt. 2,595 m, 04.08.2014, Asmat
165
Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 476 (HUP), Shogran, alt. 2,348 m,
26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 668 (HUP).
World Distribution: India, Japan, South Africa, South America,
North America, Japan, Russia.
Hypogymina (Nyl.) Nyl.
Thallus foliose, up to 25 cm or more wide, lobate; lobes solid or hollow,
irregular to linear and elongate, erect, contiguous or free, appressed,
imbricate, tips pointed to rounded; upper surface gray or suffused brown,
corticated, often with soredia or pustules, without isidia and
pseudocyphellae; lower surface black, wrinkled, corticate, without rhizines;
ascomata present or absent, apothecia, laminal on thallus, orbicular, cup-
shaped, sessile or prominently stalked; disc red to yellow-brown, concave
to flat; exciple gray or colourless; hpothecium colourless; epihymenium
brown; asci lecanora-type, 8-spored; ascospores colourless, simple globose
to shortly ellipsoid, 3.5-10 x 3-6 µm. Secondary metabolites: atranorin,
chloroatranorin. Substrate: bark, wood, occasionally on rocks.
The above genus represents 80 species from the world while previously
one specie is reported from Pakistan. The present study recoreded single
taxa from District Mansehra.
1. Hypogymnia tubulosa (Schaer.) Hav., Bergens Mus. Årbok, Naturv.
raekke no. 2: 31 (1918) [1917-1918]
Thallus foliose, up to 7 cm broad, erect to sub erect, lobate; lobes 2-3 mm
wide, hollow, tubular and ascending, dichomoously branched; upper
surface white to greenish gray, not pruinose; lower surface black, rhizines
absent, central parts of thallus directly attached to substratum; apothecia:
not seen in the study specimen.
Habitat: On bark or wood (corticolous)
166
Spot Tests: Medulla KC+ orange-red, cortex K+
yellow, Pd+ pale yellow,
Secondary Metabolites (TLC): Atranorin, Chloroatranorine, Physodic
acid, 3-hydroxyphysodic.
Specimen Examined: Mandaghucha, alt. 1,850 m, 14.11.2013, Asmat
Ullah and Mazhar-ul- Islam 142 (HUP), Paras, alt. 1,455 m, 27.07. 2014, Asmat
Ullah, Amir Khan Afridi and Syed Mushraf Shah 331 (HUP), Manoor Valley,
alt.2,341 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 459
(HUP), Paras (above River Kunhar), alt. 1,838 m, 05.08.2015, Asmat Ullah,
Amir Khan Afridi and Syed Mushraf Shah 645 (HUP).
World Distribution: Asia, Europe, Africa (Kenya, Ethiopia, Morocco)
North America (Canada, USA), C. America (Mexico).
Note: New to the study area.
Melanelia Essl.
Thallus foliose, dorsiventral, loosely to closely appressed, lobate; lobes
short and rounded to elongate, moderately to loosely attached, margin
without cilia; upper surface pale to dark brown, thin or fleshy, emaculate,
with or without pseudocyphellae, soredia or isidia; lower surface pale tan
to black, shiny to dull, rhizinate; rhizines simple, concolorous with lower
surface; ascomata apothecia, sessile or short stalk, laminal; disc red brown
to black-brown, concave to flat; asci 8-spored, clavate; ascospores
colourless, ellipsoid to ovoid, simple, 9-18 x 4.5-10.5 µm. Secondary
metabolites: unidentified brown pigmentlacking secondary substances or
commonly with various para-depsides, orcinol or β-orcinol depsidones or
aliphatic acid. Substrate: rocks bark or wood.
Previously the genus has three species from Pakistan while the present
study recorded single specie from District Mansehra.
167
1. Melanelia disjuncta (Erichsen) Essl., Mycotaxon 7(1): 46 (1978)
Thallus foliose, closely appressed, up to 5.5 cm in diameter, lobate; lobes
short and rounded, flat or shortly convex, broadened toward the tips, 0.5-
1.5 mm wide; upper surface dark brown-black, shiny toward margins,
smooth or occasionally somewhat pitted near the lobe-ends, isidiate; isidia
dark gray to black; lower surface very dark brown to black, rhizinate;
rhizines simple, black, scattered; ascomata not seen in the study specimens.
Habitat: On rocks (saxicolous)
Spot Tests: Medulla K-, -C , KC-, Pd-
Secondary Metabolites (TLC): Perlatolic and Stenosporic acid.
Specimen Examined: On way to Jalkhad, alt. 2,700 m, 10.08.2014,
Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 508 (HUP).
World Distribution: Asia, Russia, Siberia Europe, Ireland, Africa
(Kenya) North America, (Alaska).
Note: New to study area.
Melanohalea O Blanco, A. crespo, Divaker, Essl., D. Hawksw. & Lumbsch
Thallus foliose, dorsiventral, loosely to closely appressed, up to 7 cm
diameter, lobate; lobes 0.5-7 mm wide, plane to concave, flat, apices
rounded, margin without cilia; upper surface olivaceous brown, smooth to
rugose, emaculate, isidia or soredia present or absent, pseudocyphellate
present or absent; lower surface pale brown to black, flat, smooth,
rhizinate; rhizines simple; ascomata apothecia sessile to subpedicillate,
laminal; disc brown, concave to flat; asci 8-spored, broadly clavate;
ascospores colourless, ellipsoid, thin walled, 5.5-20 x 4-12 µm. Secondary
metabolites: depsidones in medulla. Substrate: bark, wood, rarely on rocks.
168
The above genera represented 19 species from the world and previously
three species from Pakistan. The present study reported single taxa from
District Mansehra.
1. Melanohalea elegantula (Zahlbr.) O. Blanco, A. Crespo, Divakar,
Essl., D. Hawksw. & Lumbsch, Mycol. Res. 108(8): 882 (2004)
Thallus foliose, loosely to moderately adnate, to 5 cm in diameter, lobate;
lobes flat, contiguous to imbricate, overlapping at center, to 2 mm wide;
upper surface dark olive brown, usually matt, lacking pseudocyphellae,
isidiate; isidia spread over most of the thallus, cylindrical, branched or
unbranched; lower surface pale brown, rhizinate; rhizines pale brown or
concolorous with lower surface, ascomata rare; ascospores ellipsoid, 7.5-
11.5 x 4-7 µm.
Habitat: On bark or wood (corticolous)
Spot test: All negative
Secondary metabolites (TLC): None detected
Specimen examined: Shogran, alt. 2,350 m, 27.07.2015, Asmat Ullah,
Amir Khan Afridi and Syed Juneed Shah,725 (HUP).
World distribution: Asia, Europe, Scotland, Ireland, South America,
North America, Africa, Morocco.
Note: New to the study area.
Parmelia Ach.
Thallus foliose, dorsiventral, loosely to tightly adnate, corticate on both
side, 2.0-20.0 cm across, lobate; lobes 1.00-25 mm wide, sublinear to
subirregular, with rounded, variously incised, eciliate margins; upper
surface gray to gray green, shiny or dull, smooth to foveolate, with or
169
without soredia, isidia, lobules, pseudocyphellae effigurate or linear; lower
surface black, uniformly rhizinate to margins; rhizines black, simple,
furcated or squarrose; ascomata apothecia, laminal, sessile to pedicellat, 1-
20 mm wide; disc pale brown to black, rarely perforate; exciple gray or
colourless; epihymenium brown or brownish yellow; hypothecium
colourless; asci 8-spored, cylindrical; ascospores ellipsoid, 10-15 x 6-10 µm.
Secondary metabolites: atranorin, chloroatranorin, orcinol depsides, orcinol
depsidones, aliphatic acid. Substrate: on bark, wood, rock and soil.
A total of 38 species of the genus are reported from the world while
previously three species from Pakistan. The present study recorded single
taxa from District Mansehra (Plate 3.23).
1. Parmelia sulcata Taylor, in Mackay, Fl. Hibern. 2: 145 (1836)
Thallus foliose, adnate to loosely adnate, 4-18 cm in diameter, lobate; lobes
sublinear, crowded to imbricate, 2-4.5 mm wide, apices truncate; upper
surface whitish gray to dark gray, sometimes white pruinose, without
isidia, pseudocyphellae laminal and marginal, discrete, forming ridges;
soralia marginal and liminal, soredia granular; lower surface black,
rhizinate; rhizines black, simple, up to 1.0 mm long; apothecia rare, up to
6.5 mm in diameter; disc dark brown; epihymenium brown, 9.5- 11.5 µm
thick; hymenium: 30-35 µm high; asci 8-spored, cylindrical; ascospores
colourless, oval, simple, 8.5-11.5 x 5-7 µm.
Habitat: On tree truck (tericolous)
Spot Tests: Medulla K+ yellow turning red, Pd+
orange, cortex K+ yellow, Pd+ yellow.
Secondary Metabolites (TLC): Atranorin, Salazinic acid, Consalazinic
acid
170
Specimen Examined: From Kaghan to Naran, alt. 2,711 m, 29.07.2014,
Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 385 (HUP), near Behari
village Manoor Valley, alt. 2,308 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad
and Mazhar-ul-Islam 460 (HUP), Manoor Valley near forest rest house, alt.
2,514 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 482
(HUP), Shogran, alt. 2,322 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and
Syed Juneed Shah 678 (HUP), Saripaya, alt. 2,830 m, 27.07.2015,Asmat Ullah,
Amir Khan Afridi and Syed Juneed Shah 731 (HUP).
World Distribution: Asia (India, Japan) Canada, Europe (Finland,
France, Portugal) N. America, S. America (Chile, Argentina, Peru), C.
America (Mexico), Australasia (Australia, New Zealand), Antarctica (S.
Georgia).
Parmelina Hale
Thallus foliose, adnate to closely adnate, dorsiventral, circular, lobate;
lobes 0.6-4.5 mm wide, flat, sub linear to sub irregular; apices subrotund to
rotund, ciliate; cilia simple, slender; upper surface gray to gray green, with
or without maculate, soredia, isidia, or pustules; lower surface black or
dark brown, rhizinate; rhizines black, simple to squarrose; ascomata
apothecia, laminal, sessile to subpedicellate up to 4.5 mm in diameter; disc
brown, imperforate; exciple gray or colourless; epihymenium brown or
brownish yellow; hypothecium colourless; asci 8-spored, clavate;
ascospores simple, ellipsoid or subglobose, 9-13 x 5-8 mm. Secondary
metabolites: atranorin, chloroatranorin, lecanoric acid. Substrate: on bark,
rarely on rocks.
This genus has a total of 10 species from the world while previously two
species are reported from Pakistan. The present study reported two species
from District Mansehra.
171
Key genera
1a. Apothecia frequent, isidia absent……………………...……..P. quercina
1a. Apothecia rare, isidia present………………………………………...…2
2a. Isidia cylindrical……………………………………………….P. tilliaceae
2b. Isidia flattened………………………………………………Parmelina sp.
1. Parmelina quercina (Willd.) Hale, Phytologia 28: 483 (1974)
Thallus foiliose, closely adnate to adnate, 2-9.5 cm in diameter, irregular
branched, lobate; lobes 1.5-3.5 mm wide, narrow, sublinear to subirregular,
plane to convex, contiguous to imbricate; apices subrotund, ciliate; cilia
simple; upper surface whitish gray to greenish gray, dull, sometimes
partly pruinose, soredia, isidia and pustulae absent; lower surface black,
rhizinate; rhizines black, simple to rarely squarrose; apothecia laminal, 1.5-
4.5 mm diameter; disc brown, imperforate; ascospores ellipsoid, simple, 6-
11.5 x 5-8.5 µm.
Habitat: On bark (corticolous)
Spot Test: Medulla C+ red, KC+ red, cortex K+
yellow
Secondary Metabolites (TLC): Atranorine, Lecanoric acid.
Specimen Examined: Mandgucha, alt. 1,802 m, 14.11.2013, Asmat
Ullah and Mazhar-ul-Islam 144 (HUP), Manoor Valley near Forest rest
house, alt. 2,498 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-
Islam 461 (HUP), Shogran, alt. 2,320 m, 26.07.2015, Asmat Ullah, Amir Khan
Afridi and Syed Juneed Shah 679 (HUP).
172
World Distribution: Asia, Europe, (C. America (Mexico) N. America
(USA), Africa (S. Africa, Socotra, Morocco), Australasia (Australia, New
Zealand).
2. Parmelina tiliacea (Hoffm.) Hale, Phytologia 28(5): 481 (1974)
Thallus foliose, adnate, 4.5-11.5 cm across, lobate; lobes sublinear,
irregularly branched, 2.5-6.5 mm wide; apices subrotund, margins crenate,
ciliate; cilia simple, black, 0.3-1.0 mm long; upper surface pale grey, dull,
white maculate, partly pruinose, isidiate; lower surface black, rhizinate;
rhizines black, simple, 0.5-1.5 mm long; apothecia rare, sessile, 3.5 µm in
diameter; disc dark brown, concave; epihymenium brown; 15-20 µm thick;
hymenium 30-35 µm high; asci 8-spored, clavate; ascospores colourless,
spherical to shortly ellipsoid, 7.5-11.5 x 5-7 µm.
Habitat: On bark of coniferous trees (corticolous)
Spot Tests: Medulla C+ red, KC + red, cortex K+
yellow,
Secondary metabolites (TLC): Atranorin, Lecanoric acid
Specimen Examined: Kaghan, alt. 2,215 m, 29.07.2014, Asmat Ullah,
Amir Khan Afridi and Syed Juneed Shah 386 (HUP), Naran, alt. 2,668 m,
30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 415 (HUP),
Near Behari village, Manoor Valley, alt. 2,337 m, 03.08.2014, Asmat Ullah,
Ashfaq Ahmad and Mazhar-ul-Islam 462 (HUP), Shogran toward Saripaya,
alt. 2,494 m, 27.08.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah
734 (HUP).
World Distribution: Asia (India, China) Europe, Africa (Sahara, S.
Africa, Madagascar)
173
Parmeliopsis (Nyl.) Nyl.
Thallus foliose, dorsiventral, adnate, closely apressed, lobate; lobes linear
to sublinear, discrete and divaricate, or contiguous to overlapping, thin; tip
incised, eciliate; upper surface yellow green or gray, lacking isidia,
maculae, pseudocyphellae, sorediate; lower surface whitish to pale or dark
brown to black, rhizinate; rhizines usually concolorous with lower surface,
moderately dense, simple or sparsely furcated; ascomata rare, apothecia,
laminal, sessile to semi-stalked; disc pale to dark brown, concave,
becoming flat, imperforate; true exciple gray or colourless; epihymenium
pale brown, 5-30 µm; hymenium colourless, 30-55 µm high; paraphyses
simple, hypothecium colourless; asci: Lecanora-type, 8-spored, clavate;
ascospores simple, reniform to ellipsoid, obtuse at poles, with one end
more pointed. Secondary metabolites: atranorine, usnic acid, divaricatic
acid. Substrate: on bark, wood rarely on rock.
The genus represented four species from world while previously single
taxa from Pakistan. The present study recorded one taxas from District
Mansehra.
1. Parmeliopsis ambigua (Wulfen) Nyl., Lich. Lapp. Orient. 8: 121
(1866)
Thallus foliose, closely adnate, 1-4.5 cm diameter, forming small rosettes,
lobate; lobes discrete, flat to concave, 1 mm wide; upper surface yellowish
green, smooth, soralia laminal; lower surface pale brown to dark,
rhizinate; rhizines simple, concolorous with lower surface, scattered;
apothecia rare, sessile to shortly pedicillate, up to 1-1.5 mm in diameter;
disc brown, flat or convex, epruinose; epihymenium pale brown, smooth;
hymenium colourless, 50-55 µm high; ascospores 6.0-12.5 x 1.5-4.5 µm,
ellipsoid or one end more pointed.
Habitat On bark (corticolous)
174
Spot Tests: Cortex KC+ yellow,
Secondary Metabolites (TLC): Usnic acid
Specimen Examined: Dader, alt. 1,220 m, 08.11.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad 81 (HUP), Mandagucha, alt. 1,809 m,
14.11.2013, Asmat Ullah and Mazhar-ul-Islam 145 (HUP), Oghi top, alt. 1,610
m, 15.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleem Shah 260 (HUP),
Balakot. alt. 1,217 m, 26.04.2014, Asmat Ullah, Amir Khan Afridi and Syed
Mushraf Shah 297 (HUP).
World Distribution: Asia, Europe, Africa (Morocco), C. America
(Mexico), N. America (USA), South America, Australasia (Australia).
Note: New to the study area
Punctelia Krog
Thallus foliose, adnate to loosely adnate, heteromerous, lobate; lobes 3- 18
mm wide, subirregular to irregular, partly imbricate, margins entire or
incised, apices rotund; upper surface gray to gray green, emaculate,
pseudocyphellate, with or without soralia or isidia; lower surface white to
pale black, rhizinate; rhizines rhizines: simple, brownish to pale, sparse to
abundant; apothecia substipitate to stipitate, laminal; disc pale to dark
brown; asci Lecanora-type, 8-spored; ascospores colourless, ellipsoid,
simple, 10-25 x 7-16 µm. Secondary metabolites: atranorine, aliphatic acid,
orcinol depsides. Substrate: barks.
Thi genus has a total of 30 species from the globe while previously single
taxa from Pakistan. The present study reported single taxa from District
Mansehra as new to Pakistan.
175
1. Punctelia subrudecta (Nyl.) Krog, Nordic Jl Bot. 2(3): 291 (1982)
Thallus foliose, 3-5 cm wide, rosette or irregular, loosely to closely adnate,
lobate; lobes 1-2.5 mm wide, flat to concave, irregular; upper surface
yellowish gray, usually shiny, smooth, sorediate, pseudocyphellae
scattered, laminal, punctiform; soralia laminal; soredia farinose to very
coarse; lower surface whitish to pale brown, smooth, rhizinate; rhizines
concolorous with lower surface, simple, apothecia: not seen.
Habitat: On tree trunk (corticolous)
Spot Tests: Cortex K+ yellow, Medulla C+ red, KC+ red
Secondary metabolites: Atranorine, Lecanoric acid
Specimen Examined: Near Dader, alt, 1,252 m, 10.10.2013, Asmat
Ullah, Amir Khan Afridi and Syed Muhammad 16 (HUP), On the side of
Kaghan and Naran road, alt. 2,178 m, 29.07.2014, Asmat Ullah, Amir Khan
Afridi and Syed Juneed Shah 387 (HUP), Naran, alt. 2,554 m, 30.07.2014,
Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 417 (HUP), Shogran, alt.
2,334 m, 26.07.2015, Asmat Ullah, Amir Khan Afrid and Syed Juneed Shah 680
(HUP), Saripaya, alt. 2,625 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and
Syed Juneed Shah 736 (HUP).
World Distribution: Asia, Europe, Australasia (Australia, New
Zealand), Africa (S. Africa, Madagascar, N. Africa, E. Africa), Antarctica,
Pacific (Hawaii).
Note: A new recorde to Pakistan
Usnea Dill. ex Adans.
Thallus fruticose, erect to pendant, filamentous, attached by holdfast,
branched; branches primary branches tapering towards secondary
branches, stout, smooth or faveolate, with or without, papillae,
176
pseudoisidia, fibrils, or soredia, isidomorphs, yellowish to pale greenish,
blackened near holdfast; ascomata apothecia, sessile to pedicellate, lateral,
subterminal or terminal, cup shaped; disc rounded, flat or concave,
pruinose or not; asci Lecanora-type, elongate-clavate, 8-spored; ascospores
colourless, simple, ellipsoid. Secondary metabolites: usnic acid, depsides,
depsidones or fatty acid. Substrate: on trees.
This genus has 250 species from world while previously six species are
reported from Pakistan. The present study recorded two species from
District Mansehra.
Key to species
1a. Thallus with soralia, true isidia or isidiomorphs……………………...2
1b. Thallus without soredia………………………………….………………3
2a. Soralia irregular, crowded and coalescing………….….U. fulvoreagens
2b. Soralia regular, rounded, discrete…………………………….Unsea sp.
3a. Thallus with papillae, medulla K+ orange……………………U. florida
3b. Thallus without papillae, Medull K-………………………….Usnea sp.
1. Usnea florida (L.) Weber ex F.H. Wigg., Prim. fl. holsat. (Kiliae) 2: 7
(1780).
Thallus fruticose, erect, 2-9.5 cm long, usually isotomic-dichotomous,
divergent, branches; basal part black, often with distinct annulations;
branches main branches tapering segment, cylindrical and terete, papillae
sparse to numerous, verrucose tubercles, fibercules absent, rare, fibrils 2-5
mm long, slender; apothecia numerous, terminal on main branches; disc
flat, smooth or wrinkled, 0.5-2.0 cm in diameter; ascospores 9-11 x 5-7 µm,
ellipsoid.
177
Habitat: On bark of Pinus trees
Spot Tests: Cortex KC- or KC+ rose, medulla K+
yellow, KC- or KC+ rose, Pd+ yellow-
oranges
Secondary Metabolites (TLC): Thamnolic acid, alectorialic acid
Specimens Examined: Manoor Valley, alt. 2,505 m, 03.08.2014, Asmat
Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 463 (HUP).
World Distribution: Asia, Europe (Sweden, Norway, Denmark),
Africa (Morocco, Socotra), N. America, S. America, C. America (Guatemala,
Panama, Mexico), Pacific (Hawaii).
2. Usnea fulvoreagens (Räsänen) Räsänen, Lich. Fenn. Exs.: no. 13
(1935)
Thallus fruticose, erect, rarely subpendulous, 2-4.5 cm long, branching
isotomic- to anisotomic-dichotomous, main branches cylindrical, to 1.5 mm
diameter; basal part black, cylindrical and terete, papillae, verrucous, few
to numerous, irregularly distributed; tubercles absent, fibercles absent,
fibrils few to numerous, slender, soralia conspicuous, deeply excavate,
typically reaching the central axis; apothecia not seen in the study
specimens.
Habitat: On tress trunks (Corticolous)
Spot Tests: Thallus K+ yellow-red, Pd+ yellow-
orange,
Secondary Metabolites (TLC): Usnic acid, Norstictic acid, Stictic acid
Specimens Examined: Shogran on way to Saripaya, alt. 2,438 m,
27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 730 (HUP).
178
World Distribution: Asia, Europe (Scotland, Ireland), N. America, C.
America.
Note: New to the study area.
Xanthoparmelia Hale
Thallus foliose to subcrustose, dorsiventrally flattened, loosely to closely
appressed, corticated on both sides, 3-10 cm in diameter, lobate; lobes
irregular to linear, lobes tips subrotuned, lacking cilia; upper surface
yellow-green to yellow, smooth to rugulose, epruinose, with or without
isidia, soredia and dactyls, pseudcyphellae absent; lower surface black,
brown or tan to light reddish brown, sparsely to densely rhizinate; rhizines
simple, black or some shade of brown; ascomata apothecia, sessile or semi-
stalked, laminal; disc red-brown to brown or black, imperforate, concave,
exciple gray or colourless; epihymenium brown or brownish yellow;
hypothecium colourless; asci lecanoral, 8-spored; ascospores colourless,
ellipsoid, simple, 7-13 x 4-7 µm. Secondary metabolites: usnic acid, orcinol
depsides, orcinol depsidones, β-orcinol depsides, aliphatic acid,
antraquinones. Substrate: mostely on rocks, sometimes on soil.
This genus has 750 species distributed worldwide while previously four
species are reported from Pakistan. The present study recorded two species
from District Mansehra.
Key to species
1a. Medulla with major stictic acid norstictic acid and stictic acid
major…………………………………………………….……X. conspersa
1b. Medulla with major salazinic acis………………………………………2
2a. Thallus loosely attached substratum, lobes more than 2mm
wide………………………………………………...….Xanthoparmelia sp.
179
2b. Thallus tightly attached to substratum, lobes are less than 2 mm
wide…...........................................................................................X. tinctina
1. Xanthoparmelia conspersa (Ehrh. ex Ach.) Hale, Phytologia 28: 485
(1974)
Thallus foliose, 4-11 cm in diameter, adnate to loosely adnate, lobate; lobes
1-2.5 mm wide, subirregular, elongate, plane to subconvex, contiguous to
somewhat imbricate; apices subrotund to subtruncate, eciliate; upper
surface yellow-green, smooth, isidiate; isidia numerous, laminal, initially
globose and constricted at base or cylindrical, simple to coralloid branched;
lower surface black, plane, rhizinate; rhizines black, simple, short;
apothecia not seen in the study specimens.
Habitat: On rocks (Saxicolous)
Spot Tests: Medulla K+ yellow to orange, C-, KC-,
Pd+ orange
Secondary Metabolites (TLC): Usnic acid, stictic acid, constictic,
norstictic acids
Specimen Examined: Dader, alt. 1,207 m, 08.11.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad 82 (HUP), Behsal, alt. 3,297 m,
11.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 584 (HUP),
above Lolosar Lake, alt. 3,570 m, 11.08.2014, Asmat Ullah, Ashfaq Ahmad and
Mazar-ul-Islam 598 (HUP).
World Distribution: Asia (Turkey, Russaia, Japan), Europe (Finland,
Belgium, Norway, Italy, Austraia, Hungary) Africa (N. Africa, S. Africa), N.
America (USA, Canada), S. America, C. America,, (Guatemala, Mexico),
Pacific (New Caledonia, Hawaii).
Note: New to the study area.
180
2. Xanthoparmelia tinctina (Maheu & A. Gillet) Hale, Phytologia 28:
489 (1974)
Thallus foliose, adnate, 2.5-8.5 cm in diameter, lobate; lobes 2-3 mm wide,
irregular, somewhat elongate, plane to slightly convex, contiguous to
slightly imbricate; apices subrotund, eciliate; upper surface yellow-green,
smooth and shiny, isidiate; isidia frequent, globose to subcylindrical,
laminal; lower surface black, plane, with sparse to densely rhizinate;
rhizines simple, black, 0.2-0.5 mm long; apothecia not seen in the study
specimens.
Habitat: On rocks (saxicolous)
Spot Tests: Cortex K-, C-, KC-, Pd-; medulla K+ red,
C-, KC-, Pd+ red
Secondary Metabolites (TLC): Usnic acid, Salazinic acid, Consalazinic
acid, norstictic acids
Specimen Examined: Dader, alt. 1,235 m, 10.10.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad 04 (HUP), Naran on way to Lake
saif-ul-Maluk, alt. 2,700 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and
Syed Juneed Shah 419 (HUP).
World Distribution: Asia (Pakistan, India) Europe (France, Sweden,
Spain, Italy, Portugal, Romania, Hungary, Greece, Bulgaria) Africa
(Morocco, Algeria, E. Africa, S Africa), S. America (Argentina), N. America
(Arizona), C. America (Mexico).
