Draft - University of Toronto T-Space · Draft Brucella melitensis M5-90 bp26 as a potential live...

Draft

Brucella melitensis M5-90△△△△bp26 as a potential live vaccine

that allows for the distinction between natural infection and

immunization

Journal: Canadian Journal of Microbiology

Manuscript ID cjm-2017-0179.R1

Manuscript Type: Article

Date Submitted by the Author: 02-May-2017

Complete List of Authors: Li, Tiansen; College of Animal Science and Technology, Shihezi University Tong, Zhixia; Shihezi University Huang, Meiling; Shihezi University Tang, Liyan; Shihezi University Zhang, Hui; Shihezi University, College of Animal Science and Technology Chen, Chuangfu; Shihezi University, College of animal science and technology

Keyword: B.melitensis M5-90, bp26 gene, live attenuated vaccines

https://mc06.manuscriptcentral.com/cjm-pubs

Canadian Journal of Microbiology

Draft

Brucella melitensis M5-90△bp26 as a potential live vaccine

1

Brucella melitensis M5-90△△△△bp26 as a potential live vaccine that allows for the

distinction between natural infection and immunization

Tiansen Li1*,Zhixia Tong

1*, Meiling Huang

2,Liyan Tang

1, Hui Zhang

1# and

Chuangfu Chen1#

Tiansen Li and Zhixia Tong contributed to this work.

Tiansen Li E-mail: [email protected]

Zhixia Tong E-mail: [email protected]

Meiling Huang E-mail: [email protected]

Liyan Tang E-mail:[email protected]

Corresponding author:

Hui Zhang E-mail: [email protected]

Chuangfu Chen E-mail:[email protected]

1College of Animal Science and Technology, Shihezi University, 832000, Shihezi,

Xinjiang, China

2College of life science, Shihezi University, 832000, Shihezi, Xinjiang, China

Page 1 of 39



Draft


2

Abstract:

Brucella is Gram-negative intracellular bacterial pathogen that infects humans

and animals and contributes to great economic losses in developing countries.

Presently, live attenuated Brucella vaccines (B. melitensis strain M5-90) are the most

effective means of brucellosis control and prevention in animals. However, these

vaccines have several drawbacks, such as an inability to distinguish between a natural

infection and immunization and an association with abortions in pregnant animals.

Therefore, this study constructed a Brucella M5-90△bp26 mutant and evaluated its

virulence. The survival of the M5-90△bp26 mutant was attenuated in human placenta

trophoblastic 8 cells (HPT-8 cells) and in BALB/c mice, with a high

immunoprotectivity noted in mice. Furthermore, a safety tests showed that the

M5-90△bp26 mutant was less virulent than the M5-90 vaccine strain. Additionally, an

indirect enzyme linked immunosorbent assay (ELISA) screening was shown to detect

the presence of Brucella protein 26 (BP26) with high sensitivity, with M5-90△bp26

inoculation accompanied with a lack of BP26 expression, and was further confirmed

by Western blotting. Together, the M5-90△bp26 mutant and the indirect ELISA can be

employed to distinguish vaccinated livestock from infected animals.

Keywords: B.melitensis M5-90, bp26 gene, live attenuated vaccines

Introduction

Brucellosis is a zoonotic disease caused by the Gram-negative genus

Brucella(De Bolle et al. 2015). Brucellosis remains endemic in many developing

Page 2 of 39



Draft


3

countries and causes substantial economic losses and public health risks(Franco et al.

2007). Currently, the most efficacious means of controlling brucellosis in animals is

via live attenuated vaccines. However, difficulties in distinguishing immunizations

from natural infections limits their application(Zhang et al. 2016). Furthermore, an

effective and safe human vaccine is currently unavailable, thus making the need for a

low virulence and high efficacy vaccine urgent.

In China, the most widely used vaccine is the B. melitensis M5-90 attenuated live

vaccine which was constructed by the China Harbin Veterinary Research

Institute(Wang et al. 2013a). After continuously attenuating a virulent Brucella strain

in chickens, the M5 strain was developed. This strain was then passaged 90 times in

chicken fibroblasts and a lower toxicity, high efficacy strain was developed

(M5-90)(Wang et al. 2013b). However, one disadvantage of this strain is an inability

to distinguish a vaccine-based immunization from a natural infection(Wang et al.