181
Fig. 4.20: Distribution of Parmeliaceae in District Mansehra: 1. Behsal, 2. Jalkhad, 3. Lalazar, 4. lake Saif-ul-Maluk, 5. Manoor Valley, 6. Paras, 7. Sharan, 8. Shogran, 9. Managhucha, 10. Dader, 11. Batal, 12.Ooghi top.
Plate 3.20: Canoparmelia texana in District Mansehra.
182
Plate 3.21: Flavoparmelia caperata (scale= 2 cm) in District Mansehra.
Plate 3.22: A. Flavopunctelia flaventior, B. Flavopunctelia soredica (scale= 2 cm) in District Mansehra.
183
Plate 3.23: Parmelia sulcuta (scale= 2 cm) in District Mansehra.
184
15. Peltigeraceae
Thallus subfruticose to foliose; lower surface non corticated or partly
corticated attached to substratum with loose hyphae or rhizine; apothecia
marginal and roundish, without thalline margin; acsi 2-8 spored; spores
colourless or dark coloured, elongate, 1-many septate. Habitat: soil, over
mosses and rocks. Distribution: Boreal to temperate.
Genera in study area: The present study recorded single genus from
District Mansehra (Fig. 4.21).
Peltigera Willd.
Thallus foliose, 2-30 cm in diameter, lobate; lobes flattened and elongate,
imbricate or separate, dichotomously branched, imbricate; tip rounded to
subtruncate, ascending; upper surface bright green, blue gray, gray-brown
or brown, dull or shiny, smooth, with or without soredia or isidia; lower
surface brownish white, densely arachnoid-tomentose or with
anastomosing pale or dark veins, rhizinate; rhizines simple, bushy or
fasciculate; ascomata frequent, apothecia, ovoid, semi-immersed; disc red-
brown to black, smooth, saddle-shaped, flat or oval; hymenium colourless
below, brown above; paraphyses simple, septate, upper part brown; asci
cylindrical, fissitunicate, 8-spored; ascospores colourless to pale brown,
fusiform to acicular, 3-septate or occasionally many septate. Secondary
metabolites: tenuiorin, gyrophoric acid, methyl gyrophate and hopane
triterpenoids. Substrate: on soil and among mosses over rocks occasionally
on tree trunks.
A total of 70 species of the genus are reported from world while previously
six species from Pakistan.The present study recorded three species from
district Mansehra (Plate 3.24).
185
Key to species
1a. Rhizines confluent…………………………………………….P. rufescens
1b. Rhizines separate…………………………………………………………2
2a. Apothecia disc flat, rhizines arrange in concentric
lines……………………………………………………...…..P. horizontalis
2b. Apothecia tubular or saddle shaped, rhizines not in concentric
lines………………………………………………………………….……..3
3a. Apothecia saddle shaped, thallus gray brown, vein
brown……………………………………..……………….P. polydactyloon
3b. Apothecia tubular, thallus blue, vein blacking in
center……………………………………………………….…Peltigera sp.
1. Peltigera horizontalis (Huds.) Baumg., Fl. Lips.: 562 (1790)
Thallus foliose, adnate, 5.5-9.0 cm in diameter, lobate; lobes elongatete, 2
cm wide and up to 4.5 cm long, imbricate; tips rounded to subtruncate;
upper surface blue-gray, often tinged brown, shiny, smooth, without
soredia and isidia; lower surface white, smooth, flattened veins becoming
darker toward center, rhizinate; rhizines brown-black or black, fasciculate;
apothecia rounded, up to 6.5 mm in diameter; disc red brown, flat;
ascospores colourless to pale brown, 3- septate, 32-45 x 4-7 µm.
Habitat: Soil over mosses (tericolous)
Spot Tests: All negative
Secondary Metabolites (TLC): Tenuiorin, Gyrophoric acid, Methyl
gyrophate
186
Specimen Examined: Manoor Valley near Bahari forest rest house, alt.
2,568 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmah and Mazhar-ul-Islam 466
(HUP).
World Distribution: Asia, Europe, British Isles, Africa, Australia and
North America
2. Peltigera polydactylon (Neck.) Hoffm., Descr. Adumb. Plant. Lich.
1(1): 19 (1789) [1790]
Thallus foliose, adnate, 5-18 cm in diameter, lobate; lobes 1-1.5 cm wide
and up to 4-5.5 cm long, imbricate; tips rounded to subtruncate, ascending;
upper surface dark brown, shiny, smooth, without soredia and isidia;
lower surface white, rhizinate; rhizines brown to black, bushy or
fasciculate branched; apothecia: rare, up to 7 mm in diameter, round to
oblong; disc pale to dark brown; ascospores colourless to pale brown, 3-
septate, 45-68 x 3-4.5 µm.
Habitat: Soil over mosses (tericolous)
Spot Tests: All negative
Secondary Metabolites (TLC): Tenuiorin, Gyrophoric acid, Methyl
gyrophate and Zeorine
Specimen Examined: Manoor Valley on way Ansoo Lake, alt. 2,700 m,
04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 488 (HUP).
World Distribution: Asia, Europe (England, Scotland), Africa (S.
Africa, Tanzania, Morocco, Kenya) S. America (Brazil, Colombia,
Argentina, Chile), N. America, C. America (Mexico), Australasia, Pacific.
187
3. Peltigera rufescens (Weiss) Humb., Fl. Friberg. Spec. (Berlin): 2
(1793)
Thallus foliose, rosette forming or fragmented, 5-18 cm in diameter; lobes 1
cm wide and up to 4.5 cm long, contiguous or somewhat overlapping; tips
rounded, often ascending; upper surface grayish brown to brown, dull,
smooth, white-gray pruinose, without isidia or soredia; lower surface; pale
brown, with anastomosing brown veins, rhizinate; rhizines brown,
fasciculate; apothecia frequent, up to 4.5 mm in diameter, oblong, saddle-
shaped; disc red-brown to black, recurved; ascospores: 35-70 x 3-5 µm,
colourless to pale brown, 3-5-septate.
Habitat: Soil (tericolous)
Spot Tests: All negative
Secondary metabolites: None detected.
Specimen Examined: Shogran on way to Saripaya, alt. 2,610 m,
27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 727 (HUP).
World Distribution: Asia, Europe, British Isles, North America,
South America, C. America, Australasia (Australia, New Zealand), Pacific
(Hawaii), Antarctica.
188
Fig. 4.21: Distribution of Peltigeraceae in District Mansehra; 1. Batakundi, 2. Manoor Valley near forest rest house, 3. Shogran.
189
Plate 3.24: A. Peltigera horizontalis, B. Peltigera polydactylon, C. Peltigera rufescens (scale= 2 cm) in District Mansehra.
190
16. Peltulaceae
Genera in study area: The present study recorded single genera from
District Mansehara (Fig. 4.22).
Peltula Nyl.
Thallus crustose, areolate, squamulose, or subfruticose, dorsiventral,
margin: minutely lobate to effigurate; upper surface olive green to olive
brown, rarely black, corticated, with or without soredia; lower surface
corticated, attached by an umbilicus, rhizohyphal weft or rhizines;
ascomata apothecia, immersed; disc punctiform; asci 16-100 or more
spores, clavate to obclavate, 65-160 x 8-30 µm; ascospores simple, hyaline,
globose to ellipsoid, 3-12 x 2-6 µm. Secondary metabolites: none detected.
Substrate: acidic or calcareous rocks or soil.
This genus has 40 species from the world while three species from
Pakistan.The present study recorded single taxa from District Mansehra
(Plat 3.25).
1. Peltula obscurans (Nyl.) Gyeln., Reprium nov. Spec. Regni veg. 38:
308 (1935)
Thallus squamulose, often widely scattered but sometimes rosette-shaped;
squamules lightly or deeply lobed, flat to convex, up to 2 mm diameter;
upper surface olive-brown to brown, not sorediate; lower surface paler
than the upper surface, attached by a branched umbilicus; apothecia one
per squamule, adnate, with a raised rim; disc red to yellow-brown, 0.5-1
mm in diameter; ascospores ovoid to ellipsoid, 4.5-7.6 x 3 µm.
Habitat: On rocks (saxicolous)
Spot Test: All negative
Secondary Metabolites (TLC): None detected
191
Specimen Examined: Dader, alt. 1,205 m, 10.10.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad 18 (HUP).
World Distribution: Asia, Southern Europe, S. America, N. America,
C. America (Mexico), Australasia (Australia).
Fig. 4.22: Distribution of Peltulaceae in District Mansehra. 1. Dader.
Plate 3.25: Peltula obscurans (scale= 2 cm) in District Mansehra.
192
17. Pertusariaceae
Thallus crustose; apothecia perithecia; spores septate to muriform.
Habitate: trees, rocks. Distribution: Boreal to temperate.
Genera in study area: The present study recorded single genera from
District Mansehra (Fig. 4.23).
Pertusaria DC. in Lam. & DC.
Thallus crustose, thick or thin, continuous, cracked or areloate; upper
surface gray but some green or yellow, white or blue black, dull or shiny,
smooth or rugulose, with or without soredia or isidia; ascomata entirely or
partly immersed; disc small, punctiform to broad; epihymenium colourless
to dark, prominent; hymenium colourless, subglobose to discoid;
hypothecium colourless, reduce; asci 1-8- spored, clvavate to cylindrical;
ascospores simple, colourless, thick walled, ellipsoid. Secondary
metabolites: xanthones, β-orcinol depsides, or fatty acid. Substrate: bark,
rock, soil or moss.
The genus represented 350 species from the world and five species from
Pakistan. The present study recorded single taxa from District Mansehra
(Plate 3.26).
1. Pertusaria leioplaca DC., in de Candolle & Lamarck, Fl. franç., Edn
3 (Paris) 5/6: 173 (1815)
Thallus crustose, fissured with thin verrucae, margins entire; uppers
surface white to pale gray shiny, smooth, not pruinose, without isidia or
soredia; fertile verrucae numerous, concolorous with thallus, 0.6-2.0 mm in
diameter; apothecia 2-4 per verruca; disc black, punctiform; epihymenium
colourless; hymenium colourless, 430 µm tall; hypothecium colourless to
yellowish; asci 4-8-spored, cylindrical; ascospores colourless, ellipsoid, 40-
110 x 25-45 µm.
193
Habitat: On bark (Corticolous)
Spot Tests: Thallus K+ yellow, C-, KC yellow, Pd+
orange.
Secondary Metabolites (TLC): Stictic acid, constictic acid.
Specimen Examined: Mandagucha, alt. 2,053 m, 14.11.2013, Asmat
Ullah and Mazhar-ul-Islam 147 (HUP), Shogran, alt. 2,407 m, 27.07.2015,
Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 728 (HUP).
World Distribution: Asia, Europe, British Isles, Africa (S. Africa,
Morocco), North America, S. America, C. America (Mexico, Nicaragua),
Caribbean (Bermuda), Pacific (New Caledonia, Hawaii, Marquesas).
Note: New to study area.
Fig. 4.23: Distribution of Pertusariaceae in District Mansehra; 1. Shogran, 2. Mandagucha.
194
Plate 3.26: Pertusaria leioplaca (scale= 2 cm) in District Mansehra.
195
18. Physciaceae
Thallus crustose or foliose; apothecia lecanorine or biatorine; spores brown,
2- celled or polarilocular. Habitat: rocks and trees. Distribution: boreal to
temperate.
Genera in study area: The present study recorded seven genera from
District Mansehra (Fig. 4.24).
Key to genera
1a. Thallus Crustose………………………………………………………….2
1a. Thallus foliose ………………………………………………………...….3
2a. Asci 8-spored…………………………………………………..Amandinea
2b. Asci 4-16 or polysporous………………………………….……….Buellia
3a. Upper surface of Thallus with short hairs, mostly at lobes
tip……………………………………………………………….Anaptychia
3b. Upper surface of Thallus without hair…………………………..…….4
4a. Thallus divided deeply, lobes linear, 1 mm wide………….…..Physica
4a. Not as above
5a. Ascspores dark brown, thin walled, smooth, 1-septate…..Hetrodermia
5b. Ascospores brown………………………………………..………………6
6a. Lower surface black to brown, rhizene black, squarrosely
branched………………………………………………………....Physconia
6b. Lower white or black, rhizine simple, black…………...…Phaeophyscia
196
Amandinea M. Choisy ex Scheid. & H. Mayrhofer
Thallus crustose, rimose, sometimes bullate; ascomata apothecia,
lecanorine or lecideine, immersed or sessile, broad or constricted base;
epihymenium brown; hymenium without oil droplets; paraphyses simple
or branched, apicall cell swollen and pigmented with dark brown cap; asci
clavate, 8-spored, Lecanora-type; ascospores 1-septate, without or with
median spore wall thickening, brown. Substrate: on bark, soil, rocks and
artificial substrata. Distribution in world: cosmopolitan.
A total of 30 species of the genus are reported from globe and previously
three species from Pakistan. The present study recorded one species from
District Mansehra (Plat 3.28).
1. Amandinea punctata (Hoffm.) Coppins & Scheid., Lichenologist
25(4): 343 (1993)
Thallus crustose, smooth to rimose, very thin or inconspicuous; prothallus
rarely present, dark or gray; upper surface pale to dark gray, rarely brown,
epruinose, esorediate; apothecia numerous, lecideine; 0.3-0.6 mm in
diameter; disc black, flat to slightly convex, epruinose; epihymenium
brown; hymenium hyaline, without oil droplets; paraphyses simple to
slightly branched, apical cell swollen, with a brown cap; asci 8-spored,
clavate, Bacidia-type; ascospores brown, ellipsoid, 1-septate, 11.5 -16.5 x 5.5-
9.0 µm.
Habitat: On bark or wood (corticolous)
Spot Tests: All negative,
Secondary Metabolites (TLC): None detected
Specimen Examined: On way to Naran, alt. 2,452 m, 29.07.2014, Asmat
Ullah, Syed Juneed Shah and Amir Khan Afridi 389 (HUP), Manoor Valley, alt.
197
2660m, 04.08.2014, Asmat Ullah, Mazhar-ul-Islam and Ashfaq Ahmad 489
(HUP), Shogran, alt. 2,320 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and
Syed Juneed Shah 684 (HUP).
World Distribution: Asia, Europe. Africa (S. Africa, Morocco), S.
America, N. America, C. America (Mexico), Caribbean (Bermuda,
Guadeloupe), Antarctica, Pacific (Hawaii).
Note: New to the study area.
Anaptychia Korb.
Thallus foliose or shrubby, dorsiventral, moderately to very loosely
attached, small to medium sized, lobate; lobes branched, elongate; upper
surface dingy white or gray to dark brown, matt, with marginal cilia,
soredia and isidia absent; lower surface pale or darkening, rhizinate;
rhizines pale or darkening, simple or furcate to squarrosely branched;
ascomata apothecia, stalked, rather rare; asci 8-spored, Lecanora-type,
subclavate to clavate; ascospores Physconia-type, dark brown, 1-septate,
25.5-45 x 12.5-23 µm. Secondary metabolites: none. Substrate: bark, wood,
rocks and sometime on soil.
A total of 15 species of the genus are reported from world while previously
two species reported from Pakistan. The present study recorded two
species from District Mansehra (Plate 3.29).
Key to species
1a. On rock, thallus brown, without marginal
cilia……………………………………………..……Anaptychia runcinata
1b. Epiphytic, thallus grey, with marginal cilia……..…Anaptychia crinalis
198
1. Anaptychia crinalis (Schleich.) Vezda
Thallus foliose or fruticose, dorsiventral, 4-7 cm wide, lobate; lobes
elongate to linear, branched, prostrate to erect , flattened; upper surface
brown, whitish grey, greyish- brown to brown, matt, smooth, or with some
tiny hairs; epruinose, isidia and soredia absent; lower surface white,
rhizinet; rhizine, simple, unbranched; ascomata apothecia, 2.5-4.5 mm in
diameter, stalked; disc flat to concave, occasionally with white pruina,
dark, brown; asci lecanora- type; ascospores hyaline, oblong-ellipsoid, thin
walled, 2-celled, 36-45 x 17.5-21.5 µm in diameter.
Habitate: On bark
Spot Tests: All negative
Secondary Metabolites: None detected
Specimen Examined: Manoor Valley near Forest rest house, alt. 2,569
m, 03.08.2014, Asmat Ullah, Mazhar-ul-Islam and Ashfaq Ahmad 467 (HUP),
Shogran, alt. 2,337 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed
Juneed Shah 689 (HUP), on way to Saripaya, alt. 2,617 m, 27.07.2015, Asmat
Ullah, Amir Khan Afridi and Syed Juneed Shah 737 (HUP).
World Distribution: Asia (Iran, Turkey), Europe (Central and
southern Europe), N. America (Ontario, Michigan).
Note: A new record to Pakistan.
2. Anaptychia runcinata (With.) J.R. Laundon, Lichenologist 16(3): 225
(1984)
Thallus foliose, orbicular, 9 cm in diameter, forming rosettes, closely
attached, lobate; lobes 0.25-2.5 mm wide, flat to convex, slightly wider at
the apices, overlapping towards the center; upper surface dark brown, dull
olive green when wet; lower surface pale to brown black, rhizinet; rhizines
199
simple, brown to black, scattered; apothecia frequent, 1-2.5 mm in
diameter; disc black-brown.
Habitat: On rocks.
Spot Tests: All negative
Secondary Metabolites (TLC): None detected
Specimen Examined: Mandagucha, alt. 1,866 m, 14.11.2013, Asmat
Ullah and Mazhar-ul-Islam 48 (HUP).
World Distribution: Asia (Turkey, China, Pakistan, Mongolia),
Europe, Africa (N. Africa, Morocco).
Note: New to the study area
Buellia De Not., Giorn. Bot. Ital. 2: 174-224 (1864), nom. Cons.
Thallus crustose, smooth, rimose, areolate, granular, placodiod, sometimes
subsquamulose or sublobate; prothallus frequently present, usually dark;
upper surface white to gray, yellow or brown, plane to uneven, smooth to
roughened, epruinose or pruinose; ascomata apothecial, immersed to
sessile, black, sometimes white-pruinose; disc rarely concave, usually
plane, black or dark brown, pruinose or epruinose; hymenium hyaline or
green in upper part, with or without oil drop; paraphyses free, apically
swollen, with pigmented cap; epihymenium brown, green black, or dull
olive; asci clavate, Lecanora-type, 4-16 or polysporous; ascospores brown,
ellipsoid, straight or curved, oblong or fusiform, 1 septate. Secondary
metabolites. 2-O-methylperlatolic acid, atranorine, barbatic acid,
connorstictic acid, confluentic acid and norstictic acid. Substrate. On bark,
wood, siliceous or rarely calcareous rocks, some species grow on soil.
200
A total of 400 species of the genus are reported from the world and two
species from Pakistan while the present study recorded single taxa from
District Mansehra (Plate 3.30).
1. Buellia stellulata (Taylor) Mudd, Man. Brit. Lich.: 216 (1861)
Thallus crustose, rimose-cracked, 1-2 cm in diameter; prothallus
conspicuous black, strongly developed in most specimens and growing
between areoles; upper surface usually white to pale gray or dark gray,
dull or shiny, epruinose, esorediate; apothecia lecideine, 0.2-3 mm in
diameter, immersed , rarely sessile; disc black, epruinose, plane, with age
becoming slightly convex; exciple thin; epihymenium olive green;
hymenium hyaline, without oil drop; asci clavate, bacidia-type, 8-spored;
ascospores soon brown, oblong to ellipsoid, 1 septate, , wall evenly
thickened, 8.7-11 x 4.8-6.1 µm in diameter.
Habitat: On siliceous rock (Saxicolous)
Spot Tests: K+ yellow turning red, C-, KC-, Pd-
Secondary Metabolites (TLC): Norstictic acid
Specimen Examined: Dader, alt. 1,223 m, 10.10.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad 19 (HUP).
World Distribution: Asia, Europe, Africa, North America, South
America, Australia, New Zealand
Heterodermia Trevis. Atti della Soc. Ital. Sci. Nat. 11: 613 (1869)
Thallus foliose, dorsiventral, heteromerous, rosette forming, loosely to
closely attached lobate; lobes linear or linear - cuneate, elongate to shorter,
branching dichotomous to irregular; tips rounded, sometimes ascending,
marginal cilia present or absent; cilia black or pale; upper surface grayish
to gray white or greenish white, soredia or isidia present or absent; lower
201
surface white, pale to dark grayish, corticated or ecorticated, often coloured
with yellow orange pigment, rhizinate; rhizines simple to branched, white
to black; apothecia rare; disc brown or black; asci 8-spored, Lecanora-
type; ascospores dark brown, thick walled, smooth, 1-septate, 15-54 x 7-25
µm. Secondary metabolites: atranorine zeorine, ß-orcinol depsides and ß-
orcinol depsidones and different pigments. Substrate: rocks bark or wood,
rarely on soil.
A total of 92 species of the genus are distributed worldwide and previously
five species are reported from Pakistan. The present study recorded two
species from District Mansehra.
Key to species
1a. Apothecia laminal, lobes sorediate………………………………….….2
1b. Apothecia apical, lobes not sorediat…………….……Heterodermia sp.
2a. Lower surface with yellow or orange pigment………........H. obsurata
2b. Lower surface without yellow or orange pigment…………H. japonica
1. Heterodermia japonica (M. Satô) Swinscow & Krog, Lichenologist 8:
122 (1976)
Thallus foliose, up to 6.5 cm in diameter, loosely adnate, lobate; lobes up to
2 mm wide, sublinear, elongate, not ascending; upper surface greenish
white, uneven, sorediate; soredia farinose to granular; lower surface white,
ecorticated, spotted with pale yellow to orange pigment, rhizinate; rhizines
black, marginal, simple, 1-4 mm long; apothecia rare, 1-8 mm in diameter;
disc brown, concave, pruinose; asci 8-spored, cylindrical to
subclavate; ascospores brown, ellipsoid, l-septate, 20-30 x 11-16 µm.
Habitat: On tree trunks (corticolous)
202
Spot Tests: Cortex K+ yellow, Pd+ yellow; medulla
K+ yellow or yellow to orange, Pd- or +
yellow to orange
Secondary Metabolites (TLC): Atranorin, chloroatranorin, zeorin,
norstictic acid, salazinic acid
Specimen Examined: Kaghan on way to Naran, alt. 2,236 m,
29.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 390 (HUP),
Naran, alt. 2,504 m, 29.07.2014, Asmat Ullah, Amir Khan and Syed Juneed
Shah 407 (HUP), Manoor Valley, alt. 2,623 m, 04.08.2014, Asmat Ullah,
Ashfaq Ahmad and Mazhar-ul-Islam 490 (HUP), Shogran, alt. 2,319 m,
26.07.2015, Asmat Ullah, Amir Khan and Syed Juneed Shah 685 (HUP).
World Distribution: Asia (Pakistan, Tiawan, Philphine), Europe. N.
America
Note: New to the study area.
2. Heterodermia obscurata (Nyl.) Trevis., Nuovo G. bot. ital. 1: 114
(1869)
Thallus foliose, 2-4.5 cm diameter, orbicular rosettes or irregularly
spreading, lobate; lobes flat to slightly, eciliate; upper surface gray-white,
shiny, rarely pruinose sorediate; soredia granular; lower surface rhizinate;
rhizines black, simple to squarrosely branched, marginal; apothecia 1-4.5
mm in diameter, rare; dis: blackish brown, epruinose; asci 8-spored,
cylindrical to subclavate; ascospores 27.5-35 x 15.5-20 µm in
diameter, brown, ellipsoid, l-septate.
Habitat: On tree trunks (corticolous)
Spot Tests: Cortex K+ yellow, Pd+ yellow
Secondary Metabolites (TLC): Atranorin, chloroatranorin, zeorin
203
Specimen Examined: Behari village, Manoor Valley, alt. 2,487 m,
03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam, 467 (HUP),
Kiwai, alt. 1,720 m, 22.08.2015, Asmat Ullah and Amir Khan Afridi 767
(HUP).
World Distribution: Asia (Pakistan, Tiawan), Europe, N. America
Note: New to the study area.
Phaeophyscia R. Moberg Symb. Bot. Ups. 22(1): 29 (1977).
Thallus foliose, lobate; lobes discrete or weakly overlapping, short or
usually elongate, less or more closely adnate; upper surface gray brown to
dark brown often dark green when wet, soredia or isidia present or absent;
lower surface white or black, rhizinate; rhizines simple, black; ascomata
apothecia, sessile, laminal, with rhizines on lower side disc brown to black;
epihymenium brown, hymenium colourless; paraphysis slender, apices
pale brown, clavate; asci Lecanora-type, 8-spored; ascospores 1-septate,
brown. Secondary metabolites: skyrin.
A total of 40 species of the genus are reported from the world and eight
species from Pakistan.The present study recorded three species from
District Mansehra (Plate 3.31).
Key to species
1a. Soralia or isidia absent…………………………………………...,……..2
1b. Soralia or isidia predent…………………………………………………3
2a. Medulla white, corticolous……………………………………...P. ciliata
2b. Medulla orange red, saxicolous……………………………P. endoccina
3a. With soredia, no isidia ……………………………………….P. orbicular
204
3b. With isidia-soredia or isidia……………………………Phaeophyscia sp.
1. Phaeophyscia ciliata (Hoffm.) Moberg, Symb. bot. upsal. 22(no. 1):
30 (1977)
Thallus foliose, orbicular, up to 4.5 cm in diameter; lobes elongate and
discrete, 1.5 mm broad, usually flat, prostrate; upper surface brown to dark
brown, epruinose, without soredia or isidia; lower surface black, dull to
weakly shiny, rhizinate; rhizines abundant, simple, black; apothecia
abundant, sessile, up to 2.5 mm in diameter, with a corona of rhizines;
ascospores Physcia-type, ellipsoid, 17-24 x 7-10 µm.
Habitat: On bark (corticolous)
Spot Tests: All negative
Secondary Metabolites (TLC): None detected.
Specimen Examined: Dader, alt. 1,205 m, 10.11.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad 20 (HUP), Naran, alt. 2,541 m,
30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 410 (HUP),
Near Lalazar, 2,539 m, 11.09.2014, Asmat Ullah, Amir Khan Afridi and Syed
Juneed Shah 593 (HUP), Shogran, alt. 2,330 m, 26.07.2015, Asmat Ullah, Amir
Khan Afridi and Syed Juneed Shah 681 (HUP), On side of track to Saripaya,
alt. 2,723 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah
733 (HUP).
World Distribution: Asia (widespread), Europe, Africa (S. Africa,
Morocco, C. America (Mexico), N. America (Canada, USA), S. America
(widespread), Australasia (Australia).
205
2. Phaeophyscia endococcina (Körb.) Moberg, Symb. bot. upsal. 22(no.
1): 35 (1977)
Thallus Foliose, up to 3 cm diameter, orbicular irregular to irregular,
closely attached, lobeite; lobed separate 0.2-1.0 mm wide; upper surface
greyish brown to dark brown, not isidiate, smooth, eciliate; lower surface
black, rhizinate; rhizines black; apothecia abundant, 1.5 mm in diameter,
margin crenulate, under side with corona; ascospores Physcia-type, 17.5-25
x 8-11-(15) µm.
Habitat: On rock (saxicolous)
Spot Tests: K+ purple
Secondary Metabolites (TLC): Skyrine, zeorine
Specimen Examined: Kaghan, alt 2,341 m, 29.07.2014, Asmat Ullah,
Amir Khan Afridi and Syed Juneed Shah 388 (HUP), Manoor Valley on way to
Ansoo lake, alt. 2,654 m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-
ul-Islam 483 (HUP), Shogran, alt. 2,389 m, 27.07.2015, Asmat Ullah, Amir
Khan Afridi and Syed Juneed Shah 712 (HUP).
World Distribution: Asia, Europe, North America
3. Phaeophyscia orbicularis (Neck.) Moberg, Symb. bot. upsal. 22(no.
1): 44 (1977)
Thallus foliose, orbicular to irregular, up to 4 cm in diameter; lobes 0.5-1.0
mm broad, flat, not ascending, overlapping or separate, sorediate; soredia
laminal, powdery to finely granular; lower surface black, dull or rather
shiny; rhizines simple, black; apothecia abundant, sessile, up to 1.5 mm in
diameter, with a corona of rhizines; ascospores Physcia-type ellipsoid,
17.5-25.5 x 7.5-11 µm.
206
Habitat: On bark (corticolous)
Spot Tests: All negative
Secondary Metabolites (TLC): None detected.
Specimen Examined: Paras, alt. 1,376 m, 28.07.2014, Asmat Ullah, Amir
Khan and Syed Mushraf Shah 362 (HUP), on way to Jalkhad, alt. 2,628 m,
10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 510 (HUP).
World Distribution: Asia, Europe, Africa (Morocco, Algeria) C.
America (Mexico), S. America (Brazil, Paraguay), N. America (Canada,
USA), Australasia (wide spread), Pacific (New Caledonia)
Note: New to the study area.
Physcia (Schreb.) Michaux
Thallus foliose, loosely adnate, lobate; lobe discrete or over lapping, with
or without cilia; upper surface gray to blue gray, dull or shiny, sometime
maculate or with or without soredia or isidia; lower surface pale, rhizinate;
rhizines, simple or furcate; ascomata apothecial, laminal on lobes,
lecanorine, sessile or shortly stiptate; disc brown to black, sometimes
pruinose; epihymenium brown or orange brown; hymenium colourless;
paraphyses simple or forked; hypothecium colourless; asci Lecanora-type,
8-spored, cylindrical; ascospores brown, ellipsoid, 1-septate. Secondary
metabolites: atranorine zeorine. Substrate: on bark, wood and rocks.
This genus has 70 species which are distributed worldwide; previously 10
species are reported from Pakistan while the present study recorded three
species from District Mansehra.
207
Key to species
1a. Thallus sorediate………………………………………………...P. dubia
1b. Thallus esorediat…………………………………………………………2
2a. Upper thallus surface with white maculae………………........P. aipolia
2b. Upper thallus surface lacking white maculae……………………........3
3a. Lobes flat, up to 3 mm wide, K+ (Medulla)
3b. Lobes flat to slightly convex, up to 1.5mm wide, K-
(Medulla)……………………………….…………………….....P. stellaris
1. Physcia aipolia (Ehrh. ex Humb.) Fürnr., Naturhist. Topogr.
Regensburg 2: 249 (1839)
Thallus orbicular to irregular, to 4.5 cm diameter, lobate; lobes flat to
convex, slightly overlapping, ascending at tips, eciliate; upper surface
whitish gray to dark gray, white-maculate, without soredia or isidia; lower
surface white to pale, without cilia, rhizinate; rhizines simple, black;
apothecia abundant, up to 2 mm in diameter; disc black, white-pruinose;
epihymenium orange brown; hymenium colourless, 85 µm tall paraphyses
clavate, simple; hypothecium colourless, 70 µm tall; asci Lecanora-type,
cylindrical or clavate; ascospores brown, 1-septate, 20.5-25 x 9-12 µm,
Habitat: On tree trunks (corticolous)
Spot Tests: Cortex and Medulla K+ yellow, Pd+
yellow
Secondary Metabolites (TLC): Atranorine, Zeorine
Specimen Examined: Kaghan, alt. 2,089 m, 29.07.2014, Asmat Ullah,
Amir Khan Afridi and Syed Juneed Shah 392 (HUP), Naran, alt. 2,505 m,
208
30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 412 (HUP),
Lalazar, alt. 3,009 m, 11.09.2014, Asmat Ullah, Amir Khan Afridi and Syed
Juneed Shah 599 (HUP).
World Distribution: Asia, Europe, Africa, N. America (USA),
C. America (Mexico), S. America, Pacific (Guam), Australasia
2. Physcia dubia (Hoffm.) Lettau, Hedwigia 52: 254 (1912)
Thallus irregular, to 3 cm diameter, loosely adnate, lobate; lobes elongated,
narrow, separated, sometimes ascending, eciliate; upper surface whitish
gray to dark gray, without pruina and maculation, sorediate; soralia
marginal al lobes tips; lower surface pale, rhizinate; rhizines white to black;
apothecia uncommon, up to 2 mm in diameter, margin sorediate;
ascospores Physcia-type, brown, 1-septate.
Habitat On rocks (Saxicolous)
Spot Tests: Upper cortex K+ yellow, Pd+ yellow
Secondary Metabolites (TLC): Atranorine
Specimen Examined: Kaghan, alt. 2,270 m, 29.07.2014, Asmat Ullah,
Amir Khan and Syed Juneed Shah 399 (HUP), Shogran, alt 2,324 m,
26.07.2015, Asmat Ullah, Amir Khan and Syed Juneed Shah 688 (HUP).
World Distribution: Asia, Europe, Africa (Ethiopia, Morocco, Kenya,
S. America (Chile, Argentina), N. America (USA), C. America (Guatemala,
Mexico)
3. Physcia stellaris (L.) Nyl., Act. Soc. linn. Bordeaux 21: 307 (1856)
Thallus orbicular or irregular, up to 4.5 cm diameter, loosely adnate, lobate;
lobes radiating, narrow, up to 1 mm wide, eciliate; upper surface whitish
gray to dark gray, without pruina, not maculate, soredia and isidia absent;
209
lower surface white, rhizinate; rhizines white to black, simple; apothecia
present, sessile, concave, 1.5-2.0 mm in diameter; disc black; epihymenium
orange-brown; hymenium 60 µm high, colourless; paraphyses simple;
hypothecium 70 µm tall; asci Lecanora-type, cylindrical or narrow clavate;
ascospores 1-septate, brown, ellipsoid, 16-7.5 µm.
Habitat: On tree trunks and branches (corticolous)
Spot Tests: Medulla K-, Pd-, cortex K+ yellow, Pd+
Secondary Metabolites (TLC): Atranorine
Specimen Examined: Kaghan, alt. 2,278 m, 29.07.2014, Asmat Ullah,
Amir Khan Afridi and Syed Juneed Shah 391 (HUP), Shogran on way to
Saripaya, alt. 2,515 m, 27.07.2015, Asmat Ullah, Amir Khan and Syed Juneed
Shah 717 (HUP).
World Distribution: Asia, Europe, Africa, S. America, N. America
(Canada, USA), C. America, Caribbean (Bermuda, Bahamas) Australasia.
Physconia Poelt
Thallus foliose, loosely attached, lobate; lobes short to elongate, discrete or
slightly overlapping, mostly more than 3 mm wide; upper surface gray
brown or reddish brown; lower surface black to brown, moderately to
densely rhizinate; rhizenes black, squarrosely branched; ascomata
apothecia, laminal; disc brown, pruinose; epihymenium brown; hymenium
colourless; paraphyses simple or branched, apices clavate, with thin dark
brown cap; hypothecium colourless; asci 8-spored, clavate; ascospores
brown, 1-septate, 22-38 x 12-20 µm, Physconia-type. Secondary metabolites:
not detected. Substrate: bark, rock, wood, soil or mosses.
210
The genus represents a total of 25 species from world and six species from
Pakistan. The present study recorded single taxa from District Mansehra
(Plate 3.32).
1. Physconia muscigena (Ach.) Poelt, Nova Hedwigia 9: 30 (1965)
Thallus foliose, irregular, occasionally orbicular, loosely adnate; lobes
variable size, discrete to elongated, marginal lobes broad, inner lobes
narrow, ascending; upper surface brown to dark brown, pruinose, without
isidia or soredia; lower surface brown to black, dull to shiny, rhizinate;
rhizines black, squarrosely branched; apothecia up to 4.5 mm in diameter;
ascospores 22.5-31.5 x 11.5-17 µm.
Habitat: On mosses (Musicolous)
Spot Tests: All negative
Secondary Metabolites (TLC): None detected
Specimen Examined: Lalazar, alt. 2,913 m, 10.09.2014, Asmat Ullah,
Amir Khan Afridi and Syed Juneed Shah 560 (HUP).
World Distribution: Asia, Europe, N. America (Alaska) S. America (Chile,
Argentina), Africa (Tanzania, Kenya, Morocco, Ethiopia), Antarctica.
211
Fig. 4.24: Distribution of Physciaceae in District Mansehra: 1. Lulusar lake. 2. Lalazar, 3. Kaghan, 4. Manoor Valley, 5. Shogran, 6. Paras, 7. Sharan.
Plate 3.27: Amandinea punctate (scale= 1cm) in District Mansehra.
212
Plate 3.28: A. Anaptychia crinalis, B. Anaptychia runcinata (scale= 1 cm) in District Mansehra.
Plate 3.29: Buellia stellulata (scale= 0.5 cm) in District Mansehra.
213
Plate 3.30: A. Phaeophyscia ciliate, B. Phaeophyscia endococcina, C. Phaeophyscia orbicularis (scale= 0.5 cm) in District Mansehra.
214
Plate 3.31: Physconia muscigena (scale= 1 cm) in District Mansehra.
215
19. Psoraceae
Thallus squamulose to placodiod or crustose, ascospores colourless,
aseptat. Habitat soil and rocks.
Genera instudy area: The present study recorded single genus from
District Mansehra (Fig. 4.25).
Psora Hoffm.
Thallus squamulose, thick; prothallus absent; squamules 2-7 mm wide,
ascending or imbricate, rounded to elongate; upper surface yellow to red
brown, dull or shiny, white pruinose or not; lower surface white to brown;
ascomata apothecia, sessile, laminal or marginal, brown black, flat or
weakly convex, pruninose or not; epihymenium red brown or brown;
hypothecium brown or colourless; asci 8-spored, clavate; ascospores simple
colourless, ellipsoid, without thick perispore. Secondary metabolites: none
detected. Substrate: soil and rocks.
This genus has a total of 40 species from world and two species from
Pakistan. The present study recorded one species from District Mansehra
(Plate 3.33).
1. Psora decipiens (Hedw.) Hoffm., Descr. Adumb. Plant. Lich. 2(4): 68
(1794)
Thallus squamulose; squamules scattered to contiguous, up to 4.5 mm
wide, rounded, adnate; upper surface pink-red-brown, dull or shiny, white
pruinose, smooth or fissured; apothecia marginal, up to 2 mm diameter,
black, epruinose or white pruinose; ascospores 9.5-16.0 x 6.5-8 µm,
ellipsoid.
Habitat: On soil (tericolous)
Spot Tests: All negative
216
Secondary Metabolites (TLC): None detected
Specimen Examined: Lalazar, alt 3,089 m, 11.09.2014, Asmat Ullah,
Amir Khan Afridi and Syed Juneed Shah, 594 (HUMP).
World Distribution: Europe, Africa, Asia, Africa, N. America, S.
America (Argentina), C. America (Mexico), Australasia.
Fig. 4.25: Distribution of Psoraceae in District Mansehra; 1. Lalazar.
217
Plate 3.32: Psora decipiens (scale= 2 cm) in District Mansehra.
218
20. Ramalinaceae
Thallus fruticose, flattened; apothecia lateral and terminal, lecanorine;
spores colourless, 2-celled. Habitat rocks and trees. Distribution: temperate
to tropical.
Genera in study area: The present study recorded three genera from
District Mansehra (Fig. 4.26).
Key to genera
1a. Thallus Crustose………………………….................................................2
1b. Thallus Fruticose, erect to pendent attached by holdfast, branches
solid or fistulose…… ………………………………...…………Ramalina
2a. Upper surface smooth to nodulose or papillate, lower surface
present in Squamulose species, attachment organs
absent…............................................................................................ Lecania
2b. Upper surface smooth, cracked, warted, lower surface
absent……………………………………………………..…………Bacidia
Bacidia De Not., Giorn. Bot. Ital. 2: 189 (1846).
Thallus: crustose or occasionally granular, areolate, rimose; prothallus
often absent, usually thin when present; upper surface pale green, pale
gray or green gray, smooth, cracked, warted, without isidia or soredia;
ascomata apothecia, flat to convex, variously coloured with white pruina,
upto 2 mm wide; epihymenium containing pigment and occasionally with
crystals; hymenium colourless, 60-125 µm tall; paraphyses straight, simple
or rarely branched, apical cell often swollen; asci:8-spored, clavate to
cylindrical-clavate, Bacidia-type; ascospores hyaline, 3 or many septate,
oblong, baciliform, fusiform, without a distinct epispore. Secondary
219
metabolites: atranorine. Substrate: mostly on bark but some species are
found on soil and rocks
A total of 250 species of the genus are distributed worldwide and
previously four are reported from Pakistan. The present study recorded
three species from District Mansehra (Plate 3.35).
Key to species
1a. Apothecia black or dark lavender brown……………………………...2
1b. Apothecia yellow orange, brown orange or whitish to pink……...…3
2a. Thallus smooth, apothecia black, lichen substance
absent……………………………………...……………….…B. laurocerasi
2b. Thallus granulose-verrucose, apothecia lavender brown, lichen
substance atranorin present…………………………………..Bacidia sp.
3a. Apothecia whitish, pink or pink-yellow, ascospores up to 15-
septate……………………………………………………………..B. rosella
3b. Apothecia yellow brown to orange brown, ascospores up to 9-
sepate…………………………………………………….……….B. rubella
1. Bacidia laurocerasi (Delise ex Duby) Zahlbr., Cat. Lich. Univers. 4:
213 (1926) [1927]
Thallus thin, smooth, cracked or warted; upper surface pale gray or
greenish gray; ascomata usually numerous, 0.5-1.0 mm in diameter, flat to
convex and immarginate; disc pink brown; epihymenium pale gray brown
to dark brown; hymenium colourless, 60-85 µm tall; hypothecium
colourless; paraphysis simple or branched, apices swollen and pigmented;
ascospores 7-septate, acicular, 30-70 x 2-3.5 µm.
220
Habitat: On bark (Corticolous)
Spot Tests: All negative
Secondary Metabolites (TLC): None detected
Specimen Examined: Dader, alt. 1,295 m, 10.10.2013, Asmat Ullah,
Amir Afridi and Syed Muhammad 13 (HUP), Shogran, alt. 2,318 m,
26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 673 (HUP).
World Distribution: Asia, Africa (S. Africa, Morocco, Algeria),
Europe, Russia, N. America (USA, Canada), Caribbean (Bahamas),
C. America (Mexico), S. America (Colombia, Brazil), Australasia (Australia,
NewZealand)
Note: New to the study area.
2. Bacidia rubella (Hoffm.) A. Massal., Ric. auton. lich. crost. (Verona):
118, fig. 231 (1852)
Thallus thin to richly granular isidiate; granules 65-115 µm in diameter;
upper surface gray to yellow-green; ascomata apothecia, flat to slightly
convex, sessile, 0.5-1.2 mm in diameter; disc pale to dark red brown,
pruinose; epihymenium hyaline; hymenium hyaline or orange red or
yellow in upper part, 75-100 µm tall; paraphyses simple or forked above,
apically slightly swollen; asci lecanoran type; ascospores hyaline, 3-9
septate, 45-75 x 3-4 µm.
Habitat: On bark (Corticolous)
Spot Tests: All negative
Secondary Metabolites (TLC): None detected
Specimens Examined: On tthe side of Siran River Dader, alt. 1,240 m,
08.11.2013, Asmat, Amir Khan Afridi and Syed Muhammad 77 (HUP), Kathai
Oghi, alt. 1,204 m, 15.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleem
221
Shah 258 (HUP), Paras, alt. 1,639 m, 28.07.14, Asmat Ullah, Amir Khan Afridi
and Syed Mushraf Shah 361 (HUP), On the side track to saripaya, alt. 2,548
m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 708
(HUP).
World Distribution: Asia (Japan, Turkey, Russia), Africa (N. Africa),
Europe, C. America (Mexico). N. America.
3. Bacidia rosella (Pers.) De Not., G. bot. ital. 2(1.1): 190 (1846)
Thallus crustose; upper surface green gray, continuous or cracked;
apothecia 0.25-.8 mm in diameter, sessile, slightly white pruinose, flat to
convex; disc pale orange; epihymenium pale brown to brown; hymenium
colourless, 110 µm tall; hypothecium colourless; paraphysis simple; asci
Bacidia-type, cylindrical, 80-95 x 10-12 µm; ascospores colourless, 9-15
sepate.
Habitat: On bark (Corticolous)
Spot Tests: All negative
Secondary Metabolites (TLC): None detected
Specimens Examined: On the side of road from Dader to Shinkari, alt.
1,287 m, 11.10.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 22
(HUP), Mundaghucha, alt. 1,878 m, 14.11.2013, Asmat Ullah and Mazhar-ul-
Islam 143 (HUP), Oghi top, alt. 1,482 m, 15.4.2014, Asmat Ullah, Amir Khan
Afridi and Kaleem Shah 259 (HUP), Balakot, alt. 1,154 m, 26.04.2014, Asmat
Ullah, Amir Khan Afridi and Syed Mushraf Shah 296 (HUP), Shogran, alt.
2,424 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 674
(HUP).
World Distribution: Asia (Turkey, Japan, Russia), N. Africa (Morocco).
Note: New to the study area.
222
Lecania A. Massal. Alc.
Thallus crustose, continuous or scattered granules, warted or areolate,
papillate or somewhat lobed; prothallus present or absent; upper surface
gray white to brown-black, smooth to nodulose or papillate, sometimes
pruinose; lower surface present in squamulose, specialized attachment
organs are absent; ascomata apothecial, 0.2- 2.0 mm in diameter, sessile;
disc pale to black-brown, flat to convex, occasionally weakly or densely
pruinose; epihymenium colourless to pale to dark reddish brown,
occasionally containing crystal of calcium oxalate; hymenium colourless,
35-95 µm tall; paraphyses simple, thick, apical cell swollen, containing dark
pigment cap; hypothecium colourless or pale yellow; asci Bacidia-type,
clavate, 8(-16) spored; ascospores colourless, 1-3-septate, oval to elongate-
ellipsoid, thin walled, without thickened perispore. Secondary metabolites:
atranorine and sometime unidentified terpens are present. Substrate: on
soil, rocks bark, sometimes on wood.
A total of 40 species are reported from world and previously two species
from Pakistan. The present study recorded two species from District
Mansehra.
Key to species
1a. Spores 3-septate ……………………………………………………….....2
1b. Spores non-septate………………………………………………………..3
2a. Thallus powdery, indistinct-spores …………………………Lecania sp.
2b. Thallus smooth, thin……………………………………………L. naeglii
3a. Mature ascospores curved……………………………….….Lecania sp.
3b. Mature ascospores, not curved………………………………..L. cyrtella
223
1. Lecania cyrtella (Ach.) Th. Fr., Lich. Scand. (Upsaliae) 1(1): 294
(1871)
Thallus crustose, inconspicuous, effuse or immersed; prothallus present,
white; surface white to pale gray, rather smooth to wrinkled and
roughened; apothecia 0.3-0.5 mm in diameter, very numerous, scattered to
crowded, emergent to sessile; disc pale pink to red-brown, flat to markedly
convex, epruinose; epihymenium brown, usually with fine pigment
granules; hymenium colourless, 30-50 µm tall; paraphyses simple, or
ocassionaly branched; hypothecium colourless, 25-65 µm thick; asci 8-
spored, clavate, 28-40 x 9.5-11.5 µm; ascospores colourless, narrowly
ellipsoid, bent when muture, 9.5-14 x 3.5-5 µm.
Habitat: On bark (corticolous)
Spot Tests: All negative,
Secondary Metabolites (TLC): None detected,
Specimen Examined: Above paras, alt. 1,792 m, 08.05.2015, Asmat
Ullah, Amir Khan Afridi and Syed Mushraf Shah 653 (HUP), on way to
Saripaya, alt. 2,884 m, 26.07.2015, Asmat Ullah, Amir Khan Afridi and Syed
Juneed Shah 742 (HUP).
World Distribution: Asia, Africa (S. Africa, Morocco, Algeria),
Europe, British Isles, N. America (USA, Canada), S. America (Argentina),
Australasia (New Zealand, Australia).
2. Lecania naegelii (Hepp) Diederich & van den Boom, in Boom,
Brand, Diederich, Aptroot & Sérusiaux, Bull. Soc. Nat. luxemb. 95:
154 (1994)
Thallus crustose, thin, inconspicuous; upper surface white to grey, thin;
apothecia sessile, dispersed, flat to convex, 0.15-0.6 mm in diameter; disc
224
black, not pruinose; epihymenium green gray, hyaline or with pale gray-
brown to blue green granules; hymenium pale yellow brown, 50-60 µm tall;
hypothecium pale yellow brown, 190 µm tall; paraphyses simple or forked,
apices swollen, apical cell pigmented; asci biatora type, 8-spored;
ascospores colourless, straight, narrowly ellipsoid, oblong to fusiform, 13.5
-24.5 x 3.5-5.0 µm.
Habitat: Bark (corticolous)
Spot Tests: Thallus K-, C-, P-,
Secondary Metabolites (TLC): None detected,
Specimen Examined: Above paras, alt. 1,994 m, 08.05.2015, Asmat
Ullah, Amir Khan Afridi and Syed Juneed Shah 746 (HUP).
World Distribution: Asia, Europe, British Isles, North America
(Canada, USA), Africa (Tunisia, Morocco), Australasia (New Zealand)
Ramalina Ach.
Thallus fruticose, often , erect to pendent, attached by holdfast; branches
solid or fistulose, flattened or sometimes terete; surface yellowish or
grayish green, smooth or angular, occasionaly become striately ridged;
pseudocyphellae present or absent, ellipsoid, short linear, or striate, often
sorediate but lacking isidia; asomata apothecia, substipitate to stipitate;
disc pale green, brown, concave to plane, sometimes white pruinose;
epihymenium colourless; hymenium in upper part colourless, below
yellow brown; hypothecium pale brown; paraphyses simple; asci 8-spored,
elongate-clavate, Bacidia-type; ascospores colourless, fusiform or broadly
ellipsoid, 1-septate. Secondary metabolites: usnic acid, depsides,
depsidones, aliphatic acid, atranorin. Substrate: on bark, wood, soil and
rock.
225
A total of 200 species of the genus are reported from world and four
species from Pakistan while the present study recorded one species from
District Mansehra (Plat 3.34).
1. Ramalina sinensis Jatta, G. bot. ital., n.s. 9: 462 (1902)
Thallus fruticose, often erect, up to 6.5cm long, attached at basal holdfast;
branching palmate or fan-shaped, growing from narrow holdfast; branches
up to 22mm wide, solid, flattened; upper surface yellowish green, uneven,
wrinkled, lacking isidia, soredia and pseudocyphellae; lower surface pale;
apothecia up to 9.5mm in diameter, laminal or subterminal; disc flat to
convex; asci 8-spored, elongate-clavate; ascospores colourless, ellipsoid,1-
septate, 11.5-15.5 x 6-7µm.
Habitat: On bark (Corticolous)
Spot tests: Cortex KC+ yellow, Pd-.
Secondary Metabolites (TLC): Usnic acid, atranorin.
Specimen Examined: Naran, alt. 2,632 m, 29.07.2014, Asmat Ullah,
Amir Khan and Syed Juneed Shah 393 (HUP), Manoor Valley forest house,
alt. 2,519 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam, 468
(HUP), Lalazar, alt. 3,018 m, 10.09.2014, Asmat Ullah, Amir Khan Afridi and
Syed Juneed Shah 554 (HUP), Shogran, alt. 2,318 m, 26.07.2015, Asmat Ullah,
Amir Khan Afridi and Syed Juneed Shah 683 (HUP), on way to Saripaya, alt.
2,604 m, 27.07.2015, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 722
(HUP).
World Distribution: Asia, Europe, N. America (USA, Canada), C.
America (Mexico), Africa (N. Africa).
Note: New to the study area.
226
Fig. 4.26: Distribution of Ramalinaceae in District Mansehra; 1. Lalzar, 2. Naran,3. Manoor Valley, 4. Sharan , 5. on way to Saripaya.
Plate 3.33: Ramalina sinensis (sacle= 2 cm) in District Mansehra.
227
Plate 3.34: A. Bacidia laurocerasi, B. Bacidia rosella, C. Bacidia rosella (scale= 2 cm) in District Mansehra.
228
21. Rhizocarpaceae
Thallus crustose; prothallus present; ascomata immersed in thallus or
lecideine; ascospores usually brown septate to muriform. Substrat: rocks.
Genera in study area: The present study recorded single genus from
District Mansehra (Fig. 4.27).
Rhizocarpon DC.
Thallus crustose, orbicular or spreading, areolate, cracked, verrucose, or
slightly effigurate at margin; prothallus usually present, black or white to
brown gray; upper surface green brown or white, rarely isidiate or
sorediate; ascomata apothecia, black, round to angular, concave to strongly
convex; epihymenium brown, green; hymenium colourless, near
epihymeniun greenish to red brown; paraphyses conglutinate, richly
branched and anastomosed, apical cell slightly to distinctly thickened;
hypothecium brown, 30-55 µm tall, lacking crystals; asci clavate to
cylindrical, 1-8 spored; ascospores pale to dark brown, ellipsoid, 1-septate
to muriform. Secondary metabolites: rhizocarpic acid, depsides,
depsidones. Substrate: on rocks.