2011). Thus, the development of a gene knockout method able to assess the Brucella

M5-90 gene deletion vaccine strain is necessary.

In Brucella, the outer membrane protein BP26, also known as CP28 or OMP28,

exhibits a highly conserved gene sequence in 7 species, to include 20 biological types

of Brucella(Qiu et al. 2012). When compared to fixed outer membrane proteins, BP26

has the advantage of easy detection. BP26 is an immunodominant antigen in infected

livestock and humans, thus making it a useful diagnostic antigen with an accuracy rate

reaching > 90%(Kim et al. 2013; Wen-Xing et al. 2011). Following immunization

with live attenuated vaccine in animals, serum samples showed that bp26 elicited a

Page 3 of 39



Draft


4

much weaker response than the virulent strains, with this difference being of practical

significance when attempting to distinguish a natural infection and vaccine

immunization(Yao et al. 2015). Currently, the bp26 gene deleted vaccine strain and

bp26 gene deletion can weaken Brucella virulence and provide better

immunoprotection(Amani et al. 2015; Kim et al. 2013). The Rev.1 strain was selected

from medium containing streptomycin and no streptomycin, toxicity is strong, have

certain protective immunity of B.abortus and B. melitensis. However, as a vaccine is

toxic, and the toxicity will be fully restored in a certain condition. M5-90 attenuated

live vaccine is attenuated by the chicken, the virulence is weak, and there will be no

toxicity recovery. Therefore, a better vaccine alternative will be obtained through the

modification of the M5-90 vaccine strain. Furthermore, previous research has

indicated that the S19 attenuated vaccines from the bp26 gene deletion mutant did not

change its biological characteristics or the immunoprotectivity of the parental

strain(Ghasemi et al. 2014). Therefore, the bp26 gene is currently considered one of

the most suitable Brucella vaccine markers.

Materials and methods

Ethics statement

This study was approved by the Institutional Committee of Post-Graduate Studies

and Research at Shihezi University, China. All experimental procedures and animal

care were performed in Canadian Council on animal care regulations.

Bacterial strains, cell line, growth conditions and vectors

Page 4 of 39



Draft


5

B. melitensis 16M and B. melitensis M5-90 vaccine strain were obtained from the

Center of Chinese Disease Prevention and Control (Beijing, China) and used to

construct a M5-90△bp26 mutant. Brucella was cultured in a tryptic soy agar (TSA)

or tryptic soy broth (TSB) (Sigma, St. Louis, MO, USA). Escherichia coli strains

DH5α and DE3 (BL21) were grown on Luria-Bertani (LB) medium. Culture mediums

were supplemented with appropriate antibiotics (50 µg/mL ampicillin or 50 µg/mL

kanamycin for E. coli) when necessary. Human HPT-8 embryonic trophoblast were

obtained (Cell Resource Center, IBMS, CAMS/PUMC, Beijing, China) and cultured

in Dulbecco’s Modified Eagle’s Medium (DMEM; Gibco Life Technologies,

Rockville, MD, USA) supplemented with 10% fetal bovine serum (FBS; Gibco Life

Technologies, Rockville, MD, USA) at 37°C with 5% CO2. The pGEM-7Zf+ vector

was purchased from Promega (Madison, WI, USA) and the pMD19-T and pET-28a

vectors were purchased from TAKARA (Dalian, China).

Animals

Sheep (~35 kg) were obtained from the Experimental Animal Center of the

Shihezi University (Xinjiang, China) and six-week-old BALB/c female mice were

obtained from the Experimental Animal Center of the Academy Military Medical

Science (Beijing, China). Animals were maintained in barrier housing with filtered

inflow air in a restricted-access room under pathogen-limited conditions. Water and

commercial food were provided.