Previously, 200 species of the genus are reported from globe and four
species from Pakistan. The present study recorded three species from
District Mansehra (Plate 3.36).
Key to species
1a. Epithecium granular, brown black, medulla I+ blue……R. viridiarum
1b. Epitheciun not granular, green brown or red brown…………………2
2a. Medulla K+ yellow, Pd + orange………………………..R. lecanorinum
2b. Medulla K-, Pd-…………………………………...……..R. geographicum
229
1. Rhizocarpon geographicum (L.) DC., in Lamarck & de Candolle, Fl.
franç., Edn 3 (Paris) 2: 365 (1805)
Thallus crustose, areolate, up to 9 cm in diameter; prothallus black; areoles
up to 1.3 mm in diameter, rounded to angular or irregular or crescent
shape, plane to strongly convex; upper surface green , smooth, epruinose;
apothecia up to 1 mm in diameter, round or angular; disc plan or weakly
convex, black, epruinose; epihymenium red brown or brown to olive-
green; hymenium colourless or more rarely green, 100-175 µm tall;
hypothecium dark brown; asci 8-spored, clavate; ascospores dark brown,
ellipsoid, muriform, 20.5-34.5 x 10-20 µm.
Habitat: On rocks (Saxicolous)
Spot Tests: Medulla K-, C-, or rarely C+ red, P+
yellow.
Secondary metabolites (TLC): Rhizocarpic acid, psoromic acids
Specimen Examined: Naran, alt. 3,141 m, 29.07.2014, Asmat Ullah,
Syed Juneed Shah and Amir Khan Afridi 394 (HUP), Lake Saif -ul- Maluk, alt.
3,369 m, 30.07.2014, Asmat Ullah, Syed Juneed Shah and Amir Khan Afridi 423
(HUP), Manoor Valley, alt. 3,101 m, 04.08.2014, Asmat, Mazhar-ul-Islam
Ashfaq Ahmad, 494 (HUP), Jalkhad, alt. 3,292 m, 10.08.2014, Asmat, Mazhar-
ul-Islam and Ashfaq Ahmad 512 (HUP).
World Distribution: Asia, Europe, N. America, S, America, C.
America, Africa (N. Africa, S. Africa), Australasia, Pacific (Hawaii),
Antarcatica.
Note: New to the study area
2. Rhizocarpon lecanorinum Anders, Hedwigia 64: 261 (1923)
230
Thallus crustose, areolate; prothallus black; areoles up to 1-2 mm in
diameter, contiguous to somewhat dispersed, matt, smooth, initially
rounded, crescent-shaped; upper surface bright yellow to green yellow;
apothecia to 1 mm in diameter; disc black, flat to convex, round, epruinose;
epihymenium pale green-brown; hymenium colourless; hypothecium
brown-black, thin; ascospores brown, muriform, 32.550 x 13.5-22.5 µm.
Habitat: On rocks (Saxicolous)
Spot Tests: K+ yellow, P+ orange.
Secondary Metabolites (TLC): Rhizocarpic acid
Specimen Examined: Lake saif-ul-Maluk, alt. 3,200 m, 30.07.2014,
Asmat Ullah, Amir Khan and Syed Juneed Shah Afridi 435 (HUP), Jalkhad, alt.
3,159 m, 11.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 528
(HUP).
World Distribution: Asia, Europe, N. America (Alaska), S. America,
Africa (S. Africa), Australasia
Note: A new record to Pakistan.
3. Rhizocarpon viridiatrum (Wulfen) Körb., Syst. lich. germ. (Breslau):
262 (1855)
Thallus crustose, 0.4-1.5 cm in diameter, areolate; areoles up to 0.5 mm in
diameter, convex to palne, round to angular; surface greyish-green to
green, smooth, epruinose; apothecia up to 0.7 mm in diameter, round or
irregularly angular; disc black, convex, epruinose; epihymenium brown;
hymenium colourless, 80-135 µm tall; hypothecium dark brown; asci 8-
spored, clavate; ascospores muriform, ellipsoid, 11.5-24.5 x 7-12.5 µm.
231
Habitat: On rocks (Saxicolous)
Spot Tests: Medulla K+ yellow, Pd+ orange.
Secondary Metabolites (TLC): Rhizocarpic acids
Specimen Examined: Lake Saif-ul-Maluk, alt 2,740 m, 30.07.2014,
Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 434 (HUP).
World Distribution: Asia, Europe, N. America (Arizona, California),
S. America (Colombia, Bolivia, Chile) Africa (Kenya, Natal, Morocco)
Australasia (New Zealand).
Note: New to the study area.
Fig. 4.27: Distribution of Rhizocarpaceae in District Mansehra: 1. Jalkhad, 2. Naran, 3. lake Saif -ul- Maluk, 4. Manoor Valley.
232
Plate 3.35: A. Rhizocarpon geographicum (scale= 2 cm), B. Rhizocarpon lecanorinum (scale= 0.5 cm), C. Rhizocarpon viridiatrum (scale= 2 cm) in District Mansehra.
233
22. Stereocaulaceae
Thallus fruticose; ascospores colourless, several septate to muriform.
Habitat: soil and rocks. Distribution: arctic to tropical.
Genera in study area: The present study recorded single genus from
District Mansehra (Fig. 4.28)
Lepraria Ach.
Thallus crustose, leprose, attached by whole under surface or partly free
from substratum, unstratified and then completely composed of soredia,
stratified or compact, forming irregular or rosettes spreading; prothallus
absent; upper surface gray, blue green, white or yellow, usually leprose;
soredia rounded, farinose to coarse, often pruinose due to presence of
crystals; ascomata absent. Secondary metabolites: Atranorine, constictic
acid, stictic acid, zeorine. Substrate: on rocks, bark and soil.
Previously, 40 species of the above genus are reported from globe while
two species are reported from Pakistan. The present study recorded one
specie from District Mansehra (Plate 3.37).
1. Lepraria elobata Tønsberg, Sommerfeltia 14: 197 (1992)
Thallus crustose, leprose, thin or sometimes thick, irregular, up to 0.5 mm
thick, firmly fastened to substrate; upper surface pale blue gray to dull blue
gray, isidia absent, soredia present; soredia 15-40 µm in diameter, loosely
to strongly packed, mostly farinose, sometimes coarse and up to 0.1 mm
wide; lower surface absent; ascomata: absent.
Habitat: On bark and wood (Corticolous)
Spot Test: K- or K+ yellow, Pd+ orange,
Secondary Metabolites (TLC): Atranorine, constictic acid, stictic acid,
zeorine.
234
Specimen Examined: Mandgucha, alt. 1,808 m, 14.11.2014, Asmat
Ullah and Mazhar-ul-Islam 150 (HUP), Shogran, alt. 2,423 m, 27.07.2015,
Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 700 (HUP).
World Distribution: Europe, N. America, C. America.
Note: A new record to Pakistan.
Fig. 4.28: Distribution of Stereocaulaceae in District Mansehra; 1. Shogran, 2. Mandagucha.
Plate 3.36: Lepraria elobata (scale= 2 cm) in District Mansehra.
235
23. Teloschistaceae
Thallus crustose, foliose or fruticose; apothecia lecanorine or lecidine; disc
usually orange; spores colourless, polarilocular. Habitat: rocks, trees and
humus. Distribution: temperate and tropical.
Genera in study area: The present study recorded three genera from
District Mansehra (Fig. 4.29).
Key to genera
1a. Thallus Crustose, Squamulose to placodioid, apothecia lecanorine or
lecideine, disc pruinose or epruinose……………………….…Caloplaca
1b. Thallus foliose …………………………………………………………..2
2a. Lower surface grayish white, epihymenium pale
orange……………………………………………………..Xanthomendoza
2b. Lower surface white to pale brown, corticated, epihymenium
golden, orange…………………………………………………Xanthoria
Caloplaca Th. Fr.,
Thallus crustose, squamulose-placodioid, verrucose or granular
furfuraceous, effigurate or lobed; prothallus orange, white, black or not
visible; upper surface yellow, yellowish orange, gray, or brown red,
smooth or verruculose, isidia, soralia, blastidia or lobules absent or present;
ascomata apothecia, lecanorine or lecideine, immersed, adnate or stipitate;
disc orange, yellow to red , gray, brown or black, convex or concave, flat,
epruinose or pruinose; hymenium hyaline; epihymenium brown, gray or
golden; paraphyses simple or branched, apical cell enlarge; asci clavate, 8-
spored; ascospores hyaline, ellipsoid, with 2 locules or rarely 4 locules.
Secondary metabolites: Teloschistin, emodin, parietin. Substrate: on rock,
trees, rarely on soil and wood.
236
There are a total of 800 species of the genus distributed worldwide.
Previously 62 species are reported from Pakistan while the present study
recorded three species from District Mansehra (Plate 3.38).
Key to species
1a. K+ purple, thallus and or soredia yellow to orange………………….2
1b. K-, soredia and thallus white, grey or green..………………. ……….3
2a. Soralia marginal, lobes 0.5-1.00 mm wide…………….……C. decipiens
2b. Soralia laminal, lobes 0.2-0.5 mm wide………….…..……C. cirrochora
3a. Thallus placodioid or lobate, effigurate, coarsely
sorediate……………………………………………….……....C. teicholyta
3b. Thallus crustose, soredia discrete………………………….Caloplaca sp.
1. Caloplaca cirrochroa (Ach.) Th. Fr., Lich. Scand. (Upsaliae) 1(1): 171
(1871)
Thallus placodioid, 5.5 cm across, closely appressed, lobeate, scattered or
contiguous thalli; lobes rounded, elongated, shallowly convex, contiguous,
separated by parallel-aligned furrow; upper surface dirty or brown orange,
soralia present, laminal, small, scattered, flat, rounded, to 0.7 mm in
diameter, soredia lemon yellow, farinose; apothecia absent.
Habitat: On rocks (Saxicolous)
Spot Tests: K+ purple all part
Secondary Metabolites (TLC): Parietin
Specimen Examined: Dader, alt. 1,343 m, 08.11.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad 85 (HUP).
237
World Distribution: Asia, Europe, Africa (Egypt). N. America, S.
America (Brazil, Argentina), Australasia (Australia).
Note: New to the study area.
2. Caloplaca decipiens (Arnold) Blomb. & Forssell, Cat. Lich. Univers.
7: 226 (1931)
Thallus crustose, 2.5 cm across, lobate; lobes elongate, appressed;
prothallus absent; upper surface yellow to orange yellow, pruinose, soralia
usually present, soredia granular, concolorous with thallus; apothecia rare,
lecanorine, adnate, 0.5-1 mm in diameter; disc flat, orange, epruinose;
epihymenium golden, K+ red, C-; hymenium hyaline, 60-80 µm tall;
paraphyses simple, apical cell 2-5 µm wide; asci 8-spored, cylindrical;
ascospores hyaline, 11-14 x 6-8 µm in diameter, ellipsoid, 2 locules.
Habitat: On rocks (Saxicolous)
Spot Tests: Thallus K+ red, C-, apothecia K+ red, C-
Secondary Metabolites (TLC): Teloschistin, parietin, emodin
Specimen Examined: Manoor Valley on way to Ansoo lake, alt. 3,553
m, 04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 498 (HUP),
Jalkhad, alt. 3,200 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-
Islam 530 (HUP).
World Distribution: Asia, Europe, Africa (Morocco, Algeria, Tunisia)
N. America (USA), C. America, Australasia (New Zealand).
Note: New to the study area.
3. Caloplaca teicholyta (Ach.) J. Steiner, Sber. Akad. Wiss. Wien,
Math.-naturw. Kl., Abt. 1 104: 388 (1895)
238
Thallus crustose, slightly placodioid with rounded lobe tips thin to thick,
closely appressed lobes; lobe end poorly differentiated, flat or convex,
rounded; upper surface white to bluish gray, sorediate at center; soredia
white, granular; apothecia uncommon, 0.7 mm in diameter, scattered or
sometimes crowded, immersed, deeply concave at first, becoming flat,
sometime thalline margin also present; disc orange to red brown,
occasionally white pruinose; paraphyses branched, slender, flexuose,
apically not swollen; ascospores ellipsoid, 14.5-17.5 x 7.5-10 µm.
Habitat: On rocks (Saxicolous)
Spot Tests: Apothecia K + purple red, thallus K-
Secondary Metabolites (TLC): Teloschistin
Specimen Examined: Lalazar, 2,855 m, 11.09.2014, Asmat Ullah, Amir
Khan Afridi and Syed Juneed Shah 595 (HUP).
World Distribution: Asia, Europe (Scotland, Ireland), Africa
(Morocco, Algeria, Tunisia, Egypt), North America, S. America (Mexico).
Note: New to the study area.
Xanthomendoza S. Kondratyuk & Karnefelt, Biblioth. Lichenol. 68: 26
(1997).
Thallus foliose to umbilicate, loosely attached, lobate; lobes erect or semi-
erect, discrete, elongate, eciliate; upper surface pale yellow to reddish
orange, smooth to somewhat wrinkled, with or without sorediate, lacking
pseudocyphellae; lower surface grayish white, rhizinate; rhizines simple;
ascomata apothecia, sessile to stipitate, laminal; disc darker orange than the
thallus; epihymenium pale orange; hymenium colourless below but light
orange above; hypothecium colourless; paraphyses simple or branched;
asci 8-spored, clavate to broadly clavate, Teloschistes-type; ascospores
239
colourless, ellipsoid to oblong, polarilocular, 10-20 x 5-8 µm. Secondary
metabolites: Parietin, fallacinal, teloschistin and parietinic acid. Substrate:
on bark, rock, rarely on soil.
This genus has a total of 20 species from the world. The present study
recorded two species from District Mansehra.
Key to species
1a. Thallus rosette like, rhizines present, abundant……………...X. fallax
1b. Thallus cushion like, rhizines absent or sparse………………………2
2a. Soredia powdery, lobe narrow………………………….………X. fulva
2b. Soredia granular, lobe broad………………….…….Xanthomendoza sp.
1. Xanthomendoza fallax Søchting, Kärnefelt & S.Y. Kondr., Mitt. Inst.
Allg. Bot. Hamburg 30-32: 237 (2002)
Thallus foliose, up to 2.5 cm wide, adnate to loosely adnate, rosette, lobate;
lobes flattened to convex, dorsiventral; tips truncate to rotund; upper
surface yellow to orange, smooth, sorediate; soredia powdery; lower
surface white to yellow; apothecia rare, up to 2.0 mm in diameter, laminal;
disc orange; epihymenium brown; hymenium colourless below, 55-100 µm
tall; paraphyses simple or branched, septate; hypothecium colourless to
pale brown; asci: , 8-spored, clavate; ascospores colourless, ellipsoid,
polarilocular, 11.0-15.0 x 5.5-9 µm.
Habitat: On bark (Corticolous)
Spot Tests: K+ purple, C-, KC-, Pd-.
Secondary Metabolites (TLC): Parietin, fallacinal, teloschistin, parietinic
acid.
240
Specimen Examined: Kaghan, alt. 2,296 m, 29. 07.2014, Asmat Ullah,
Amir Khan and Syed Juneed Shah 398 (HUP), Manoor Valley Behari village,
alt. 2,498 m, 03.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 459
(HUP).
World Distribution: Asia, Europe, N. America.
2. Xanthomendoza fulva (Hoffm.) Søchting, Kärnefelt & S.Y. Kondr.,
Mitt. Inst. Allg. Bot. Hamburg 30-32: 237 (2002)
Thallus foliose, adnate to loosely adnate, lobate; lobes up to 0.2-0.5 mm
wide, flattened to slightly convex, dorsiventral; tips truncate; upper surface
orange to dark orange, smooth, sorediate; soredia powdery; lower surface
white to yellow, smooth, rarely rhizinate; rhizenes white, short; apothecia
rare, up to 3.5 mm in diameter, laminal, stipitate; disc orange;
epihymenium brown; hymenium colourless below, 55-100 µm tall;
paraphyses simple to branched, septate; hypothecium colourless to pale
brown; asci 8-spored, clavate; ascospores colourless, ellipsoid,
polarilocular, 10.5-20 x 5.5-9 µm.
Habitat: On bark (Corticolous)
Spot Tests: Upper surface K+ purple, C-, KC-, Pd-
Secondary Metabolites (TLC): Parietin, fallacinal, teloschistin, parietinic
acid
Specimen Examined: Naran, alt. 2,622 m, 30.07.2014, Asmat Ullah,
Amir Khan Afridi and Syed Juneed Shah 408 (HUP), Shogran, alt. 2,442 m,
27.07.2015, Asmat Ullah, Amir Khan and Syed Juneed Shah 732 (HUP).
World Distribution: Asia Europe N. America
241
Xanthoria (Fr) Th. Fr.,
Thallus foliose, loosely to closely attacheddorsiventral, orbicular, rosette
spreading, lobate; lobes flat, to convex or concave, elongate; tips ascending
to erect; upper surface bright yellow orange or orange red, corticate,
smooth or wrinkled; lower surface white to pale brown, corticate, rhizinate;
rhizines pale, simple; ascomata apothecia, sessile to subpedicellate; disc
yellow, orange or orange red, plane or concave, epruinose; epihymenium
golden, orange; hymenium 50-60 µm; hypothecium colourless; paraphyses
apical cell swollen; asci 8-spored, clavate; ascospores colourless, ellipsoid,
polarilocular. Secondary metabolites: Anthraquinones paritin, teloscistin,
fallacinal, emodin. Substrate: on bark or rock.
The genus represented a total of 50 species from world and four species
fom Pakistan. The present study recorded two species from District
Mansehra.
Key to species:
1a. Thallus isidiate or sometimes sorediate.................................X. sorediata
1b. Thallus lacking isidia and soredia...........................................................2
2a. Thallus orange to dark yellow, corticolous, lobes plane or
convex.........................................................................................X. parietina
2b. Thallus orange red to red brown, saxicolous, lobes
convex………………………………………………………..Xanthoria sp.
1. Xanthoria parietina (L.) Th. Fr., Lich. Arctoi 3: 69 (1860)
Thallus foliose, rosettes, to 8 cm wide, lobate; lobes flat, rounded,
dorsiventral; upper surface orange, yellow or orange yellow, smooth, not
sorediate; lower surface near margin pale yellow, in center white,
wrinkled, attached with white hapters; apothecia abundant, concave to flat,
242
slightly stalked, 0.5-2.0 mm in diameter; disc orange; epihymenium orange;
hymenium colourless 65 µm tall; hypothecium colourless paraphyses
simple, slightly moniliform; asci 8-spored, clvate, Teloscistes-type;
ascospores colourless, ellipsoid, polarilocular, 11.5-12.5 x 7-8 µm.
Habitat: On twigs (Corticolous)
Spot Test: Thallus K+ purpel
Secondary Metabolites (TLC): Paritin, teloscistin, fallacinal, emodin
Specimen Examened: Manoor Valley on way to Ansoo Lake, alt. 2,786
m, 04.08. 2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 499 (HUP),
Lalazar, alt. 3,031 m, 11.09.4014, Asmat Ullah, Amir Khan and Syed Juneed
Shah 600 (HUP), Shogran, alt. 2,325 m, 26.07.2015, Asmat Ullah, Amir Khan
and Syed Juneed Shah 691 (HUP), Saripaya, alt. 2,900 m, 27.07.2015, Asmat
Ullah, Amir Khan and Syed Juneed Shah 745 (HUP).
World Distribution: Asia, Europe, Africa, N. America.
Note: A new record to Pakistan.
2. Xanthoria sorediata (Vain.) Poelt, Mitt. bot. St. Samml., Münch. 11:
29 (1954)
Thallus foliose, to 3.5 cm wide, tightly adnate, rosettes or small colonies,
tightly lobate; lobes flattened to convex, dorsiventral, rotund to
truncate; upper surface yellow to orange, sorediate; soredia granular; lower
surface smooth or somewhat wrinkled, white, short, white hapters;
apothecia rare, up to 2 mm in diameter, laminal; epihymenium brown;
hymenium 60-90 µm tall, colourless below; hypothecium colourless to pale
brown; paraphyses simple; asci 8-spored, clavate; ascospores colourless,
ellipsoid, polarilocular, 10.5-12 x 6.5-9 µm.
243
Habitat: On rock (Saxicolous)
Spot Tests: Upper surface K+ purple, C-, KC-, Pd-
Secondary Metabolites (TLC): Parietin, fallacinal, emodin, teloschistin
Specimen Examined: Jalkhad, alt. 3,179 m, 10.08.2014, Asmat Ullah,
Ashfaq Ahmad and Mazhar-ul-Islam 514 (HUP), Barwai, alt. 2,979 m,
15.09.2014, Asmat Ullah, Amir Khan and Syed Juneed Shah 609 (HUP).
World Distribution: Asia, Europe, N. America, C. America (Mexico),
N. Africa (Morocco).
Note: New to the study area.
Fig. 4.29: Distribution of Teloschistaceae in District Mansehra; 1. Lulusar lake, 2. Lalazar, 3. Kaghan, 4. near forest rest house Manoor Valley, 5. Shogran, 6. Paras, 7. Sharan.
244
Plat 3.37: A. Caloplaca cirrochroa, B. Caloplaca decipiens, C. Caloplaca teicholyta (scale= 0.5 cm) in District Mansehra.
245
24. Thelotremataceae
Thallus crustose; apothecia immersed (more or less); spores colourless or
brown, septate to muriform. Habitat: Trees, soil, rocks. Distribution:
temperate to tropical.
Genera in study area: The present study recorded single genus from
District Mansehra (Fig. 4.30).
Diploschistes Norman, Nyt. Mag. Naturvid. 7: 232 (1853).
Thallus crustose, continous to cracked-areolate; upper surface gray-white,
smooth to verrucose, often pruinose; ascomata apothecia, laminal,
immersed; disc black, occasionally pruinose; exciple brown to dark brown;
epihymenium colourless to black; hymenium colourless; hypothecium
colourless to brown or black; asci elongate-clavate to subcylindrical, 1-8
spored; ascospores brown to dark brown or purple-black, broadly
ellipsoid, smooth, muriform, lacking a distinct perispore or gelatinous
sheath. Secondary metabolites: para-depsides (eg lecanoric, diploschistesic
acid), Orsellinic acid. Substrate: on soil, rock, lichens or mosses.
This genus has a total of 35 species from the world and four species are
reported from Pakistan. The present study recorded three species as new to
District Mansehra (Plate 3.39).
Key to species:
1a. Grayish, saxicolous, K- or K+ yellow to red……………....D. scruposus
1a. Whitish to grayish, terricolous or muscicolous, K+ yellow to red….2
2a. Hymenium 75-115 µm tall, asci 4-spored, ascospores 17-30 x 5.5-14
µm………………………………………………………..…...D. muscorum
246
2b. Hymenium 105-170 µm tall, asci 4-8 spored, ascospores 19.5-37.5 x 9-
16.5 µm…………………………………………………………D. diacapsis
1. Diploschistes diacapsis (Ach.) Lumbsch, Lichenologist 20(1): 20
(1988)
Thallus crustose, rimose- to verrucose-areolate; areoles plane to
subconvex,1.0-15 mm thick, to 0.5-2.0 mm in diameter; upper surface pale
gray, rough, dull, slightly whitish or grayish pruinose; ascomata urceolate,
subimmersed, up to 2.5 mm in diameter, sessile; disc blackish, concave,
white or gray pruinose; exciple up to 75 µm thick; epihymenium gray
brown; hymenium colourless to pale brown, 105-170 µm high;
hypothecium 30-60 µm tall; paraphysis simple; asci 4-8-spored, subclavate
to cylindrical; ascospores brown, broadly ellipsoid, 19.5-37.5 x 9-16.5 µm,
muriform.
Habitat: On soil (Tericolous)
Spot Tests: K+ yellow to red, C+ red, KC-, Pd-,
Secondary Metabolites (TLC): Lecanoric acids, diploschistesic acid
Specimen Examined: Dader, alt. 1,232 m, 08.11.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad 73 (HUP), on way to Lake Saif-ul-
Maluk, alt. 2,744 m, 30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed
Juneed Shah 404 (HUP).
World Distribution: Asia, Europe, Africa (S. Africa, Somalia,
Morocco, Egypt), S. America (Peru, Chile, Colombia), N. America (USA), C.
America (Mexico), Australia (Australia).
Note: New to the study area
2. Diploschistes muscorum (Scop.) R. Sant., in Hawksworth, James &
Coppins, Lichenologist 12(1): 106 (1980)
247
Thallus crustose, continuous, weakly areolate; prothallus present, white;
areoles thin or thick, plane to subconvex, 0.2-0.5 mm in diameter; upper
surface white to pale brown, rough, slightly or profusely grayish or whitish
pruinose; ascomata urceolate, up to 1.6mm in diameter, sessile; disc
blackish, concave, slightly white pruinose; exciple 65-70 µm thick;
epihymenium colourless; hymenium 75-115 µm high; hypothecium dark
brown, 80-95 µm tall; asci subclavate to cylindrical, 70-80 x 11-18 µm, 4-
spored; ascospores brown, ellipsoid, 17-30 x 5.5-14 µm.
Habitat: On soil (Tericolous)
Spot Tests: Thallus K+ yellow to red, C+ red
Secondary Metabolites (TLC): Lecanoric acids, diploschistesic acid
Specimen Examined: Dader, alt. 1,205 m, 10.10.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad 07 (HUP), Parehna, alt. 1,006 m,
05.12.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 155 (HUP),
Oghi, alt. 1,440 m, 14.04.2014, Asmat Ullah, Amir Khan Afridi and Kaleen Shah
223 (HUP).
World Distribution: Asia, Europe, Africa (S. Africa, Algeria,
Morocco), N. America, Caribean, S. America (Uraguay, Cheli, Argentena),
C. America (Mexico).
Note: New to the study area
3. Diploschistes scruposus (Schreb.) Norman, Nytt Mag. Natur. 7: 232
(1853) [1852]
Thallus crustose, effuse, sometimes bullate, rimose; upper surface pale
brown gray, shiny or dull, smooth, epruinose; apothecia 1.5-2.5 mm in
diameter, unceolate, sessile; disc blackish, white pruinose; epihymenium
brown; hymenium colourless, 100-130 µm tall; hypothecium brown, 50-90
248
µm tall; paraphysis simple; asci 8-spored, subclavate to cylindrical;
ascospores: brown, ellipsoid, muriforn, 20-30 x 10-15 µm.
Substrate: On rock (Saxicolous)
Spot Tests: K± yellow to red, C+ red,
Secondary Metabolites (TLC): Diploschistesic acid, lecanoric acid,
orsellinic acid
Specimen Examined: Mandgucha, alt. 1,899 m, 14.11.2013, Asmat
Ullah and Mazhar-ul-Islam 139 (HUP), Manoor Valley, alt. 2,874 m,
04.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-Islam 475 (HUP),
Jalkhad, alt. 3,000 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-
Islam 502 (HUP), Barawai, alt. 2,900 m, 15.09.2014, Asmat Ullah and Amir
Khan Afridi 601 (HUP).
World Distribution: Asia, Europe, Africa, C. America (Mexico), N.
America, S. America, Australasia (Australia, New Zealand), Hawaii.
Note: New to the study area
Fig. 4.30: Distribution of Thelotremataceae in District Mansehra; 1. Jalkhad. 2. Barhawai, 3. on way to lake Saif-ul-Maluk, 4. Manoor Valley, 6. Dader, 7. Mandagucha, 8. Oghi, 9. Parehna.
249
Plate 3.38: A. Diploschistes diacapsis, B. Diploschistes muscorum, C. Diploschistes scruposus (scale= 0.5 cm) in District
Mansehra.
250
25. Trapeliaceae
Thallus crustose to lobate or squamulose; apothecia biatorine or lecanorine,
sessile; sopres colourless, unicellular. Habitat: rocks. Distribution: arctic to
temperate.
Genera in study area: The present investigation recorded single genus
from District Mansehra (Fig. 4.31).
Trapeliopsis Hertel & Gotth. Schneid.
Thallus crustose, spreading, areolate, or squamulose to small foliose; upper
surface pale green to greyish, isidia or soredia absent or present; ascomata
apothecia, constricted at base, appressed; disc yellow brown to black;
exciple colourless; epihymenium usually pigmented; hymenium colourless,
weakly amyloid; paraphyses branched, anastomosing, septate; asci 8-
spored, clavate-cylindrical; ascospores colourless, ellipsoid, simple,
smooth, without thick perispore. Secondary metabolites: gyrophoric acid,
substrate: on rocks, wood and soil.
The present study recorded one specie as new to Pakistan from District
Mansehra.
1. Trapeliopsis granulosa (Hoffm.) Lumbsch, in Hertel, Lecideaceae
exsiccatae, Fascicle V (München) 5: no. 99 (1983)
Thallus crustose, warted-areolate; areoles up to 0.1-0.4 mm in diameter,
slightly to strongly convex; upper surface white to pale gray, rarely dark
green, dull, usually sorediate; soralia 0.3-0.6 mm in diameter, whitish to
cream-yellow, irregular and granular; apothecia frequent, 0.4-1.0 mm in
diameter, sessile with a constricted base; disc variable in colour, pale pink
to reddish brown, or green gray, dull, flat to weakly convex , epruinose;
exciple colourless or grayish brown near margin; epihymenium pale to
greenish, 10-20 µm high; hymenium 50-70 µm tall; paraphyses hyaline,
251
strongly branched and anastomosing; hypothecium colourless to pale
orange brown, 10-75 µm high; ascospores colourless, simple, 10.5-13x 4.5-
6.5 µm.
Habitat: On rotting wood and bark (Corticolous)
Spot Tests: Thallus C+ red, KC+ red,
Secondary Metabolites (TLC): Gyrophoric acid.
Specimen Examined: Mandaghucha, alt. 1,928 m, 14.11.2014, Asmat
Ullah and Mazhar-ul-Islam 151 (HUP), Kaghan, alt. 2,231 m, 29.07.2014,
Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 395 (HUP).
World Distribution: Asia, Europe, Africa (Madagascar, S. Africa,
Morocco), N. America, S. America, Caribbean, Australasia (Australia),
Antarctica.
Note: New to Pakistan.
Fig. 4.31: Distribution of Trapeliaceae in District Mansehra: 1. Kaghan, 2. Mandaghucha.
252
26. Umbilicariaceae
Thallus foliose, umbilicate; apothecia superlecideoid; ascospores colourless
or brown, unicellular or muriform. Habitat: rocks. Distribution: arctic to
temperate to tropical.
Genera in study area: The present study recorded a single genus from
District Mansehra (Fig. 4.32).
Lasallia Merat
Thallus foliose, umbilicate, monophyllus, dorsiventral, attached by stout;
upper surface whitish gray or light to dark brown, dull, densely postulate,
isidia present or absent; lower surface whitish gray to dark brown or black,
smooth to tiny papillose to areolate, without rhizines; ascomata apothecia,
sessile or stalked; disc dark brown to black, flat to undulate; true exciple
present, persistent; hymenium colourless; paraphyses simple or slightly
branched, apices clavate, cap dark brown; asci Umbilicaria-type, clavate, 1-2
spored; ascospores pale to dark brown, muriform. Secondary metabolites:
anthraquinones, gyrophoric acid, papulosin. Substrate: on siliceous rock,
cliffs, boulders in sun and shade.
The genus represented a total of 17 species from the world and single taxa
from Pakistan. The present study recorded single taxa from District
Mansehra (Plate 3.40).
Lasallia papulosa (Ach.) Llano, (1950)
Thallus umbilicate, monophyllus, up to 8.5 cm in diameter, margin
irregular or scalloped; upper surface gray, occasionally brown or covered
with rusty red pruina; lower surface ashen gray or brown, smooth to
slightly areolate; apothecia common, up to 2.0 mm in diameter, sessile to
subpedicellate; disc dark brown to black, flat to undulate; asci clavate, 1-
253
spored; ascospores muriform, colourless initially becoming brown, 50-90 x
30-40 µm.
Habitat: On rock (Saxicolous)
Spot Tests: Upper cortex: K- , C+ red, KC+ red, Pd-,
Secondary Metabolites (TLC): Anthraquinones, gyrophoric acid,
papulosin,
Specimen Examined: Dader, alt. 1,215 m, 10.10.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad 06 (HUP).
World Distribution: Asia, Europe, Africa (S. Africa, Morocco, Kenya,
Tanzania).
Fig. 4.32: Distribution of Umbilicariaceae in District Mansehra. 1. Dader.
254
Plate 3.39: Lasallia papulosa (scale= 0.5 cm) in District Mansehra.
255
27. Verrucariaceae
Thallus foliose or crustose, usually corticate when foliose, non-corticate
when crustose. Photobiont green algal cells. Perithecia immersed or
superficial, simple, entire or dimidiate; ascus with 1-8 spores, occasionally
16 spores; spores colourless or sometimes brown, simple.
Genera in study area: The present study recorded four genera from
District Mansehra (Fig. 4.33).
Key to genera
1a. Thallus Crustose ………………………………………………..……….2
1a. Thallus foliose or Squamulos…………………………………………..3
2a. Perthecia black, immersed or sessile, asci 8-spored……..…Verrucaria
2b. Not as above
3a. Thallus foliose, growing on rocks, spore simple without
perispore……………………………………………………Dermatcarpon
3b. Thallus Squamulose or subfoliose, growing on rocks, soil, mosses…4
4a. on soil, ascus 8-spored……………………………….……Catapyrenium
4b. on soil, rocks, ascus bisporous………………………………Endocarpon
Catapyrenium Flot.
Thallus squamulose, attached by intricate, rhizoidal hyphae or rhizines;
squamules rounded, dispersed, loosely or closely adnate, contiguous or
imbricate; upper surface greenish gray or brown, smooth or minutely
scabrose, soredia and isidia absent; lower surface pale black, bare or with
rhizohyphal weft, hyphal tuft or rhizines; ascomata perithecia, immersed,
laminal, immersed, subglobose or broadly pyriform; exciple colourless,
256
brownish, brown-black; paraphyses absent; asci clavate, 8-spored, thin
walled, wall non amyloid, without an ocular chamber; ascospores biseriate,
simple, hyaline, ellipsoid or ovoid-clavate. Secondary metabolites: none
detected. Substrate: on soil, over plants debris and bryophytes.
A total of 8 species of the genus are reported from the globe while two
species from Pakistan. The present study recorded one species from
District Mansehera (Plate 3.41)
Catapyrenium cinereum (Pers.) Körb., Syst. lich. germ. (Breslau): 325 (1855)
Thallus squamules, small, up to 3 mm across, closely adnate, finely incised,
occasionally subgranular in central part, usually whitish pruinose; lower
surface dark on black loose hypothallus; ascomata perithecia, numerous,
immersed in the thallus; exciple pale when young, soon becoming blackish
or brown throughout; asci clavate, 8-spored; ascospores simple, hyaline,
biseriate, clavate, 16.5-23 x 6-8.5 µm.
Habitat: On soil (Tericolous)
Spot Test: All negative
Secondary Metabolites (TLC): None detected
Specimen Examined: Dader, alt. 1,215 m, 10.10.2013, Asmat Ullah,
Amir Khan Afridi and Syed Muhammad 031 (HUP).
World Distribution: Asia, Europe, British Isles, Africa (S. Africa,
Uganda), North America, S. America (Chile), Australasia (Australia, New
Zealand) and Antarctica.
Note: New to the study area.
257
Dermatacarpon Eschw.
Thallus: foliose; upper surface gray to brown, vegetative propagules
absent; lower surface dark brown to almost black, smooth, rugose,
reticulate, some species on lower surface with rhizine like structure, single
or multiholdfast; ascomata perithecial, immersed in thallus, broadly
obpyriform to subglobose; asci clavate or cylindrical, bitunicate, thin
walled, 8-spored; ascospores colourless, simple, smooth, ellipsoid, without
perispore, irregularly arranged in ascus, 8-25 µm long. Secondary
metabolites: none detected. Substrate: on rocks in damp habitat.
The genus represented 35 species from the world and two species from
Pakistan. The present study recorded one species from District Mansehra
(Plate 3.41).
1. Dermatocarpon miniatum (L.) W. Mann, Lich. Bohem. Observ.
Dispos.: 66 (1825)
Thallus foliose, entire or lobed, up to 20-45 mm in diameter, attached to
substratum by central holdfast; lobes flat or slightly rippled, 1-6.5 cm
broad; upper surface pale gray to gray brown, slightly white pruinose;
lower surface light brown to dark brown, smooth to warty, occasionally
with reticulate veins; ascomata perithecia, abundant, immersed, black, 190
µm in diameter; ascospores hyaline, simple, elongated, 7.5-13.5 x 5-6 µm.
Habitat: On rocks (Saxicolou)
Spot Test: All negative
Secondary Metabolites (TLC): None detected
Specimen Examined: Near Bafa Durah, alt. 934 m, 09.11.2013, Asmat
Ullah and Amir Khan Afridi 99 (HUP), Dader on the bank of Siran river, alt.
1,205 m, 10.10.2013, Asmat Ullah, Amir Khan Afridi and Syed Muhammad 01
258
(HUP), on side of road from Naran to Lake Saif-ul-Maluk, alt. 2,990 m,
30.07.2014, Asmat Ullah, Amir Khan Afridi and Syed Juneed Shah 403 (HUP),
Jalkhad, alt. 3,167 m, 10.08.2014, Asmat Ullah, Ashfaq Ahmad and Mazhar-ul-
Islam 515 (HUP).
World Distribution: Asia, Europe, British Isles, Africa (Algeria,
Morocco), North America, S. America (Venezuela, Colombia), C. America
(Mexico), Australasia.
Note: New to the study area.
Endocarpon Hed.
Thallus squamulose, to subfoliose; squmules 0.5-10 mm wide, scattered to
contiguous or imbricate, rounded or variously lobed, plane to convex,
closely appressed to ascending; upper surface brown, smooth or rugulose
to shallowly rimose, isidia or soredia absent; lower surface pale, bare, or
with rhizohyphal weft or rhizines; ascomata perithecia, broadly pyriform
to subglobose, laminal, immersed; exciple dark throughout; asci bitunicate,
clavate or cylindro-clavate, thin walled, usually bisporous; ascospores
colourless, or pale to dark brown, multiseptate to muriform. Secondary
metabolites: none detected. Substrate: soil, rocks, on mosses, rarely barks.
A total of 60 species of the genus are reported from world and one specie
from Pakistan. The present study recorded one specie from District
Mansehra (Plate 3.41)
1. Endocarpon pusillum Hedw., Descr. micr.-anal. musc. frond.
(Lipsiae) 2: 56 (1789)
Thallus squmulose; squmules scattered or contiguous, 0.8-3 mm wide, 0.15-
0.20 mm thick, closely appressed to substratum, usually weak to deeply
lobate; upper surface pale to dark raddish brown, smooth, dull; lower
surface black, rhizinate; rhizines black usually conspicuous, moderately to
259
richly branched; perithecia up to 0.4 mm wide, globose; exciple 20-35 µm
thick, brown-black to black; asci clavate to cylindro clavate, 2-spored, 80-
120 x 17-30 µm; ascospores colourless to dark brown, muriform, ellipsoid to
subcylindrical, 30-50 x 16-20 µm.
Habitat: On soil (tericolous)
Spot Tests: All negative,
Secondary Metabolites (TLC): None detected
Specimen Examined: Dader, alt 1,209 m, 11.10.2013, Asmat Ullah, Amir
Khan Afridi and Malik Zahir 40 (HUP).
World Distribution: Asia, Africa, N. America, (Canada, USA), S.
America, C. America (Guatemala, Mexico), Hawaii, Australasia.
Verrucaria Schrader
Thallus crustose, immersed or superficial, continuous or rimose to areolate;
upper surface white, gray, green, brown, black or purple, dull or shiny
very rarely isidiate-pseudosorediate; ascomata perithecia, black, globose or
broadly ovoid, immersed, laminal or lateral; exciple hyaline, brown or
black; involucrellum present or absent; paraphyses disappearing; asci 8-
spored, clavate, fissitunicate; ascospores colourless, subglobose, ellipsoid,
smooth, thin walled. Secondary metabolites: absent. Substrate: mostly on
rock, occasionally on bark or soil.
The genus has 200 species distributed worldwide; previously six species
are reported from Pakistan. The present study recorded one specie from
from District Mansehra (Plate 3.42).
1. Verrucaria muralis Ach., Methodus, Sectio prior (Stockholmiæ): 115
(1803)
260
Thallus crustose, immersed to superficial, irregularly rimose, rarely
areolate; aupper surface white-green or brown-white,dull, epruinose;
perithecia black, semi-immersed or almost sessile, apex rounded to slightly
flattened; exciple colourless to pigmented at base, sub-globose, 0.2-0.35 mm
wide; involucrellum present around upper half of exciple, more or less
hemispherical; asci 8-spored, clavate, 60-75 x 15.5-22 µm; ascospores
colourless, narrowly to broadly ellipsoid, simple, 16.5-24.5 x 8-12 µm.
Habitat: On rocks (Saxicolous)
Spot Tests: All negative
Secondary Metabolites (TLC): None detected.
Specimen Examined: Lalazar, alt. 2,600 m, 10.09.2014, Asmat Ullah,
Amir Khan Afridi and Syed Juneed Shah 597 (HUP).
World Distribution: Asia, (Japan, Taiwan) Europe, Africa, North
America, Australasia (Australia, New Zealand).
Fig. 4.33: Distribution of Verrucariaceae in District Mansehra; 1. Jalkhad, 2. Dader.
261
Plate 3.40: A. Catapyrenium cinereum, B. Dermatocarpon miniatum, C. Endocarpon pusillum (scale= 0.5 cm) in District Mansehra.
262
Plate 3.41: Verrucaria muralis (scale= 2 cm) in District Mansehra.
4.2 Lichen Species Identified by DNA Barcoding
All reported lichen species from study area were also tested by DNA
barcoding for identification. Amomg 110 lichen species, only five species
were identified by the above method (Table 4.9).
1. Lecanora allophana (Ach.) Nyl.
DNA barcoding: Maximum homology of the lichen sample P-10 (Gene
bank accession number KY548051.1) with Lecanora allophana at nucleotide
sequence level (98% identity and 100% query).
2. Phaeophyscia ciliata (Hoffm.) Moberg
DNA Barcoding: Maximum homology of the lichen sample P-7 (Gene bank
accession number AY498676.1) with Phaeophyscia ciliata at nucleotide
sequence level (99% identity and 100% query).
3. Physcia aipolia (Ehrh. ex Humb.) Fürnr.
DNA barcoding: Maximum homology of the lichen sample P-50 (Gene
bank accession number GU247177.1) with Physcia aipolia at nucleotide
sequence level (99% identity and 100% query).
263
4. Physcia dubia (Hoffm.) Lettau
DNA barcoding: Maximum homology of the lichen sample P-59 (Gene
bank accession number KX550105.1) with Physcia dubia at nucleotide
sequence level (91% identity and 73% query).
5. Xanthomendoza fulva (Hoffm.) Søchting, Kärnefelt & S.Y. Kondr.
DNA barcoding: Maximum homology of the lichen sample P-48 (Gene
bank accession number KC179134.1) with Xanthomendoza fulva at
nucleotide sequence level (100% identity and 100% query).
Table 4.9: List of species identified by DNA barcoding.
Sr. No
Lichens species Accession
No Identity at NCBI
1 Lecanora allophana (Ach.) Nyl. KY548051.1 100%
2 Phaeophyscia ciliata (Hoffm.) Moberg AY498676.1 99%
3 Physcia aipolia (Ehrh. ex Humb.) Fürnr. GU247177.1 99%
4 Physcia dubia (Hoffm.) Lettau KX550105.1 100%
5 Xanthomendoza fulva (Hoffm.) Søchting, Kärnefelt & S.Y. Kondr.
KC179134.1 100%
264
4.3 Biological Activities
4.3.1 Antibacterial Activity
The crude acetonic extract of ten selected lichen species showed
variable range of zone of inhibitions (7.00 – 12.66 mm) against tested
bacteria (Table 4.10). The zones of inhition for control were recorded in
range of 18 - 22 mm against all bacterial strains. Acetone extract exhibted
from Flavoparmelia caperata, Cladonia pyxidata and Lecanora allophana caused
maximum zones of inhibition (12.66 mm) against Escherichia coli,
Enterococcus faecali, S. aureus and S. epidermidis. Slightly narrow zones of
inhibition (12.33 mm) were recorded for Flavoparmelia caperata and Lecanora
allophana against Staphylococcus epidermidis. The crude methanolic extract of
selected lichen species showed variable range of zone of inhibitions (7.00 –
12.33 mm) against tested bacteria (Table 4.11). The zones of inhibition for
control were recorded in range of 18 - 21 mm against all bacterial strains.
For crude methanolic extracts, maximum zone of inhibation (12.33 mm)
were recorded for lichen species Flavoparmelia caperata and Rhizocarpon
viridiatrum against Escherichia coli and Pseudomonas aeroginosa, followed by
Caloplaca decipines, Collema flaccidum, Lecanora allophana and Usnea
fulvoreagens (zone of inhibition 12.33 mm) against Enterococcus faecali and
Pseudomonas aeroginosa.
265
Table 4.10: Antibacterial activity of acetone extracts of selected lichen species from District Mansehra.
Sr. No. Lichen species Bacterial strains and zone of inhibition (mm)
E. coli S. epidermi-dis B. subtilis E. faecalis P. aerogin-osa S. aure-us
1 Caloplaca decipiens 8.66 10.00 0 10.33 10.66 10,00
2 Cladonia pyxidata 9.66 8.33 8 12.66 9.66 8.33
3 Collema flaccidum - 0 0 0 8.66 8.66
4 Dermatocarpon miniatum 10.33 8 8 8.33 8.33 8.33
5 Flavoparmelia caperata 12.66 12.33 9.66 10.33 11.33 11.33
6 Flavopunctelia flaventior 0 9 0 8 0 9
7 Lecanora allophana 10 12.33 10.66 10 7 12.66
8 Peltigera polydactylon 0
8.66 0 0
9 Rhizocarpon viridiatrum 7.66 11.33 10.66 9.33 7.33 8.66
10 Usnea fulvoreagens
7.66 8.33 7.66 8.33 8.00
266
Table 4.11: Antibacterial activity of methanol extracts of selected lichen species from District Mansehra.
Sr. No.
Lichen species Bacterial strains and zone of inhibition
E. coli S. epidermidis B. subtilis E. faecalis P. aeroginosa S. aureus
1 Caloplaca decipiens 10.33 7 8.33 10.66 8 8.33
2 Cladonia pyxidata 0 7 0 10 0 0
3 Collema flaccidum 0 7 0 10.66 7 8
4 Dermatocarpon miniatum 0 7 0 9 7 7.66
5 Flavoparmelia caperata 12.33 7 10.33 10 12.33 9.66
6 Flavopunctelia flaventior 8 7 0 8 8 8.66
7 Lecanora allophana 8.33 7 9.66 10.66 10 9
8 Peltigera polydactylon 0 7 0 0 7 0
9 Rhizocarpon viridiatrum 12.33 7 10 0 10 7
10 Usnea fulvoreagens 8 7 9 10 10.66 7
267
4.3.2 Antifungal Activity
The crude acetonic extract of selected lichen species showed
variable range of zone of inhibition (7.00 – 11.33 mm) against tested fungi
(Table 4.12). The zones of inhition for control were recorded in range of 17 -
19 mm against all tested fungal strains. For crude acetone extracts
maximum zones of inhibition (11.33 mm) were recorded for Caloplaca
decipines, Flavoparmelia caperata and Lecanora allophana against Aspergillus
fumigatus and A. niger, followed by Cladonia pyxidata, Flavoparmelia caperata
and Lecanora allophana (Zone of inhibition 10.66 mm) against Aspergillus
fumigatus, A. niger and Fusarium solani. The crude methanolic extract of
selected lichen species showed variable range of zone of inhibition (7.00 –
10.66 mm) against tested fungi (Table 4.13). The zones of inhibition for
control were recorded in range of 16 - 19 mm against all tested fungal
strains. For crude methanolic extracts maximum zone of inhibation (10.66
mm) were recorded for lichen species Flavoparmelia caperata and Lecanora
allophana against Aspergillus fumigatus and A. niger, while slightly lower
zone of inhibition (10.33 mm) were shown by Flavopunctelia flaventior
against A. niger.
268
Table 4.12: Antifungal activity of acetone extracts of selected lichen species from District Mansehra.
Sr. No Lichen species Fungal strain and zone of inhibation (mm)
A. niger A. fumigatus F. solani F. oxysporium
1 Dermatocarpon miniatum 8.33 7.33 7.66 7.33
2 Caloplaca decipiens 9.66 11.33 9.33 8.33
3 Cladonia pyxidata 8.33 10.66 8.66 9.33
4 Collema flaccidum 0 0 0 0
5 Flavoparmelia caperata 10.66 11.33 9 10
6 Flavopunctelia flaventior 9 8.33 7 7.33
7 Lecanora allophana 11.33 10.0 10.66 8.33
8 Peltigera polydactylon 0 0 0 0
9 Rhizocarpon viridiatrum 7.33 8.66 7 8.33
10 Usnea fulvoreagens 9.66 7 8 8.33
269
Table 4.13: Antifungal activity of methanol extracts of selected lichen species from District Mansehra.
Sr. No. Lichen species Fungal strain and zone of inhibition
A. niger A. fumigatus F. solani F. oxysporium
1 Dermatocarpon miniatum 8 7.66 7 7.33
2 Caloplaca decipiens 8 8.66 9 8.33
3 Cladonia pyxidata 8 8.66 7.33 8.66
4 Collema flaccidum 0 0 0 0
5 Flavoparmelia caperata 9.66 10.66 8.33 9.66
6 Flavopunctelia flaventior 10.33 8.66 7.33 9.66
7 Lecanora allophana 10.66 9.33 9 8.33
8 Peltigera polydactylon 0 0 0 0
9 Rhizocarpon viridiatrum 8.33 8 7 8.66
10 Usnea fulvoreagens 9.66 8.33 8 9.33
270
4.3.3 Cytotoxcity Assay
The crude acetonic extracts of investigating lichen species in
different concentration were shown variable range of (4% - 60%) toxic effect
on larvae of A. salina (Table 4.14). In crude acetone extract concentration of
0.05 mg/mL, maximum mortality rate (60%) was recorded for
Flavopunctelia flaventior followed by Flavoparmelia caperata (40%) while
maximum mortality rate for extract of concentration 0.01 mg/mL were
recorded for Flavopunctelia flaventior (40%). Similary, for extracts in
concentration 0.001 mg/mL, 30% mortality rate was recorded for same
species (Fig. 4.34). The crude methaholic extracts of investigating lichen
species in different concentration were shown variable range of (3% - 53%)
toxic effect on larvae of A. salina (Table 4.15). In crude methaholic extract of
concentration 0.05 mg/mL, maximum mortility (53%) was shown by
Flavopunctelia flaventior followed by Flavoparmelia caperata (50%). In
concentration of 0.01 mg/mL maximum mortality was shown by
Flavoparmelia caperata (40%) followed by Flavopunctelia flaventior (30%).
Similarly, in concentration of 0.001 mg/mL, maximum mortilty (30%) was
shown by Flavoparmelia caperata (Fig. 4.35).
271
Table 4.14: Percentage mortality of acetone extracts of selected lichen species from District Mansehra.
Sr. No. Lichen species Percentage mortality
0.05 mg/mL 0.01 mg/mL 0.001 mg/mL LC50 ( mg/mL)
1 Caloplaca decipiens 4% 0% 0% 579.77
2 Cladonia pyxidata 7% 4% 0% 399. mg/mL
3 Collema flaccidum 0% 0% 0% 0%
4 Dermatocarpon miniatum 10% 10% 0% 325.51
5 Flavoparmelia caperata 40% 30% 26% 86.09
6 Flavopunctelia flaventior 60% 40% 30% 31.87
7 Lecanora allophana 30% 10% 0% 83.77
8 Peltigera polydactylon 30% 20% 20% 142.66
9 Rhizocarpon viridiatrum 24% 13% 4% 119.37
10 Usnea fulvoreagens (Rasanen) 17% 7% 0% 153.82
272
Table 4.15: Percentage mortality of methanol extracts of selected lichen species from District Mansehra.
Sr. No. Lichen species Percentage mortality
0.05 mg/mL 0.01 mg/mL 0.001 mg/mL LC50 (mg/mL)
1 Caloplaca decipiens 10% 0% 0% 234.40
2 Cladonia pyxidata 10% 7% 0% 290.76
3 Collema flaccidum 0% 0% 0%
4 Dermatocarpon miniatum 30% 30% 20% 184.66
5 Flavoparmelia caperata 53% 27% 13% 45.01
6 Flavopunctelia flaventior 50% 40% 30% 48.11
7 Lecanora allophana 10% 7% 0% 290.76
8 Peltigera polydactylon 30% 20% 20% 142.66
9 Rhizocarpon viridiatrum 27% 17% 7% 112
10 Usnea fulvoreagens (Ra 20% 3% 0% 122.88
273
Fig. 4.34: Percentage mortality of acetone extracts of selected lichen species from District Mansehra.