Construction of the M5-90 △△△△bp26 mutant

The M5-90△bp26 mutant was constructed as previously described with some

Page 5 of 39



Draft


6

modifications(Li et al. 2015a). Primers were designed using the Brucella bp26 gene

sequence (Genbank ID: AY065979) and its flanking sequences were upstream and

downstream of the homologous arm (Table 1). PCR amplification was performed to

generate the 3 PCR products in addition to amplifying the sacB gene from Bacillus

subtilis using primers sa-F and sa-R (Table 1). The amplified sequences were cloned

into the pMD19-T vector via Xba I/Nhe I and Nhe I/Sac I restriction sites. The

upstream and downstream homologous arm sequences were cloned into the

pGEM-7Zf+ vector, followed by cloning of the SacB gene. Brucella vaccine strain

M5-90 competent cells were transformed via electroporation and successful

recombinants were selected via ampicillin resistance and a 5% sucrose screening.

M5-90△bp26 mutants were detected using appropriate primers (wb-F, wb-R and bp-F

and bp-R) and compared with the M5-90 vaccine strain. The genetic stability of the

M5-90△bp26 mutant was also established after 30 generations in culture.

Evaluation of M5-90△△△△bp26 mutant attenuation in HPT-8 embryonic trophoblast

cells

HPT-8 embryonic trophoblast cells were seeded in 6-well plates and infected with

M5-90△BP26 or the parental strain M5-90 at a multiplicity of infection (MOI) of 100

as previously described(Li et al. 2015b). Culture plates were centrifuged at 350 × g

for 5 min at room temperature and then placed at 37°C with 5% CO2. After 45 min

post-infection, the cells were washed 3 times with medium and incubated for 1 h with

50 µg/mL of gentamicin (Invitrogen, USA) to kill any extracellular bacteria. The

culture was then placed in DMEM containing 25 µg/mL gentamicin (defined as time

Page 6 of 39



Draft


7

zero). At different time points (0, 4, 8, 12, 24 and 48 h) post-infection, the supernatant

was discarded and cells were lysed in PBST containing 0.1% (v/v) Triton X-100.

Bacteria used for enumeration were plated on TSA plates. All assays were performed

in triplicate and repeated three times.

HPT-8 embryonic trophoblast cell cytotoxicity assay

HPT-8 embryonic trophoblast cells were cultured in 6-well plates for 3.5 h at

37°C in 5% CO2. Cells were then infected with M5-90 or M5-90∆bp26 at a MOI of

100, with supernatants collected at 24h post-infection. The HPT-8 cells were also

infected with 60 µg/ml purified BP26 protein or PBS as a control. IL-6, IL-10 and

TNF-α levels were determined in the supernatants via ELISA assay as previously

described(Zhang et al. 2016).

Protection induced by M5-90△△△△bp26 in mice

Six-week-old female BALB/c mice (n = 20 per group) were vaccinated

intraperitoneally with 1×106 Colony-Forming Units (CFU) (200 µL) of M5-90△bp26

(experimental vaccine group), M5-90 (reference vaccine control group) or 200µL PBS

(unvaccinated control group). At 5 weeks post-vaccination, the mice were challenged

intraperitoneally with 1×106 CFU per mouse (200 µL) of the virulent strain 16 M.

Mice (n = 10 per time point per group) were euthanized by cervical dislocation 2

weeks post challenge, and bacterial CFUs in the spleens were determined as

previously described(Li et al. 2015a). A mean value for each spleen count (Living

mice) was obtained after logarithmic conversion. Log units of protection were

obtained by subtracting the mean Log CFU for the experimental group from the mean

Page 7 of 39



Draft


8

Log CFU for the control group, as previously described(Willett et al. 2015). For each

biological replicate, the CFU counts were performed in triplicate.

To observe the symptoms of different doses of M5-90 and M5-90△△△△bp26 mutant

immunized mice

Brucella suspensions were prepared from 1 × 108 cells/ml and 1 × 109 cells/ml

stocks, with each diluted with PBS to reach a final concentration of 1 × 106 cells, 6 ×

106 cells and 2 × 107 cells in 200 µL. Mice were intraperitoneally immunized with

M5-90 or M5-90△bp26, with any clinical manifestations or death recorded at days 1,

3, 7 and 9 post-inoculation.