Fig. 4.35: Percentage mortality of methanol extracts of selected lichen species from District Mansehra.
0%
10%
20%
30%
40%
50%
60%
70%
% m
ort
ali
ty o
f A
.sa
lin
a
Lichen species
0.05 mg/mL
0.01 mg/mL
0.001mg/mL
0%
10%
20%
30%
40%
50%
60%
%
mo
rta
lity
of
A.
sali
na
Lichen species
0.05 mg/mL
0.01 mg/mL
0.001mg/mL
274
4.3.4 Anticarcinogenic Activity
The crude acetonic extracts of investigating lichen species in
different concentration were shown variable range of tumor inhibition (8%
- 40%) (Table 4.16). Tumor inhibitions for control were recorded in range of
95%- 100%. For crude acetonic extracts in concentration of 0.05 m/mL,
maximum tumor-inhibition activity (40%) were recorded for lichen species
Flavoparmelia caperata followed by Rhizocarpon viridiatrum (39%) and
Dermatocarpon miniatum 38%. While in extracts of concentration 0.01
mg/mL maximum tumor-inhibition were recorded for Flavoparmelia
caperata (38%), Rhizocarpon viridiatrum and Dermatocarpon miniatum (33%
each). Similarly, in concentration of 0.001 mg/mL, maximum activity (30%)
was shown by Flavoparmelia caperata (Fig. 4.36). The crude methanolic
extracts of investigating lichen species in different concentration were
shown variable range (8% - 38%) of tumor inhibition (Table. 4.16). Tumor
inhibitions for control were recorded in range of 95%-100%. Crude
methanolic extracts in concentration of 0.05 mg/mL maximum tumor-
inhibition (38%) were recorded for lichen species Flavopunctelia flaventior
followed by Flavoparmelia caperata and Rhizocarpon viridiatrum (37% each).
While in extracts of concentration 0.01mg/mL, maximum activity (31%)
was shown by Flavoparmelia caperata followed by Flavopunctelia flaventior
(30%) and in concentration 0.001 mg/mL maximum activity (30%) was
shown by Flavopunctelia flaventior (Fig. 4.37).
275
Table 4.16: Anticarcinogenic activity of acetone and methanol extracts of selected lichen species from District Mansehra.
Sr. No. Lichen species Acetone Extracts Methanol Extracts
0.05 mg/mL 0.01 mg/mL 0.001 mg/mL 0.05 mg/mL 0.01 mg/mL 0.001 mg/mL
1 Caloplaca decipiens 0% 0% 0% 0% 0% 0%
2 Cladonia pyxidata 17% 8% 0% 18% 10% 0%
3 Collema flaccidum 17% 13% 12% 17% 10% 0%
4 Dermatocarpon miniatum 38% 33% 26% 31% 19% 10%
5 Flavoparmelia caperata 40% 38% 34% 37% 31% 15%
6 Flavopunctelia flaventior 36% 23% 20% 38% 30% 27%
7 Lecanora allophana 18% 13% 0% 0% 0% 0%
8 Peltigera polydactylon 34% 23% 20% 30% 16% 8%
9 Rhizocarpon viridiatrum 39% 33% 29% 37% 25% 13%
10 Usnea fulvoreagens 29% 20% 11% 28% 20% 9%
276
Fig. 4.36: Percentage tumor-inhibition of acetone extracts of selected lichen species from District Mansehra.
Fig. 4.37: Percentage tumor-inhibition of methanol extracts of selected
lichen species from District Mansehra.
0%
5%
10%
15%
20%
25%
30%
35%
40%
% t
um
or
inh
iba
tio
n
0.05 mg/mL
0.01 mg/mL
0.001 mg/mL
0%
5%
10%
15%
20%
25%
30%
35%
40%
% t
um
or
inh
iba
tio
n
0.05 mg/mL
0.01 mg/mL
0.001 mg/mL
277
4.3.5 Antioxidant Activity
The crude acetonic extracts of investigating lichen species in
different concentration were shown variable range (12% - 66%) of DPPH
radical scavenging activity. For control DPPH radical scavenging activity
were recorded in range of 61%- 79% (Table. 4.17). For crude acetone
extracts in concentration of 1000 µg/mL, the strongest DPPH radical
scavenging were recorded for Cladonia pyxidata (66%), Rhizocarpon
viridiatrum (63%) and Peltigera polydactylon (58%). While in concentration
500 µm/mL, Rhizocarpon viridiatrum showed 60%, Peltigera polydactylon 56%
and Cladonia pyxidata showed 54% antioxidant activity. Similarly, in
concentration of 250 µg/mL maximum activity were shown by Rhizocarpon
viridiatrum (56%) and Peltigera polydactylon (50%), while for concentration of
125 µg/mL maximum activity (47%) were shown by Peltigera polydactylon
(Fig. 4.38). The crude methanolic extracts of investigating lichen species in
different concentration were shown variable range of DPPH radical
scavenging activity (8% - 57%). For control DPPH radical scavenging
activity were recorded in range of 61%- 79% (Table. 4.18). For crude
methanolic extracts in concentration of 1000µg/mL, highest DPPH free
radical scavenging was recorded for Rhizocarpon viridiatrum (56%) and
Peltigera polydactylon (50%), while in concentration of 500µg/mL, maximum
activity was shown by Peltigera polydactylon (55%) and Rhizocarpon
viridiatrum (55%). Similarly, for crude methanolic extracts in concentration
of 250 µg/mL, maximum activity was recorded for Peltigera polydactylon
(51%) and Rhizocarpon viridiatrum (46%) while in concentration of 125
µg/mL, maximum activity was shown by Rhizocarpon viridiatrum (44%) and
Flavoparmelia caperata (41%) (Fig. 4.39).
278
Table 4.17: Antioxidant activity of acetone extracts of selected lichen species from District Mansehra.
Sr. No. Lichen Species Percent free radical scavenging activity
1000 µg/mL 500 µg/ml 250 µg/ml 125 µg/ml
1 Caloplaca decipiens 17 12 0 0
2 Cladonia pyxidata 66 54 44 40
3 Collema flaccidum 37 31 30 25
4 Dermatocarpon miniatum 52 47 43 36
5 Flavoparmelia caperata 46 39 33 26
6 Flavopunctelia flaventior 29 26 22 20
7 Lecanora allophana 40 37 29 26
8 Peltigera polydactylon 58 56 51 41
9 Rhizocarpon viridiatrum 63 60 56 49
10 Usnea fulvoreagens 33 31 26 24
Ascorbic acid 79 72 65 61
279
Table 4.18: Antioxidant activity of methanol extracts of selected lichen species from District Mansehra.
Sr. No. Lichen Species Percent free radical scavenging activity
1000 µg/mL 500 µg/mL 250 µg/mL 125 µg/mL
1 Caloplaca decipiens 29 20 13 0
2 Cladonia pyxidata 49 47 41 33
3 Collema flaccidum 26 19 13 11
4 Dermatocarpon miniatum 48 46 37 33
5 Flavoparmelia caperata 51 48 43 41
6 Flavopunctelia flaventior 31 29 23 21
7 Lecanora allophana 37 36 30 28
8 Peltigera polydactylon 56 55 51 38
9 Rhizocarpon viridiatrum 57 55 46 44
10 Usnea fulvoreagens 26 23 16 8
Ascorbic acid 79 72 65 61
280
Fig. 4.38: Antioxidant activity of acetone extracts of selected lichen species from District Mansehra.
Fig. 4.39: Antioxidant activity of methanol extracts of selected lichen species from District Mansehra.
0
10
20
30
40
50
60
70
80
% D
PP
H s
cav
en
gin
g
Lichen species
1000 µg/mL
500 µg/mL
250 µg/mL
125 µg/mL
0
10
20
30
40
50
60
70
80
% D
PP
H s
cav
en
gin
g
Lichen species
1000 µg/mL
500 µg/mL
250 µg/mL
125 µg/mL
281
Chapter 5
DISSCUSSION
In the present study, species diversity of lichens in District Manshera was
evaluated alongwith in-vitro antimicrobial, cytotoxic, antitumor and
antioxidant activities of acetone and methanol crude extract of the lichens.
Recently worldwide, there is great focus on the taxonomy, ecology and
phylogenetic study of lichens to explore their biodiversity and biological
importance (Geiser et al., 2010; Leavitt and Clair, 2011; Lendemer and
Hodkinson, 2013; McMurray et al., 2013; Shrestha et al., 2012). Due to highly
diverse topographic and climatic attributes, Pakistan serves a distinct home
land for a diverse flora. The higher plants of Pakistan are documented
comprehensively (Stewart, 1972; Ali and Qaiser, 1995-2012), however
exploration of lower plants including lichens remain neglected.
Unfortunately, the lichen flora of Pakistan is still little known and even
earlier available literature provides just sample checklists for some
localities of Pakistan (Hawksworth and Mahmood 1971; Shaheen and
Iqbal, 1978; Aptroot and Iqbal, 2011). In order to asses our lichens resource,
detail documentation of lichen flora of Pakistan is important future target.
As Pakistan covers a vast area (7,960,962 km2), therefore area-wise lichen
exploration is possible rather than taking into account the whole country
simultaneously. Furthermore, contrary to previous studies which involved
the collection of lichen samples from roadsides and in particular season, an
additional attempt was made to collect the lichen samples round the year
and less explored localities difficult to access such as Manoor Valley,
Lulusar Lake, Jalkhad, Saripaya and Mandagucha.
In current study, a thorough field survey based on scientific investigation
was carried out in selected areas of District Manshera during January 2012
to July 2015. During the field surveys, about 900 lichen specimens were
282
collected from various localities of the District Mansehra. Identification of
the collected lichen specimens via morphological, anatomical, chemistry of
thalli and DNA barcoding indicated that collected lichen specimens
belonged to 110 lichen taxa representing 27 families and 56 genera from the
study area. Previously 96 taxa belonging to 25 families and 50 genera were
reported from District Mansehra (Aptroot and Iqbal, 2012). Surprisingly,
only 36 already reported lichen species were recollected and while the
remaining 60 species were not found in the study area.
The highest number of genera was shown by Parmeliaceae with 12 genera
(10.90%) followed by Physciaceae 7 genera (6%), Teloschistaceae 4 genera
(3.63%) and Verrucariaceae 4 genera (3.63%). Similar high diversity has
been reported for Parmeliaceae and Physciaceae from District Tamil Nadu
(Nayaka et al., 2001), Jammu and Khasmir (Goni and Sharma, 2015) and
Uttarkand (Mishra and Upreti, 2016). Higher number of lichen species
were recorded for family Parmeliaceae with 17 species (15.45%), followed
by Lecanoraceae 15 species (13.63%), Physciaceae 13 species (11.81%) and
Teloschistaceae 9 species (8.18%) is comparable to studies carried out in
Kombam district, India (Nayaka et al., 2001), Laltipur district (Devkota,
2008) and Kathmandu and Sagarmatha national Parks, Nepal (Baral, 2015).
Among 110 lichens species, only five species were identified through DNA
barcoding. The common reasons are the failure of amplification process to
obtain the target gene in selected lichens. All specimens where
amplification failed were collected 2.5 - 3 years ago. Complete sequences
were obtained from DNA extracted from the specimens collected within 1
year. Kelly et al. (2011) also reported that amplification failure is one of
common reason for not obtaining target gene and the in DNA extracted
from 3 years old samples (7.1%) or (9.8%) amplification failed.
283
Most interestingly, among the identified lichen species, 12 species were
new to Pakistan viz., Acarospora veronensis, Anaptychia crinalis, Candelariella
efflorescens, Cladonia caespiticia, Cladonia floerkeana, Lecanora chlarotera,
Lecanora pulicaris, Lepraria elobata, Nephroma parile, Punctelia subrudecta,
Rhizocarpon lecanorinu and Trapeliopsis granulosa. Additionally, in the
current investigation 59 identified species belonging to 17 families and 35
genera were recorded for the first time in District Mansehra, Khyber
Paktonkhawa. Meanwhile as far as various growth forms of recorded
lichen species are concerned, Crustose included 51 species (46.36%) and
foliose comprised 47 species (42.72%). A similar ratio of crustose and
foliose growth forms were also recorded by some other investigators from
different region of the world; District Poonch (Khan et al., 2010), Uludag
mountain, Bursa (Ozturk et al., 2010), Southern Assam (Rout et al., 2010)
and Jammu and Kashmir (Ghoni and Sharma 2015). In addition, the lichen
species from District Mansehra prefer specific habitats; 55 species were
corticolous (50%), 42 species saxicolous (38.18%), 12 species tericolous
(10.9%) and only one muscicolous (0.9%). The occurrence of dominant
corticolous and saxicolous lichen species was confirmed by similar studies
conducted earlier in differen area; Kombam district, Western Ghat and
Jummu and Kashmir (Nayaka et al., 2001; Vinayaka, 2011; Ghoni and
Sharma, 2015).
Lichen species from District Mansehra colonized on different substrates
like trees, rocks, soil and mosses. On the basis of hosted substrate, the
present study recorded 43 species on bark (39.09%), followed by 42 species
on rocks (38.18%) and 12 species on soil (10.9%). Lichen always prefers
bark of trees as indicated by Vinayaka et al. (2016) in their investigation
suggesting a higher number of species inhabiting bark of trees. In the view
of conservation, majority of the lichen species (78.13%) are recorded at two
or more localities while 23 taxa (21.87%) are restricted to single locality and
284
fall under rare category. Hence, these taxa deserve immediate attention
and an effective conservation action plan should be developed at urgent
bases.
Emergence of bacterial resistance to various drugs such as β-lactam
antibiotics has limited the scope of existing antibiotics and forced the
concerted efforts to search and develop new bioactive compounds for the
treatment of these strains (Stapleton and Taylor, 2002). After the
publication of first report on antibacterial activity of lichen species by
Burkholder et al. (1944), and many other research works have been done in
recent years on the antibacterial potentials of lichen species. The results of
these researches have manifested that lichen can be another option for drug
discovery against several antibiotic resistant strains (Lauterwein et al.,
1995; Cocchietto et al., 2002; Francolini et al., 2004; Molnar and Farkas,
2010; Boustie et al., 2011; Pompilio et al., 2013; Shrestha and Clair, 2013 a,b;
Ramos et al., 2014; Rankovic et al., 2014).
In present study, we evalualted the antibiotic activities of methanolic and
acetonic crude extracts of selected lichen species against some bacterial
strains. Maximum zone of inhibition (12.66 mm) of the crude acetone
extracts against Escherichia coli (ATCC_39111) was recorded for
Flavoparmelia caperata. Chauhan and Abraham (2013) also recorded zone of
inhibition within range of 6.00 mm to 22.66 mm for methanol extracts
Parmotrema sp. in different concentrations. In case of Pseudomonas
aeroginosa (ATCC_10145), maximum zone of inhibition (11.33 mm) was
recorded for Flavoparmelia caperata. Srivastava et al. (2013b) was also
recorded almost identical zone of inhibition (12.30 mm) against P.
aeruginosa for ethanol extract of Usnea ghattensis. The maximum zone of
inhibition of the crude extracts against Gram+ve S. epidermidis (ATCC-
700587) was recorded for Flavoparmelia caperata and Lecanora allophana
(12.33 mm). Karagoz et al. (2009) also reported identical zone of inhibition
285
(13.00 mm) for the ethanol extract of Peltigera polydactylon against S.
epidermidis. Maximum inhibition zone (10.66 mm) against Bacillus subtilis
(ACTT 6633) were shown by Lecanora allophana, Rhizocarpon viridiatrum. An
earlier study also reported identical zone of inhibition (10.0 mm) for
aquous extracts of Peltigera praetextata and Umbilicaria vellea against Bacillus
subtilis (Karagoz et al. 2009). The crude acetonic extract of Cladonia pyxidata
exhibited maximum zone of inhibition (12.66 mm) against Gram+ve
bacterium E. faecialis (ATCC-19433). Almost similar results were reported
for the acetonic extract of Roccella belangeriana against Gram+ve Enterococci
sp. (Karthikaidevi et al., 2009). Meanwhile, crude acetonic extracts of
Lecanora allophana showed maximum zone of inhibition (12.66 mm) against
Gram+ve S. aureus (ATCC_33591). Hengameh and Rajkumar
(2017) reported identical zone of inhibition (12.00 mm) for methanol
extracts of Parmotrema tinctorum.
The antibacterial activity of crude methanolic extract of selected species
proved tremendously effective against Gram+ve and Gram-ve bacterial
strains. The crude methanolic extract of Flavoparmelia caperata and
Rhizocarpon viridiatrum showed maximum zone of inhibition (12.33 mm)
against Gram-ve E. coli (ATCC_39111). Aslan et al. (2006) also recorded
zone of inhibition within range of 4.0 mm to 19.00 mm for methanol
extracts of Cladonia foliacea, Evernia divaricate, Evernia prunastri and
Neofuscella pulla.
The methanolic extracts of Flavoparmelia caperata showed maximum zone of
inhibition (10.33 mm) aganist Bacillus subtilis. Stojanovic et al. (2013)
reported slightly higher zone of inhibition (15.7 mm) for methanol extracts
of Parmelia sulcata against Bacillus subtilis. Maximum zone of inhibition
(10.66 mm) against Enterococcus faecalis (ATCC -19433) were recorded for
Collema flaccidum, Lecanora allophana and Caloplaca decipines (10.66 mm).
There exists compatibility in the activity of methanolic extracts against E.
286
faecialis of various lichen species reported in the studies of Devi et al. (2011)
and Chauhan and Abraham (2013). Similary, maximum zone of inhibition
(12.33 mm) against Gram-ve P. aeruginosa (ATCC_10145) was recorded for
methanolic extract of Flavoparmelia caperata. Similar results were reported
for extracts of species Alectoria sarmentose, Bryoria fuscescens, Evernia
divaricate, Platismatia glauca Ramalina farinacea and Parmotrema sp.
(Cobanoglu et al., 2010; Chauhan and Abraham, 2013). The methanolic
extract of Flavoparmelia caperata exhibited maximum zone of inhibition
(09.66 mm) against Gram+ve S. aureus (ATCC_33591). Similar, antibacterial
effectiveness were reported for methanolic extract of four lichen species
against S. aureus in various investigations (Chauhan and Abraham, 2013;
Abuiraq et al., 2015).
The present study also investigated the antifungal activities of crude
acetonic and methanolic extracts of ten species against four fungal strains;
A.niger (ATCC_16888), A.fumigatus (ATCC_16424), F.solani (ATCC_46492)
and F. oxyporium (ATCC_10913). Almost all fungal strains were vulnerable
to crude acetonic and methanolic extracts of lichens except Peltigera
polydactylon and Collema flaccidum. However, contrary to present study,
remarkable antifungal activity of Peltigera polydactylon crude extracts was
observed against Candida albicans in previous study (Shrestha et al., 2015).
Crude acetonic extracts of Lecanora allophana manifested maximum activity
(11.33 mm) against A. niger (ATCC_16888). Devi et al., 2016 recorded no
activity for the methanolic extract of Ramalina conduplicans against A. niger.
Maximum zones of inhibition (11.33 mm) against A. fumigatus
(ATCC_16424) were recorded for Flavoparmelia caperata and Caloplaca
decipines. In the study of Rankovic and Misic (2007), significant activity
(11.0 mm) was recorded for ethyl acetate extracts of lichen species Alectoria
sarmentosa against the above fungal species. In case of F.solani
(ATCC_46492), maximum zone of inhibition (10.66 mm) was shown by
287
crude acetone extract of Lecanora allophana. Chauhan and Abraham (2013)
also recorded zone of inhibition (22.66 mm) for methanol extracts
Parmotrema sp. against Fusarium sp. Similarly, crude acetonic extracts of
Flavoparmelia caperata showed maximum zone of inhibition (10.0 mm)
against F. oxyporium (ATCC_10913). Almost similar results were reported
by Rankovic and Misic (2007) for crude ethyl acetate extracts of lichen
species Cladonia rangiferina with comparable zones of inhibitions (12.0 mm).
Furthermore, crude methanolic extracts of Lecanora allophana and
Flavoparmelia caperata showed maximum zones of inhibition (10.66 mm
each) against A. niger (ATCC_16888) and A. fumigatus (ATCC_16424),
respectively. Rankovic et al. (2010) also reported 7.0 mm and 6.0 mm zone
of inhibition for extract of Ochrolechia tartarea and Parmelia centrifuga
against A. niger. In crude methanolic extracts against F. oxysporium
(ATCC_10913), maximum zone of inhibition was shown by Flavoparmelia
caperata and Flavopunctelia flaventior (9.66 mm). In addition, crude
methanolic extracts of Lecanora allophana and Caloplaca decipines manifested
maximum zone of inhibition (9.00 mm) against F. solani (ATCC_46492).
Almost identical zone of inhibition (08.0 mm) was reported for the aqueous
extract of Alectoria sarmentosa (Rankovic and Misic, 2007).
Brine shrimp lethality assay in present study was carried out to evaluate
the potential effects of ten selected species of lichens. In acetone extract of
concentrations 0.05mg/mL, 0.01mg/mL and 0.001mg/mL, maximum
mortalities of 60%, 40% and 30%, respectively were shown by Flavopunctelia
flaventior. In the crude methanol extract of concentration 0.05mg/mL,
maximum mortality of 53% (LC50 45.01 mg/mL) was shown by lichen
species Flavoparmelia caperata, while in extract of concentration 0.01mg/mL,
maximum mortality (40%) was shown by Flavopunctelia flaventior. For
extract of concentration 0.001mg/mL, maximum mortality (30%) was
shown by Flavopunctelia flaventior. Similar results were reported for
288
methanolic extracts of lichens Heterodermia sp., Ramalina sp. and
Everniastrum cirrhatum, which showed comparable toxic effects on A. salina
(Paudel et al., 2012; Kekuda et al., 2012).
Until now, only limited data is available about anticarcinogic activity of
lichens. However, according to some investigations, lichen species exert
significant antitumor effects on human and animal (Bezivin et al., 2003;
Triggiani et al., 2009). Out of ten species screened for antitumor activity in
current study, the crude methanolic extracts of eight lichen species and
crude acetone extracts of nine species manifested antitumor potential of
variable ranges at concentrations of 0.05mg/ml, 0.01mg/ml, and
0.001mg/ml. According to this study, lichens can be good lead for
antitumor applications as this capacity is pertinent to other studies (Bezivin
et al., 2003). Crude acetonic and methanolic extracts of Flavoparmelia caperata
induced maximum antitumor activity while extracts of Caloplaca decipines
did not showed any antitumor activity. Crude acetonic extracts of the
selected species showed higher degree of anticancer activity as compared
to crude methanolic extracts of the same species. Crude acetone extracts of
selected lichens at concentration of 0.05mg/ml induced variable range
(40%) of antitumor activity from lichen species Flavoparmelia caperata,
followed by Rhizocarpon viridiatrum (39%), Dermatocarpon miniatum (38%),
Flavopunctelia flaventior (36%), Peltigera polydactylon (34%) and Usnea
fulvoreagens (29%). While in the extracts of 0.01 mg/mL, maximum activity
was shown by Rhizocarpon viridiatrum (33%), followed by Peltigera
polydactylon, Flavopunctelia flaventior (23%) and Usnea fulvoreagens (20%).
Similarly, in extracts of concentration of 0.001 mg/mL, maximum activity
(34%) were recorded for lichen species Flavoparmelia caperata, followed by
Rhizocarpon viridiatrum (29%), Dermatocarpon miniatum (26%) and Peltigera
polydactylon, Flavopunctelia flaventior (20%).
289
The crude methanol extracts of selected lichen species at 0.05mg/mL
concentration manifested comparable antitumor activity of 38% for
Flavopunctelia flaventior, followed Flavoparmelia caperata, Rhizocarpon
viridiatrum (37%), Peltigera polydactylon (30%) and Dermatocarpon miniatum,
Usnea fulvoreagens (28%). In addition, at concentrations (0.01mg/mL),
maximum antitumor activity (31%) was recorded for extracts of
Flavoparmelia caperata, followed by Flavopunctelia flaventior (30%),
Rhizocarpon viridiatrum (25%) and Usnea fulvoreagens (20%). Finally, at lower
concentration of 0.001mg/mL, maximum activity (27%) was shown by
Flavopunctelia flaventior.
In current study antioxidant potential of ten selected lichen species was
adopted to assess their significance in biomedical applications. The tested
lichen extracts demonstrated a strong antioxidant potential against DPPH
oxidative system in-vitro. In the screened lichen extracts, the percentage
inhibition of DPPH increased with increase in concentration of crude
extracts. As far as maximum and minimum range of percentage inhibition
of each extract is concerned, crude acetone extract of 1000 ug/mL
manifested DPPH radical scavenging activity in the range of 17%-66%,
while crude methanolic extract of 1000ug/mL showed percentage
inhibition in the range of 26%-57%. The strongest DPPH radical scavenging
activity (66%) was shown by Cladonia pyxidata and minimum activity (17%)
was shown by Caloplaca decipines. With the increase in the concentration of
extracts, DPPH radical scavenging activity was also increased. In a study
conducted by Gulcin et al. (2002), the antioxidant activity of Cetraria
islandica was evaluated and aqueous extracts of this species showed
significant DPPH radical scavenging activity. In the concentration of
500ug/mL, the lichen species Rhizocarpon viridiatrum showed 63% and
Caloplaca decipines showed 12% DPPH radical scavenging activity. While in
concentration of 250 ug/mL, Rhizocarpon viridiatrum showed 56% activty
290
and Flavopunctelia flaventior showed 22%, while Caloplaca decipines showed
no activity. Similarly, in concentration of 125ug/mL, maximum activity
(49%) was shown by Rhizocarpon viridiatrum, while Flavopunctelia flaventior
and Caloplaca decipines showed 20% and no activity, respectively. Kosanic et
al. (2014) reported the antioxidant activity of acetone extract of lichen
species Lecanora muralis, L. atra, Cladonia furcata and found highest
antioxidant activity (90.08%) for lichen Lecanora atra.
In methanolic extracts of concentration 1000ug/mL, 57% DPPH radical
scavenging activity was recorded for lichen species Rhizocarpon viridiatrum,
while Collema flaccidum and Usnea fulvoreagens showed 26% activity each.