Cloning, Expression and purification of BP26 recombinant proteins

Based on the obtained Brucella M5-90 bp26 (GenBank ID: AY065979) gene

sequence, primers P9/P10 (Table 1) were designed to contain Nco I/Xho I restriction

sites. The bp26 open reading frame was amplified by PCR, with the M5-90 DNA

serving as a template. The amplicon was then cloned into a pET-28a vector (Novagen,

USA) and expressed in E. coli BL21 as an N-terminally His-tagged recombinant

protein. The expression of the recombinant protein was confirmed by SDS-PAGE

(12 %) and the recombinant BP26 protein was purified by affinity chromatography

with Ni2-conjugated Sepharose (GE Healthcare Life Sciences, USA)

Western blotting

Cell lysates containing the recombinant BP26 protein were analyzed by Western

blotting as previously described(Li et al. 2015a). The membrane containing

recombinant bp26 protein was then incubated with Brucella-vaccinated serum,

Page 8 of 39



Draft


9

followed by sheep anti-mouse IgG (horserumdish peroxidase conjugated; EarthOx

Life Sciences, USA) secondary Ab. The membrane was developed using an enhanced

HRP-DAB substrate color kit according to the manufacture’s protocols (Tiangen

Biotech, China).

BP26 protein Quantification

The purified protein was quantified using a BCA Protein kit (Sangon Biotech,

China) according to the manufacture’s protocols. The BP26 protein (25 µL) was

combined with 200 µL BCA working solution, incubated for 30 min at 37°C and

spectrophotometrically read at an absorbance of 562 nm. The BP26 protein

concentration was then determined based on the generated BCA standard curve.

Establishment of an indirect ELISA method for BP26 protein

To determine optimal enzyme-conjugate secondary antibody concentration, with

the maximum dilution positive serum reaction and OD490nm value at 1.0% of the

enzyme conjugate of the maximum dilution as enzyme conjugate (Table 3).

Determination of the optimal coating antigen (purified recombinant BP26) and the

concentration of serum dilution of positive and negative. ELISA plates were coated in

either dilution purified recombinant BP26 antigen (3.2 mg/ml) or serum, with positive

and negative serum diluted 1:10, 1:20, 1:40, 1:80 and 1:160 with matrix reaction

(Table 4). To determine the optimal serum dilution, a positive serum result was

considered an OD490nm > 1.0 and a negative serum result was considered an OD490nm

< 0.2.

Brucella M5-90 △△△△bp26 mutant immunized sheep and serologic analysis

Page 9 of 39



Draft


10

Thirty female Chinese Merino 4-month-old lambs born into a brucellosis-free

flock were randomly divided into 3 groups (n = 10 per group). Groups 1 and 2 were

subcutaneously injected (s.c.) with 200 µL PBS containing 1 × 109 CFU of

M5-90△bp26 or M5-90 and group 3 was administered 200 µL PBS as a negative

control. Serum samples were obtained from immunized sheep at days 0, 7, 14, 21, 30

and 45 post-immunization and tested by Rose Bengal Plate Test (RBPT)

and standard tube agglutination test (STAT) (IVRI, Izatnagar)(Table 5). Equal

volumes (20 µL) of RBPT colored antigen and the test serum were mixed on a clean

glass slide using a sterile toothpick(Godfroid et al. 2016). The slide was observed

after 1 min for the formation of clumps, with clear clumps indicating a positive test,

while the absence of clumps was considered a negative result.

For the STAT, plain antigen was used as previously described(Islam et al. 2013).

Two-fold serial dilutions (1:25 to 1:200) of the serum were prepared in phenol saline

(1150 µL of phenol saline was added to the first tube and 500 µL to the remaining

tubes; then, 100 µL of serum was added to the first tube and mixed, 500 µL was

transferred to the next tube and 750 µL was discarded; further volumes of 500 µL

were transferred to subsequent tubes to give a series of double dilutions). Each tube

then had 500 µL of STAT white antigen added, followed by the addition of 0.5 mL of

plain antigen. After mixing, all the tubes were incubated at 37°C for 24 h. A titer of

1:50 or above was considered positive for brucellosis.

Detection of serum samples from sheep

ELISA plates coated with purified BP26 protein were used to detect the presence

Page 10 of 39



Draft


11

of BP26 antibodies in M5-90 and M5-90△bp26 immunized sheep serum (7 d, 14 d,

21 d, 30 d, 37 d and 45 d)(Table 6). Serum samples were further evaluated via

SDS-PAGE and Western blot to determine whether there would be an

antigen-antibody binding reaction.