While in extract of concentration 500ug/mL, 55% activity was recorded for
each Rhizocarpon viridiatrum and Peltigera polydactylon, while Collema
flaccidum showed 19% activity. Similarly, in extracts of concentration
250ug/mL, Peltigera polydactylon showed 51% DPPH radical scavenging
activity, while Caloplaca decipines and Collema flaccidum showed 13% activity
each. In concentration of 125ug/mL, maximum activity (44%) was
recorded by Rhizocarpon viridiatrum and minimum activity (8%) was shown
by Usnea fulvoreagens, while Caloplaca decipines didn’t show any activity.
Kosanic et al. (2011) and Manojlovic et al. (2011) have also worked on the
antioxidant activities of some lichen species. Their studies reported a
maximum DPPH radical scavenging activity of 69.87% for methanol
extracts of lichen species Lasallia pustulata and while 51% activity was
observen in case of Toninia candida.
291
CONCLUSION
The District Mansehra shows remarkably high lichen diversity and 110
lichen species are documented distributed in 56 genera and 27 families.
Parmeliaceae with 12 genera (10.90%) is the largest family while the
remeaning families have 1-7 genera per family. Substrate-wise, 43 species
are found on bark of trees while in various habitat corticolous lichens with
55 lichen species show their dominace in the study area. There is need to
give attention to this major group of lower plants.
The maximum antibacterial activity of crude aceton extracts are recorde for
lichen species Flavoparmelia caperata, Lecanora allophana and Cladonia
pyxidata with a maximum zone of inhibition (12.66 mm) while in crude
methanol extracts maximum zone of inhibition (12.33 mm) are show by
lichen species Flavoparmelia caperata and Rhizocarpon viridiatrum. In
addedtion, maximum antifungal activity of crude acetone extracts are
shown by lichen species Caloplaca decipine and Flavoparmelia caperata (11.66
mm) while for methanol extracts maximum activity are shown by
Flavoparmelia caperata and Lecanora allophana (10.66 mm). The highest
percent free radical scavenging activity for crude acetone extract is shown
by Cladonia pyxidata (66%) while highest antioxidant activity of crude
methanol extracts is shown by Rhizocarpon viridiatrum l (57%). Maximum
cytotoxic effect of crude acetone extract is recorde for (concentration of
0.05mg/mL) Flavopunctelia flaventior (60%) while maximum cytotoxic effect
of crude methanol extract is show by (0.05mg/mL) Flavoparmelia caperata
(53%). The highest antitumor activity of crude acetone extract of
Flavoparmelia caperata is 40% while crude methanol extract of lichen species
Flavopunctelia flaventior demonstrate maximum antitumor potential (38%).
Thus, further study is needed to mark the chemical constituent of the
extract from lichen species.
292
RECOMMENDATIONS
The following suggestions are recommending in order to further studies
and in the view of conservation of the taxa:
1. Further studies should be done in order to assess the unexplored
lichens diversity of Hazara Division.
2. Taxanomic studies and distribution of lichen taxa should be done
especialy in Hazara division and Pakistan.
3. Further study should be done in order to identify the algal or
cyanbacterial symbiots of lichens diversity of Hazara Division.
4. Molecular studies of the lichen taxa should be carried out in order to
authenticity of idenfication of lichen flora of Hazara Division and
Pakistan.
5. Crude extracts tested lichen species posses compunds with
antibacterial, antifungal, antioxidant, cytotoxicity and antitumor
activities which require further investigation to determine the
compunds for treatment of diseases in plants and human.
293
REFFRENCES
Abuiraq, L., G. Kanan, M. Wedyan and A. El-Oqlah. 2015. Efficacy of
Extracts of Some Lichens for Potential Antibacterial Activity. Res. J.
Pharm. Biol. Chem. Sci., 6(1): 318-331.
Ahmadjian, V. 1993. The Lichen Symbiosis. John Wiley and Sons, New York.
Alexeeva, N. 2005. Lichens from Islands in the Russian part of the Gulf of
Finland. Folia Cryptogamica Estonica, 41: 5–12.
Anonymous. 1998. District census report of Mansehra. 1-1.
Anonymous. 2005. Mapping and documentation of the cultural assets of
Kaghan Valley, Mansehra. United Nations Educational, Scientific and
Cultural Organization, Islamabad.
Anonymous. 2011. Archeological exploration in Balakot, District Mansehra
(2006-2007): A Preliminary Report. Pakistan Heritage, 3: 149-160.
Ali, S. I. 1978. The Flora of Pakistan: some general and analytical remarks.
Notes Roy. Bot. Gard. Edinb., 36: 427-439.
Ali, S.I. and M. Qaiser (Eds.). 1995-2012. Flora of Pakistan. University of
Karachi, Karachi.
Almborn, O. 1989. Revision of the lichen genus Teloschistes in central and
southern Africa. Nordic J. Bot., 8(5):521-537.
Anjali, D. B., S. Mohabe, A. M. Reddy and S. Nayaka. 2015. Antimicrobial
activities of 2-propanol crude extract from lichen Parmotrema
tinctorum (Despr. ex. Nyl.) Hale, collected from Eastern Ghats, India.
Curr. Res. Environ. Appl. Mycol., 5(3): 160-168.
Anne, G. K. 1998. Distribution and diversity of alpine lichens: biotic and
abiotic factors influencing alpine lichen communities in the
northeast Olympic and North Cascade Mountains. Ph.D Thesis,
Department of Botany, Univ., of Washington, USA.
294
Aptroot, A. 2001. Lichens from Gambia, with a new black-fruiting isidiate
Caloplaca on savannah trees. Cryptogam., Mycol., 22: 265–270.
Aptroot, A. and F. J. Feijen. 2002. Annotated checklist of the lichens and
lichenicolous fungi of Bhutan. Fungal Divers., 11: 21-48.
Aptroot, A. and S. H. Iqbal. 2012. Annotated checklist of Lichen of
Pakistan, with report of new record. Herzogia, 25(2): 211-229.
Armstrong, R. A and A. R. Welch. 2007. Review article; Competition in
lichen communities. Symbiosis, 43: 1–12.
Aslan, A., M. Gulluce, M. Sokmen, A. Adiguzel, F. Sahin and H. Ozkan.
2006. Antioxidant and Antimicrobial Properties of the
Lichens Cladonia foliacea, Dermatocarpon miniatum, Everinia
divaricata, Evernia prunastri and Neofuscella pulla. Pharmaceutical
Biology, 44(4):247–252.
Awan, M. S., Z. Iqbal, S. M Shah, Z. Jamal, G. Jan, M. Afzal, A. Majid and
A. Gul. 2011. Studies on traditional knowledge of economicaly
important plants of Kaghan valley, Mansehra District, Pakistan. J.
Med. Plants Res., 5(16): 3958-3967.
Awasthi, D. D. 1965. Catalogue of the lichen from India, Nepal, Pakistan and
Ceylon. J. Cramer.
Awasti, D. D. 1988. A Key to Macrolichens of India and Nepal.
J. Hattori Bot. Lab., 65: 207-302.
Awasti, D. D. 1990. A Key to Microlichens in India, Nepal and Sri Lanka.
Bibl. Lichenol., 40: 1-336.
Aydin, E. and H. Turkez. 2011. Antioxidant and genotoxicity screening of
aqueous extracts of four lichens collected from North East Anatolia.
Fresen. Environ. Bull., 20 (8a): 2085 – 2091.
295
Aydin, S. and K. Kinalioglu. 2013. The Investigation of Antibacterial
Activities of Ethanol and Methanol Extracts of Flavoparmelia caperata
(L.) Hale (Parmeliaceae) and Roccella phycopsis Ach. (Roccellaceae)
Lichens Collected from Eastern Black Sea Region, Turkey. J. appl.
Pharm. Sci., 3 (02): 143-147.
Backorova M., B. M. Mikes, R. J. Jendze, R. lovsky and P. Fedorocko. 2011.
Variable responses of different human cancer cells to the lichen
compounds parietin, atranorin, usnic acid and gyrophoric acid.
Toxicol. In vitro, 25(1): 37-44.
Balaji, P. and G. N. Hariharan. 2013. Checklist korovitych lisejniku pohori
Siruvani Hills (Bolampatti II Forest Range) v Zapadnim Ghatu, stat
Tamil Nadu, India. Czech. Mycol.., 65(2): 219–232.
Balaji, P., P. Bharath, R. S. Satyan and G. N. Hariharn. 2006. In vitro
antimicrobial activity of Roccella montagnei thallus extract. J. Trop.
Med. Plants 7(3): 169-173.
Baral, B. 2015. Enumeration of lichen diversity in Manaslu conservation
area and Sagarmatha national park of Nepal. Int. J. Biodivers., 7(3):
140-147.
Baral, B. and B. L. Maharjan. 2011. Assessment of antimicrobial and
phytochemical potential of high altitude Nepalese lichen. J.
Microbiol. Biotechnol. Food Sci., 1(2): 98-112.
Basile, A., D. Rigano, S. Loppi, A. Santi, A. Nebbioso, S. Sorbo, B. Conte, L.
Paoli, F. Ruberto, A. M. Molinari, L. Altucci and P. Bontempo. 2015.
Antiproliferative, Antibacterial and Antifungal Activity of the
Lichen Xanthoria parietina and its secondary metabolite Parietin. Int.
J. Mol. Sci., 16: 7861-7875.
296
Begerow, D., H. Nilsson, M. Unterseher and W. Maier. 2010. Current state
and perspectives of fungal DNA barcoding and rapid identification
procedures. Appl. Microbiol. Biotechnol., 87(1): 99-108.
Bezivin, C., S. Tomasi, F. Devehat and C. Boustie. 2003. Cytotoxic activity
of some lichen extracts on murine and human cancer cell lines.
Phytomed., 10: 499-503.
Blaxter M, J. Mann, T. Chapman, F. Thomas, C. Whitton, R. Floyd and E.
Abebe. 2005. Defining operational taxonomic units using DNA
barcode data. Philos. Trans. R. Soc. Lond. B. Biol. Sci., 360(1462): 1935-
43.
Blazekovic, B., G. Stanic, S. Pepeljnjak and S. Vladimir-Knezevic. 2011. In
Vitro Antibacterial and Antifungal Activity of Lavandula ×
intermedia Emeric ex Loisel. `Budrovka’. Molecules, 16: 4241-4253.
Blinkova, O. and G. Urbanavichus. 2005. Ecological analysis of lichens in
the Teberda State Biosphere Reserve (North-Western Caucasus,
Russia). Folia. Cryptogam. Est., 41: 23–35.
Boustie, J., S. Tomasi and M. Grube. 2011. Bioactive lichen metabolites:
alpine habitats as an untapped source. Phytochem. Rev., 10: 287-307.
Boustie J. and Grube M. 2005. Lichens? A promising source of bioactive
secondary metabolites. Plant Genet. Resour., 3(2): 273-287.
Burkholder, P. R, A. W. Evans, I. Mcveigh and H. K. Thornton. 1944.
Antibiotic Activity of Lichens. Proc. Natl. Acad. Sci. U.S. A., 30, 250-5.
Butler, N. J. 1950. A guide to the collections of botanical specimens. Tuatara.
3(2): 67-77.
Caldiz, M. S. 2005. Diversity and growth of epiphytic macrolichens in
northwestern Patagonian Nothofagus forests. Ph. D Thesis, Southern
Swedish Forest Research Centre, Swedish Univ. of Agricultural
Sciences, Alnarp.
297
Candana, M., M. Yılmaza, T. Tayb, M. Kıvanc and H. Turk. 2006.
Antimicrobial Activity of Extracts of the Lichen Xanthoparmelia
pokornyi and its Gyrophoric and Stenosporic Acid Constituents. Z.
Naturforsch., 61c: 319-323.
Chahra, D., M. Ramdani, T. Lograda, P. Chalard and G. Figueredo. 2016.
Chemical composition and antimicrobial activity of Evernia prunastri
and Ramalina farinacea from Algeria. Issues Biol. Sci. Pharma. Res.,
4(5): 35-42.
Chauhan, R. and J. Abraham. 2013. In Vitro Antimicrobial Potential of the
Lichen Parmotrema sp. extracts against various pathogens. Iran. J.
Basic Med. Sci., 16(7): 882–885.
Cobanoglu, G. and O. Sevgi. 2009. Analysis of the distribution of epiphytic
lichens on Cedrus libani in Elmali Research Forest (Antalya,
Turkey). J. Environ. Biol., 30(2): 205-212.
Cobanoglu, G., C. Sesal, B. Gokmen and S. Cakar. 2010. Evaluation of the
antimicrobial properties of some lichens. South-west J. Hortic. Biol.
Environ., 1(2): 153 – 158.
Cocchietto, M., N. Skert, P. Nimis and G. Sava. 2002. A review on usnic
acid, an interesting natural compound. Naturwissenschaften, 89: 137-
146.
Culberson, C. F. 1972. Improved condition and new data for identification
of lichen product by standardized thin layer chromatographic
method. J. Chromatogr., 72: 113-125.
Culberson, C. F. and H. Kristinsson. 1970. A standardized method for
identification of lichen product. J. Chromatogr., 46: 85-93.
Desbenoit, B., E. Galin and S. Akkouche. 2004. Simulating and modeling
lichen growth. Comput. Graph. Forum., 23: 341-350.
298
Devi, G. K., P. Anantharaman, K. Kathiresan and T. Balasubramanian.
2011. Antimicrobial activity of lichen Rocella belangeriana (Awasti)
from mangroves of Gulf of Mannar. Indian J. Mar. Sci., 40(3): 449-
453.
Devkota, O. 2008. Taxonomic study of lichens of Phulchowki hills, Lalitpur
District (Kathmandu valley). Sci. World J., 6 (6): 44-51).
Dey, A. K., G. K. Mishra, J. Rout and D. K. Upreti. 2015. An enumeration of
epiphytic lichens from Hojai sub-division of Nagaon district, Assam,
India. Int. J. Adv. Res. Biol. Sci., 2(10): 111–115.
Dietrich, M. and C. Scheidegge. 1997. Frequency, diversity and ecological
strategies of epiphytic lichens in the Swiss Central Plateau and the
Pre-Alps. Lichenologist 29: 237–258.
Divakar, P. K., A. Crespo, O. Blanco, H. T. Lumbsch. 2006. Phylogenetic
significance of morphological characters in the tropical
Hypotrachyna clade of parmelioid lichens (Parmeliaceae,
Ascomycota). Mol. Phylogenet. Evol., 40: 448–458.
Dorszynska, M. M., G. Wezgrzyn and B. G. Krzeminska. 2014. Antibacterial
activity of lichen secondary metabolite usnic acid is primarily
caused by inhibition of RNA and DNA synthesis. FEMS Microbiol.
Lett., 353 (1): 57–62.
Elix, J. A. 2014. A Catalogue of Standardized Chromatographic Data and
Biosynthetic Relationships for Lichen Substances, (3rd Ed) Canberra.
Emsen, B., A. Aslan, B. Togar, H. Turkez. 2015. In Vitro Antitumor
Activities of the Lichen Compounds Olivetoric, Physodic and
Psoromic Acid in Rat Neuron and Glioblastoma Cells. Pharm. Biol.,
54 (9): 1748-1762.
Esimone, C. O. and M. U. Adikwu. 1999. Antimicrobial activity and
cytotoxicity of Ramalina farinacea. Fitoterpia., 70(4): 428-437.
299
Farkas, V. 2003. Structure and biosynthesis of fungal cell walls:
Methodological approaches. Folia Microbiol., 48: 469–478.
Francolini, I., P. Norris, A. Piozzi, G. Donelli and P. Stoodley. 2004. Usnic
acid, a natural antimicrobial agent able to inhibit bacterial biofilm
formation on polymer surfaces. Antimicrob. Agents Chemothe.,. 48:
4360-4365.
Friedel, T and B. Budel. 2008. Photobiont. In: Nash T. H (Ed) Lichen Biology.
Cambridge University Press, Cambridge, pp 9-26.
Galun, M. 1988. CRC handbook of Lichenology. Vol. III, 95-107, CRC Press,
Boca Raton, Florida.
Gardes, M. and T. D. Bruns. 1993. ITS primers with enhanced specificity for
basidiomycetes--application to the identification of mycorrhizae and
rusts. Mol. Ecol., 2(2):113-8.
Geiser, L. H., S. E. Jovan, D. A. Glavich and M. K. Porter. 2010. Lichen-
based critical loads for atmospheric nitrogen deposition in Western
Oregon and Washington Forests, USA. Environ. Pollut., 158: 2412-
2421.
Gilbert, O. 2004. Lichens (Naturally Scottish). Scottish Natural Heritage.
Goni, R. and N. Sharma. 2015. Additions to lichen flora of Jammu and
Kashmir, India. Trop. Plant Resh., 2(2): 78–81.
Green, T. G. A., J. Horstman, H. Bonnett, A. Wilkins and W. Silvester. 1980.
Nitrogen fixation by members of the Stictaceae (Lichens) of New
Zealand. New Phytol., 84(2): 339-48.
Grujicic, D., I. Stosic, M. Kosanic, T. Stanojkovic, B. Rankovic, O. M.
Djordjevic. 2014. Evaluation of in vitro antioxidant, antimicrobial,
genotoxic and anticancer activities of lichen Cetraria islandica.
Cytotechnology, 66(5): 803-813.
300
Gupta, S., H. Rai, D. K. Upreti, P. K. Sharma and R. K. Gupta. 2016. New
addition to the Lichen flora of Uttarakhand, India. Trop. Plant Resh.,
3(1): 224–229.
Gupta, S., R. Khare, H. Rai, D. K. Upreti, R. K. Gupta, P. K. Sharma, K.
Srivastava and P. Bhattacharya. 2014. Influence of macro-scale
environmental variables on diversity and distribution pattern of
lichens in Badrinath valley, Western Himalaya. Mycosphere. 5(1):
229–243.
Gulcin, I., M. Oktay, O. I. Kufrevioglu and A. Aslan. 2002. Determination of
antioxidant activity of lichen Cetraria islandica. J. Ethnopharmacol.,
79: 325-329.
Guvenc, S., S. Oran and S. Ozturk. 2009. The Epiphytic Lichens on
Anatolian Black Pine Pinus nigra Arnd. subsp. pallasiana (Lamb.)
Holmboe in Mt. Uludag (Bursa, Turkey). J. Appl. Biol. Sci., 3(2): 157-
161.
Halama, P., and C. V. Haluwin. 2004. Antifungal activity of lichen extracts
and lichenic acids. Biol. Control. 49 (1): 95–107.
Halcomb, H. 2010. Lichens. The University of Tennesse.
Halici, M. G. and A. Aksoy. 2006. Saxicolous and Tericolous lichens of
Sirvan mountain (Pinarbasi, Kayseri). Turk. J. Bot., 30: 477-481.
Halici, M. G., V. John and A. Aksoy. 2005. Lichens of Erciyes Mountain
(Kayseri, Turkey). Fl. Medit., 15: 567-580.
Hansen, E. S. 2009. Lichens from Johannes V. Jensen Land, N Greenland,
the northernmost arctic land area. Willdenowia, 39: 179–186.
Hansen, E. S. 2007. Lichen from Saqqaq and Qeqertaq central west
Greenland. Folia Cryptog. Estonica, 43: 1-12.
301
Haq, M. U., Z. A. Reshi, D. K. Upreti and M.A. Sheikh. 2012. Lichen wealth
of Jammu and Kashmir- A promising plant source for
Bioprospection. Life Sci. J., 4: 926-929.
Hara, K., M. Endo, H. Kawakami, M. Komine and Y. Yamamoto. 2011.
Anti-oxidation activity of ethanol extracts from natural thalli of
lichens. Mycosystema, 30(6): 950-954.
Hawksworth, D. L. and T. Mahmood. 1971. Some lichens coniferous forest
in West Pakistan. Pak. J. Sci. Ind. Res., 12 (1-2): 113-115.
Herrera, M., R. Lucking, R. E. Perez, A. Campos, P. Martinez, and A.
Barcenas. 2004. The folicolous lichen flora of Mexico. V.
Biogeographical affinities, altitudinal preferences, and an updated
checklist of 293 species. Lichenologist, 36: 309–327.
Huneck, S. 1999. The significance of lichens and their metabolites.
Naturwissenschaften.86 (2): 559-570.
Hussain, F. and I. Ilahi. (1991). Ecology and Vegetation of Lesser Himalayas,
Pakistan. Department of Botany University of Peshawar, Pakistan.
Jadoon Printing Press, Peshawar.
Idamokoro, E. M., P. J. Masika, V. Muchenje, D. Falta and E. Green. 2014.
In-vitro antibacterial sensitivity of Usnea barbata lichen extracted
with methanol and ethyl-acetate against selected Staphylococcus
species from milk of cows with mastitis. Arch. Tierz., 57(25): 1-9
Javeria, S., S. K. Shahi, M. P. Shahi, and D. K. Upreti. 2013. Parmotrema
nilgherrense: potential antimicrobial activity against drug resistant
pathogens. Int. J. Microbial. Resource Technol., 2(1): 36-40.
Jesus, E. E., J. S. Hur, K. I. R. Notarte, K. A. A. Santiago and C. Tee. 2016.
Antibacterial, antioxidant, and cytotoxic activities of the corticolous
lichens Canoparmelia aptata, Pannaria sp., and Parmotrema gardneri
302
collected from Mt. Banahaw, Quezon, Philippines. Curr. Res.
Environ. Appl. Mycol., 6(3): 173–183.
Jönsson, M. T., G. Thor and P. Johansson. 2011. Environmental and
historical effects on lichen diversity in managed and unmanaged
wooded meadows. Appl. Veg. Sci., 14(1): 120–131.
Juriado, I., J. Paal and J. Liira. 2003. Epiphytic and epixylic lichen species
diversity in Estonian natural forests. Biodivers. Conserv., 12(8): 1587–
1607.
Kaffer, M. I., R. V. Dantas and S. M. A. Martins. 2016. Characterization of
the epiphytic lichen vegetation in a riparian forest in southern
Brazil. Plant Ecol. Evol., 149 (1): 92–100.
Kantvilas, G., J. A. Elix and S. J. Jarman. 2008. A contribution to an
inventory of lichens from South Sister, northeasternTasmania. Pap.
Proc. R. Soc. Tasmania, 142(2): 49-60.
Karabulut, G. and S. Ozturk. 2015. Antifungal activity of Evernia prunastri,
Parmelia sulcata, Pseudevernia furfuracea var. furfuracea. Pak. J. Bot.,
47(4): 1575-1579.
Karagoz, A., N. Doruoz, Z. Zeybek and A. Aslan. 2009. Antibacterial
activity of some lichen extracts. J. Med. Plants Res., 3(12): 1034-1039.
Karthikaidevi, G., G. Thirumaran, K. Manivannan, P. Anantharaman, K.
Kathiresan and T. Balasubaramanian. 2009. Screening of the
Antibacterial Properties of Lichen Roccella belangeriana (Awasthi)
from Pichavaram Mangrove (Rhizophora Sp.). Adv. Biol. Res., 3 (3-4):
127-131.
Karunaratne., V. K. Bombuwella, S. Kathirgamanather and V. M. Thadhani.
2005. Lichen: A Chemically important Biota. J. Natl. Sci. Found Sri.,
33(3): 169-186.
303
Kasimogullari, S. C., S. Oran, F. Ari, E. Ulukaya, N. Aztopal, M.
Sarimahmut and S. Ozturk. 2014. Genotoxic, cytotoxic, and
apoptotic effects of crude extract of Usnea filipendula Stirt. in vitro.
Turk. J. Biol., 38: 940-947.
Kekuda, P., T. Ramanoorthy, H. Raghavedra, L. Shitty, S. Devidas, V. T.
Mudduray and K. S. Vinayaka. 2012. Antifungal and cytotoxic
activity of Everniastrum cirrhatum (fr) Hale. Chiang Mai J. Sci., 39(1):
76-83.
Khan, S. I., A. K. Raina and D. K. Upreti. 2010. Enumaration and
distribution of lichen in Surankot, District Poonch, J and K (India).
Environ. Cons., 11(3): 27-31.
Killmann, D. and E. Fischer. 2005. New records for the lichen flora of
Rwanda, East Africa. Willdenowia, 35(1): 193-204.
Kelly, L. J., P. M. Hollingsworth, B. J. Coppins, C. J. Ellis, P. Harrold and J.
Tosh. 2011. DNA barcoding of lichenized fungi demonstrates high
identification success in a floristic context. New Phytologist, 191: 288–
300.
Kirk, P., P. Cannon, D. Minter and J. Stalpers. 2008. Dictionary of Fungi, (10th
Ed). CABI Europe, Oxford.
Knudsen, K. K., M. Harding and J. Hoines. 2013. The Lichen Flora of Joshua
Tree National Park An Annotated Checklist. Natural Resource
Technical Report NPS/JOTR/NRTR—2013/743
Kosanic, M. and B. Rankovic. 2010. Screening of Antimicrobial Activity of
Some Lichen species In Vitro. Kragujevac J. Sci., 32: 65-72.
Kosanic, M., B. R. Rankovic and T. P. Stanojkovic. 2012. Antioxidant,
antimicrobial and anticancer activities of three Parmelia species. J.
Sci. Food Agric., 92(9): 1909-1916.
304
Kosanic, M., D. Seklic, S. Markovic and B. Rankovic. 2014. Evaluation of
antioxidant, antimicrobial and anticancer properties of selected
lichens from Serbia. Dig. J. Nanomater. Biostruct., 9(1): 273–287.
Kosanic, M., N. Manojlovic, S. Jankovic, T. Stanojkovic and B. Rankovic.
2013b. Evernia prunastri and Pseudoevernia furfuraceae lichens and
their major metabolites as antioxidant, antimicrobial and anticancer
agents. Food Chem. Toxicol., 53: 112–118.
Kosanic. M., B. Rankovic and T. Stanojkovic. 2013a. Investigation of
selected Serbian lichens for antioxidant, antimicrobial and
anticancer properties. J. Anim. Plant Sci., 23(6): 1628-1633.
Kumar, J., H. Rai, R. Khare, D. K. Upreti, P. Dhar, A. B. Tayade, O. P.
Chaurasia and R. B. Srivastava. 2014a. Elevational controls of lichen
communities in Zanskar valley, Ladakh, a Trans Himalayan cold
desert. Trop. Plant Res., 1(2): 48–54.
Kumar, J., P. Dhar, A. B. Tayade, D. Gupta, O. P. Chaurasia and D. K.
Upreti. 2014b. Antioxidant Capacities, Phenolic Profile and
Cytotoxic Effects of Saxicolous Lichens from Trans-Himalayan Cold
Desert of Ladakh. PLoS ONE 9(6):
Kumar, B. 2010. Ecological, Social and Commercial Role of Lichens in India
with Special Reference to Garhwal Himalayas. Academ. Arena,
Supplement 0201.
Kumar, S. R., N. Thajuddin and C. Venkateswari. 2010. Antibacterial
activity of cyanolichen and symbiotic cyanobacteria against some
selected microorganisms. Afr. J. Microbiol. Res., 4(13): 1408-1411.
Kumar, S. R., N. Thajuddin and D. K. Upreti. 2011. Diversity of lichens in
Kollihills of Tamil Nadu, India. Int. J. Biod. Cons., 3(2): 36-39.
Kusumaningrum, I. K., W. P. Suwarso and A. H. Cahyana. 2011. Screening
for Bioactive compound Group in Parmotrema tinctorum’s Extract
305
and Bioactivity Test of Dichloromethane Extract as Anti-tuberculosis
against Mycobacterium tuberculosis H37RV and Toxicity against
Artemia salina. Sci. J. Ubu., 2(1):53–59.
Lauterwein, M., M. Oethinger, K. Belsner, T. Peters and R. Marre. 1995. In
vitro activities of the lichen secondary metabolites vulpinic acid, (+)-
usnic acid, and (-)-usnic acid against aerobic and anaerobic
microorganisms. Antimicrob. Agents Chemother., 39(11): 2541-2543.
Leavitt, S. D. and L. L. Clair. 2011. Estimating Xanthoparmelia
(Parmeliaceae) population density in subalpine communities in
southern Utah, USA using two distance methods, with implications
for assessing community composition. Bryologist, 114: 625-636.
Lendemer, J. C and B. P. Hodkinson. 2013. A radical shift in the taxonomy
of Lepraria s.I: molecular and morphological studies shed new light
on the evolution of asexuality and lichen growth form
diversification. Mycologia, 105(4): 994-1018.
Logesh, A. R., M. Chinlampianga, A. C. Shukla and D. K. Upreti. 2015.
Studies on Lichens of Mizoram, Northeast India. Proc. Natl. Acad.
Sci., India, Sect. B Biol. Sci. DOI 10.1007/s40011-015-0592-z
Luo, H., M. Ren, K. Lim, Y. J. Koh, L. S. Wang and J. S. Hur. 2006.
Antioxidative Activity of Lichen Thamnolia vermicularis in vitro.
Mycobiol., 34(3): 124-127.
Lutzoni, F and J. Miadlikowsk. 2009. Lichen. Quick Guide. Curr. Biol., 19:
502-503.
Madamombe, I. T. and A. J. Afolayan. 2003. Evaluation of antimicrobial
activity of extracts from African Usnea barbata. Pharm., Biol., 4(4):
199-202.
306
Manojlovic, N.T., S. Solujic and S. Sukdolak. 2002. Antimicrobial activity of
extract and anthraquinones from Caloplaca schaereri. Lichenologist 34:
83-85.
Manojlovic, N. T., P. J. Vasiljevic, P. Z. Maskovic. 2012. Chemical
composition and antioxidant activity of lichen Toninia candida. Rev.
Bras. Farmacogn., 22(2): 291-298.
Marmor, L., T. Torra, E. Leppik, L. Saag and T. Randlane. 2011. Epiphytic
lichen diversity in Estonian and Fennoscandian old coniferous
forests. Folia Cryptog. Estonica, 48: 31–43.
Matsunaga, K. K. S., R. A. Stockey and A. M. F. Tomescu. 2013.
Honeggeriella Complexa gen. et sp. nov., a heteromerous lichen
from the lower cretaceous of Vancouver Island (British Columbia,
Canada). Am. J. Bot., 100(2): 450-459.
Mazari, P., M. R Khan, M. A. Khan, K. Y. Khan, M. Zafar, B. Ali and R.
Niamat. 2012. Pollen fertility estimation of selected taxa of Kaghan
valley, Pakistan. Res. Plant Biol., 2(4): 16-21.
Mcmurray, J. A., D. W. Roberts, M. E. Fenn, L. H. Geiser and S. Jovan
(2013). Using Epiphytic Lichens to Monitor Nitrogen Deposition
near Natural Gas Drilling Operations in the Wind River Range, WY,
USA. Water Air Soil Pollut., 224: 1487.
Melo, M.G.D., A. A. S. Araújo, M. R. Serafini, L. F. Carvalho, M. S. Bezerra,
C. S. Ramos, L. R. Bonjardim, R. L. C. A. Junior, J. T. Lima, R. S.
Siqueira, V. S. Fortes, M. J. V. Fonseca and L. J. Q. Junior. 2011. Anti-
inflammatory and toxicity studies of atranorin extracted from
Cladina kalbii Ahti in rodents. Braz. J. Pharm Sci., 47(4): 861-872.
Mishra, G. K. and D. K. Upreti. 2016. Diversity and Distribution of Macro-
lichen in Kumaun Himalaya, Uttarakhand. Int. J. Adv. Res., 4(2): 912-
925.
307
Mitrovic, T., S. Stamenkovic, V. Cvetkovic, M. Nikolic, S. Tosic and D.
Stojicic. 2011a. Lichens as source of versatile bioactive compounds.
Biologica Nyssana, 2(1): 1-6.
Mitrovic. T., S. Stamenkovic, V. Cvetkovic, S. Tosic, M. Stankovic, I.
Radojevic, O. Stefanovic, L. Comic, D. Dacic, M. Curcic and S.
Markovic. 2011b. Antioxidant, Antimicrobial and Antiproliferative
Activities of Five Lichen Species. Int. J. Mol. Sci., 12(8): 5428-5448.
Molnar, K. and E. Farkas. 2010. Current result on Biological activities of
Lichen secondary compound; a Review. Z. Naturforsch. C Bio. Sci.,
65(3-4): 157-173.
Moniri, M. H., H. J. M. Sipman and M. Schultz. 2014. New Records of
Lichenized and Lichenicolous Fungi from Northeastern
Iran. Herzogia, 27(2): 367-376.
Muggia., L. I. Schmitt and M. Grube. 2009. Lichens as treasure chests of
natural products. SIM NEWS, 59: 85-97.
Nayaka, S. 2007. Diversity and distribution of lichens in Katarniaghat
Wildlife Sanctuary, Uttar Pradesh. 30th Botanical Conference of
Indian Botanical Society, at Jiwaji University, Gwalior.
Nayaka, S., D. K. Upreti and P. K. Divakar. 2001. Distribution and diversity
of lichens in Meghamalai Wildlife Sanctury, Kambam district, Tamil
Nadu, India. Biol. Memoirs., 27(2): 51–58.
Nayanakantha, N. M. C. and S. Gajameragedara. 2003. A survey of lichens
in the Kandy Municipal Region. Cey. J. Sci. (Bio. Sci.),1: 35–41.
Neeraj, V., B. C. Behera, H. Parizadeh, B. O. Sharma. 2011. Bactericidal
Activity of Some Lichen Secondary Compounds of Cladonia
ochrochlora, Parmotrema nilgherrensis & Parmotrema sancti-angelii. Int.
J. Drug Dev. Res., 3 (3): 222-232.
308
Negi, H. R. 2003. Lichens: A valuable Bio resource for environmental
Monitoring and sustainable development. Resonance, 8(1): 51-58.
Nguyen T. T, S. Yoon, Y. Yang, H. O. Lee and S. Oh. 2014. Lichen
Secondary Metabolites in Flavocetraria cucullata Exhibit Anti-Cancer
Effects on Human Cancer Cells through the Induction of Apoptosis
and Suppression of Tumorigenic Potentials. PLoS ONE 9(10):
e111575. doi:10.1371/journal.pone.0111575
Obermayer, W. 2004. Additions to the lichen flora of the Tibetan region.
Bibl. Lichenol., 88: 479-526.
Odabasoglu, F., A. Aslan, A. Cakir, H. Suleyman, Y. Karagoz, M. Halici
and Y. Bayir. 2004. Comparison of antioxidant activity and phenolic
content of three lichen species. Phytother. Res., 18(11): 938-41.
Okuyama E., K. Umeyama, M. Yamazaki, Y, Kinoshita and Y. Yamamoto.
1995. Usnic acid and diffractaic acid as analgesic and antipyretic
components of Usnea diffracta. Planta Med., 61(2): 113-115.
Orange, A., P.W. James and F. J. White. 2001. Micro-chemical Methods for the
Identification of Lichens. British Lichen Society, UK, 101pp.
Ozturk, S. and S. Guvence. 2010. The distribution of epiphytic lichens on
Uludag fir (Abies nordmanniana (Steven) Spach subsp. bornmuelleriana
(Mattf.) Coode and Cullen) forests along an altitudinal gradient (Mt.
Uludag, Bursa, Turky). Ekoloji, 19(74): 131-138.
Ozturk, S., S. Oran, S. Guvenc and N. Dalkiran. 2010. Analysis of the
distribution of epiphytic lichens in the oriental beech (Fagus
Orientalis Lipsky) forests along an altitudinal gradient in Uludag
Mountain, Bursa, Turkey. Pak. J. Bot., 42(4): 2661-2670.
Paksa, O and P. Skaloud. 2008. Change of Chloroplast structure in
Lichenized algae. Symbiosis, 46(3): 153-160.
309
Paudel, B., H. D. Bhattarai, D. P. Pandey, J. S. Hur, S. G. Hong, Chan Kim
and J. H. Yim. 2012. Antioxidant, Antibacterial activity and Brine
shrimp toxicity test of some mountainous lichens from Nepal. Biol.
Res., 45(4): 387-391.
Pinokiyo, A. and K. P. Singh. 2006. New species and new record of
foliicolous lichenized fungi from Sikkim (India). Mycotaxon. 97: 57-
61.
Pinokiyo, A., K. P. Singh and J. S. Singh. 2008. Diversity and distribution of
lichen in relation to altitude within a protected biodiversity hot spot,
north-east India. Lichenologist, 40: 47-62.
Pinokiyo, A., K. P. Singh and S. K. Borethakur. 2004. Foliicolous Species of
Porina (lichen) from Arunaehal Pradesh. J. Indian Forest. 27(4): 407-
416.
Pisutthanana, S., P. Plianbangchang, N. Pisutthanana, S. Ruanruaya and
O. Muanrita. 2004. Brine Shrimp Lethality Activity of Thai Medicinal
Plants in the Family Meliaceae. Naresuan Uni. J., 12(2): 13-18.
Pompilio, A., S. Pomponio, V. Di Vincenzo, V. Crocetta, M. Nicoletti, M.
Piovano, J. A. Garbarino and G. Di Bonaventura. 2013. Antimicrobial
and antibiofilm activity of secondary metabolites of lichens against
methicillin-resistant Staphylococcus aureus strains from cystic fibrosis
patients. Future microbiol., 8(2): 281-292.
Prabhu, S. S. and S. S. Sudha. 2015. Evaluation of the antibacterial
properties of some Lichen species against human pathogens. Int. J.
Adv. Res. Biol. Sci., 2(4): 177–181.
Quilhot, W., M. Cuellar, R. Diaz, F. Riquelme and C. Rubio. 2012. Lichens
of Aisen, Southern Chile. Gayana Bot., 69(1): 57-87.
310
Ramamoorthy, P. K. T., R. H. L. Shetty, S. Devidas, V. T. Mudduraj and K.
S. Vinayaka. 2012. Antifungal and Cytotoxic Activity of Everniastrum
cirrhatum (Fr.) Hale. Chiang Mai J. Sci., 39(1): 76-83.
Ramos, D. B. M., F. S. Gomes, T. H. Napoleao, P. M. G. Paiva, M. D. C. Silva
and L. C. B. B. Coelho. 2014. Antimicrobial Activity of Cladonia
verticillaris Lichen Preparations on Bacteria and Fungi of Medical
Importance. Chin. J. Biol. http://dx.doi.org/10.1155/2014/219392.
Rana, K., S. Nayaka, P. Shukla and D. K. Upreti. 2015. Notes on Occurrence
of Fruticose Lichens in Joram Top, Ziro Valley, Arunachal Pradesh
with 10 New Records to the State. Int. J. Sci. Res., 4(12): 999-1003.
Rankovic, B., M. Kosanic, T. Stanojkovic, P. Vasiljevic and N. Manojlovic.
2012. Biological activities of Toninia candida and Usnea barbata
together with their norstictic acid and usnic acid constituents. Int. J.
Mol. Sci., 13(11): 14707-14722
Rankovic, B and M. Misic. 2007. Antifungal activity of extract of lichens
Alectoria sarmentosa and Cladonia rangiferina. Mikol. Fitopatol., 41: 276–
81.
Rankovic, B. R., M. M. Kosanic and T. P. Stanojkovic. 2011. Antioxidant,
antimicrobial and anticancer activity of the lichens Cladonia furcata,
Lecanora atra and Lecanora muralis. BMC Complement. Altern. Med., 11:
97. doi: 10.1186/1472-6882-11-97
Rankovic, B., D. Rankovic and D. Maric. 2010. Antioxidant and
antimicrobial activity of some lichen species. Mikrobiologiya, 79(6):
809-815.
Rankovic, B., M. Kosanic and T. Stanojkovic. 2014. Stereocaulon paschal
lichens as antioxidant, antimicrobial and anticancer agent. Farmacia
62(2): 306-317.
311
Rankovic, B., M. Misic and S. Sukdolak. 2009. Antimicrobial activity of
extracts of the lichens Cladonia furcata, Parmelia caperata, Parmelia
pertusa, Hypogymnia physodes and Umbilicaria polyphylla. Biologia,
64(1): 53-58.
Ravaglia, L. M., K. Goncalves, N. M. Oyama, R. G. Coelho, A. A. Spielmann
and N. K. Honda. 2014. In vitro radical-scavenging activity, toxicity
against A. salina, and NMR profiles of extracts of lichens collected
from Brazil and Antarctica. Quim. Nova, 37(6): 1015-1021.
Redzic, S., S. Barudanovic and S. Pilipovic. 2010. Wild Mushrooms and
Lichens used as Human Food for Survival; Podrinje - in War
Conditions Zepa Region (Bosnia and Herzegovina, W. Balkan).
Hum. Ecol. Rev., 17(2): 175-187.
Rezanka, T. and V. M. Dembitsky. 2006. The colleflaccinosides, two chiral
bianthraquinone glycosides with antitumor activity from the lichen
Collema flaccidum collected in Israel and Russia. Nat. Prod. Res.,
20(10): 969-980.
Ribera, A. E and G. Zuniga. 2012. Induced plant secondary metabolites for
phytopatogenic fungi control: a review. J. Soil Sci. Plant Nutr., 12 (4):
893-911.
Rosabal, D., A. R. Burgaz and R. D. Masa. 2010. Diversity and distribution
of epiphytic macrolichens on tree trunks in two slopes of the
montane rainforest of Gran Piedra, Santiago de Cuba. Bryologist,
113(2): 313-321.
Rosato, V. G. 2006. Diversity and distribution of lichens on mortar and
concrete in Buenos Aires province, Argentina. Darwiniana, 44(1): 89-
97.
312
Rout, J. A., B. Singh and D. K. Upreti. 2012. Lichen flora on betel nut (Areca
catechu) palm tree from a pristine habitat in southern Assam, India.
Vegetos, 25(1): 198-201.
Rout, J., P. Das and D. K. Upreti. 2010. Epiphytic lichen diversity in a
Reserve Forest in southern Assam, northeast India. Trop. Ecol., 51(2):
281-288.
Saag, L., E. S. Hanen, A. Saag and T. Rindlane. 2007. Survey of lepraria and
Leprocaulon in Greenland. Mycotaxon, 102: 57-90.
Sanders, W. B. 2001. Interface between Mycology and Plant morphology.
Bioscience, 51(12): 1025-1036.
Santiago, K. A. A., J. N. C. Borricano, J. N. Canal1, D. M. A. Marcelo1, M.
C. P. Perez, and T. E. E. Cruz. 2010. Antibacterial activities of
fruticose lichens collected from selected sites in Luzon Island,
Philippines. Philipp. Sci. Lett., 3(2): 18-29.
Sati, S. C. and S. Joshi. 2011. Antibacterial activity of the Himalayan lichen
Parmotrema nilgherrense extracts. Br. Microbiol. Res. J., 1(2): 26-32.
Serusiaux, E., B. Goffinet, J. Miadlikowska and O. Vitikainen. 2009.
Taxonomy, phylogeny and biogeography of the the lichen genus
Peltigera in Papua New Guinea. Fungal Divers., 38: 185-224.
Shah, G. M. and M. A. Khan (2006). Common medicinal Folk recipes of
Siran valley, Mansehra, Pakistan. Ethnobot. leaflets 10: 49-62.
Shah, N. C. 2013. Lichens of Commercial importance in India. Herbal Tech
Industry. 10(01): 13-17.
Shahbaz, B., T. Ali and M. Awais. 2012. Perceived impact of precipitation in
forest managmentnon natural and social capitals in Mansehra
district of Pakistan. J. Anim. plant sci., 22(4): 1167-1172.
313
Shaheen, B. and S. H. Iqbal. 1978. The Parmelia borreri Group (lichens) in
Pakistan. Biologia, 24(2): 367-372.
Shahi, M. P, S. K. Shahi, A. Dikshit and D. K. Upreti. 2012. Broad spectrum
antifungal activity of Indian lichen Peltigera praetextata extracts to
control fungal. Int. J. Curr. Innov. Res.,1(1): 1-6.
Shahidi, F. and P. K. Janitha, P. D. Wanasundara. 1992. Phenolic
antioxidants. Crit. Rev. Food Sci. Nutr., 32(1): 67-103.
Sharma, B. C. and S. Kalikotay. 2012. Screening of antioxidant activity of
lichens Parmotrema reticulatum and Usnea sp. from Darjeeling hills,
India. IOSR J. Pharm., 2(6): 54–60.
Sharma, B. C., S. Kalikotay and B. Rai. 2012. Assessment of antimicrobial
activity of extracts of few common Lichen of Darjeeling Hills. Ind. J.
Fund. App. Life Sci., 2 (1): 120-126.
Shetty, P. P., G. S. Pandit and B. O. Sharma. 2012. Lichens on mangrove
plants in Andaman Islands, India. Mycosphere, 3(4): 476-484.
Shrestha, G, and L. L. S. Clair. 2013b. Lichens: a promising source of
antibiotic and anticancer drugs. Phytochem. Rev., 12(1): 229-244.
Shrestha, G. and L. L. S. Clair. 2013a. Antimicrobial activity of extracts from
two lichens Ramalina menziesii and Usnea lapponica. Bulletin of the
California Lichen Society, 20(1): 5 -10.
Shrestha, G., A. M. El-Naggar, L. L. S. Clair and K. L. Neill. 2015.
Anticancer Activities of Selected Species of North American Lichen
Extracts. Phytother. Res., 29 (1): 100–107.
Shrestha, G., S. L. Petersen and L. L. S. Clair. 2012. Predicting the
distribution of the air pollution sensitive lichen species Usnea hirta.
Lichenologist, 44: 511-521.
314
Shukla, P., D. K. Upreti, S. Nayaka and P. Tiwari. 2014. Natural dye from
Himalayan lichens. Indain J. Tradit. Know., 13(1): 195-201.
Silva, C. M. S. M. D. and S. P. Senanayake. 2015. Assessment of Epiphytic
Lichen Diversity in Pine Plantations and Adjacent Secondary Forest
in Peacock Hill, Pussellawa, Sri Lanka. Int. J. Mod. Bot., 5(2): 29-37.
Singh, K. P., A. Pinokiyo and S. K. Borthakur. 2006. Foliicolous lichens of
India with special reference to Arunaehal Pradesh, India. J. Forest.
29(3): 219-333.
Singh, P., K. P. Singh and A. B. Bhatt. 2015. Diversity and distribution of
microlichens in the state of Arunachal Pradesh, Eastern Himalaya,
India. Check List, 11(6): 1807.
Sinha, S. N. and M. Biswas. 2011. Evaluation of antibacterial activity of
some lichen from Ravangla, Sikkim, India. Int. J. Pharma. Bio. Sci.,
2(4): 23-28.
Sipman, H. and T. Raus. 2002. An Inventory of the Lichen Flora of
Kalimnos and Parts of Kos (Dodecanisos, Greece). Willdenowia, 32(2):
351-39.
Slack, N. G. 1988. The Ecological Importance of Lichens and Bryophytes. In
T. W. Nash III and V. Wirth (Ed.), Lichens and Bryophytes and air
quality. J. Cramer, Berlin, pp 23-53.
Srivastava, P., A. R. Logesh, D. K Upreti, T. N. Dhole and A. Srivastava.
2013a. In-vitro evaluation of some Indian lichens against human
pathogenic bacteria. Mycosphere 4(4): 734–743.
Srivastava, P., D. K. Upreti, T. N. Dhole and A. K. Srivastava. 2013. In-vitro
evaluation of the antimicrobial activities of lichen Usnea ghattensis.
Int. J. Curr. Microbiol. App. Sci., 2(5): 271-279.
315
Stapleton, P. D and P. W. Taylor. 2002b. Methicillin resistance in
Staphylococcus aureus: mechanisms and modulation. Sci. Prog., 85(1):
57-72.
Stewart, R. R. 1972. An annotated catalogue of the vascular plants of West
Pakistan and Kashmir. In Nasir, E. & S. I. Ali (Ed.), Flora of West
Pakistan Fakhri Press, Karachi. 1028 pp.
Stojanovic, I., N, Radulovic, V. Cvetkovic, T. Mitrovic and S. Stamenkovic.
2014. Antimicrobial activity of methanol extracts of four
Parmeliaceae lichen species. FACTA UNIVERSITATIS, 11(1): 45 – 53.
Susithra, E., K. M. Rao, K. V. Ramseshu and S. Meena. 2011. Evaluation of
In-vitro Antioxidant activity of isolated compounds of lichen, Usnea
undulate. J. Pharm. Res., 4(2): 352-355.
Syed, H. H., R. Ullah, F. Haq and M. I. Ullah. 2012. Ladybird beetles fauna
of Hazara University, garden campus, Mansehra, Pakistan. Int. J.
Biosci., 2(11): 58-65.
Tabarez, M. R., R. Jansen, M. Sylla, H. Lunsdorf, S. Haubler, D.A. Santosa,
K. N. Timmis and G. Molinari. 2006. 7-O-Malonyl Macrolactin A, a
New Macrolactin Antibiotic from Bacillus subtilis Active against
Methicillin-Resistant Staphylococcus aureus, Vancomycin-Resistant
Enterococci, and a Small-Colony Variant of Burkholderia cepacia.
Antimicrob. Agents Chemother., 50(5): 1701-1709.
Temina, M., S. Y. Kondratyuk, S. D. Zelenko, S. P. Wasser and E. Nevo.
2005. Lichen-forming, lichenicolous and allied fungi of Israel. In:
Wasser, S. P. and E. Nevo (Ed.). Biodiversity of Cyanoprocaryotes,
Algae and Fungi of Israel. ARA Ganter Verlag, Ruggell.
Thadhani, V. M., M. I. Choudhary, S. Khan and V. Karunaratne. 2012.
Antimicrobial and toxicological activities of some depsides and
depsidones. J. Natl. Sci. Found. Sri., 40(1): 43-48.
316
Tiwari, P., H. Rai, D. K. Upreti, S. Trivedi and P. Shukla. 2011b. Antifungal
Activity of a Common Himalayan Foliose Lichen Parmotrema
tinctorum (Despr. ex Nyl.) Hale. Nat. Sci., 9(9): 167–171.
Tiwari, P., H. Rai, D. K. Upreti, S. Trivedi and O. Shukla. 2011a.
Assessment of antifungal activity of some himalayan foliose lichens
against plant pathogenic fungi. Am. J. Plant Sci., 2(6): 841–846.
Triggiani D, D. Ceccarelli, A. Tiezzi, T. Pisani, S. Munzi, C. Gaggi and S.
Loppi. 2009. Anti-proliferative activity of lichen extracts on murine
myeloma cells. Biologia. 64(1): 59-62.
Tufan, O., H. Sumbul and A. O. Turk. 2005. The lichen flora of the
Termessos National Park in Southwestern Turkey. Turkish lichens.
Mycotaxon, 94: 43-46.
Turk, A. Q., M. Yilmaz, M. Kivanc and H. Turk. 2003. The Antimicrobial
Activity of extracts of the lichen Cetraria aculeata and its
protolichesterinic acid constituent. Z. Naturforsch., 58c: 850-854.
Uppadhyay, V., K. K. Ingle, S. Trivedi and D. K. Upreti. 2016. Diversity and
distribution of lichens from the monuments of Gwalior division,
Madhya Pradesh with special reference to rock porosity and lichen
growth. Trop. Plant Res., 3(2): 384–389.
Vidyalakshmi, A. and K. Kruthika. 2012. Antibacterial activity of Parmelia
perlata. Asian Pac. J. Trop. Biomed., 2(2): 892-894.
Vinayaka, K. S., S. Nayaka, Y. L. Krishnamurthy and D. K. Upreti. 2012. A
report on some macro-lichens new to Karnataka, India. J. Threat.
Taxa, 4(1): 2318-2321.
Vinayaka, K. S. 2011. A Study on Diversity and Conservation of Lichens in
Shettihalli Wildlife Sanctuary, Western Ghats, India. Final Report.
Kuvempu University, Shankaraghatta, Shimoga District, Karnataka
317
Vinayaka, K. S., H. C. Chetan and A. R. Mesta. 2016. Diversity and
Distribution Pattern of Lichens in the MidElevation Wet Evergreen
Forest, Southern Western Ghats, India. Int. J. Res. Studies Biosci.,
(IJRSB), 4(1): 15-20.
Wang, L., T. Narui, H. Harada, C. F. Culberson, and W. L. Culberson. 2001.
Ethnic Uses of Lichens in Yunnan, China. Bryologist, 104(3): 345-349.
White, T. J., T. Bruns, S. Lee, and J. W. Taylor. 1990. Amplification and
direct sequencing of fungal ribosomal RNA genes for phylogenetics.
In: Innis, M. A., D. H. Gelfand, J. J. Sninsky, and T. J. White (Eds.)
PCR Protocols: A Guide to Methods and Applications. Academic Press,
Inc., New York. Pp. 315-322.
Wolseley, P. A. and B. A. Hudson. 1995. Key to lichen genera in Thailand
with special reference to epiphytic taxa, part 1: Macro-lichens. Bull.
Am. Mus. Nat. Hist., 43: 303-335.
Zedda, L., M. Schultz and G. Rambold. 2009. Diversity of epiphytic lichens
in the savannah biome of Namibia. Herzogia 22: 153–164.