Statistical analysis

Bacterial survival in the HPT-8 cells and the mice is expressed as the mean

LogCFU ± the standard deviation (SD). Antibody response and cytokine production

are expressed as the mean OD450 ± SD. RBPT and STAT were compared by using the

Fisher test. The strain effect was further analyzed using a non-parametric

Kruskall–Wallis rank test. Results expressed as percentages were analyzed using the

Fisher test. P-values < 0.05 were considered statistically significant.

Result

Construction of the B. Melitensis M5-90△△△△bp26 mutant

A B.melitensis strain M5-90 mutant (M5-90△bp26) was successfully constructed,

with a 526 bp DNA fragment amplified when using the M5-90△bp26 primers

(Table1). When M5-90 was amplified with the same primers, a 1279bp DNA

fragment was generated, thus confirming successful knocked out (data not shown).

PCR products were sequenced to confirm the deletion and RT-PCR showed that bp26

was not transcribed in M5-90△bp26 mutant (data not shown).

M5-90△△△△bp26 mutant is attenuated in HPT-8 embryonic trophoblast cells

To assess B. melitensis M5-90△bp26 attenuation, HPT-8 embryonic trophoblast

cells were infected with the M5-90△bp26 mutant and compared with trophoblast

Page 11 of 39



Draft


12

infected with other B. melitensis strains to assess replicative abilities. At 0 h and 4 h

post-infection, no differences in bacterial loads were noted (Fig.1), thus indicating no

significant difference in HPT-8 invasive abilities. However, 12 h post-infection, both

strains experienced a 1.2-log (M5-90△bp26) and 0.3-log (M5-90) load decrease. At

24 h post-infection, the load had further decrease to 3.0-log and 0.7-log, respectively

(P < 0.01; Fig.1). These results showed that the M5-90△bp26 mutant has a limited

replicative ability in HPT-8 cells when compared with the vaccine strain M5-90, thus

indicating that M5-90△bp26 is attenuated and that bp26 is involved in chronic

Brucella infections.

M5-90△△△△bp26 mutant is attenuated in BALB/c mice

To evaluate M5-90△bp26 virulence in vivo, BALB/c mice were intraperitoneally

infected with 1 × 106 CFU of M5-90△bp26, M5-90 or PBS (negative control). To

evaluate Brucella CFUs, mice spleens were evaluated 1, 3, 7, 14 and 28 days

post-infection. While no significant difference in bacterial load was noted 1 and 3

days post-infection (P > 0.05), a 3.28-log decrease (P < 0.05) was noted in the

M5-90△bp26 mutant compared to M5-90 (Fig.2A) at day 7. At 14 days

post-infection, a further decrease to 3.69-log was noted (Fig.2A; P < 0.05). These

results showed that the M5-90△bp26 mutant was significantly attenuated (P < 0.05)

at 7 and 14 days post-infection when compared to M5-90. Importantly, by 28 days

post-infection, no detectable spleen CFU was detected in mice inoculated with

M5-90△bp26 (Fig.2A). Additionally, when comparing splenic weights, the

M5-90△bp26 infected spleens were significant lighter than that of M5-90 infected

Page 12 of 39



Draft


13

ones (Fig.2B) for most time points, thus indicating a significantly reduced

inflammation in M5-90△bp26-dosed mice. These results show that virulence of the

M5-90△bp26 strain is greatly attenuated in comparison to the M5-90 vaccine strain.

Strain M5-90△△△△bp26 induces immunoprotection when challenged with the

virulent 16M strain

To examine M5-90△bp26-induced immunoprotection, a vaccine challenge

experiment was performed, with mice intraperitoneally vaccinated with 1 × 106 CFU

of M5-90△bp26, M5-90 or PBS. At 5 weeks post-vaccination, mice were challenged

with 1 × 106 CFU of strain 16M. The mice immunized with M5-90△bp26 had a

significantly lower splenic Brucella load than unimmunized animals (Fig.3).

Furthermore, a similar protection was seen in mice immunized with the M5-90△bp26

mutant strain (2.89-log units) as in the M5-90 vaccine strain (2.65-log units).

Moreover, a slightly higher survival rate of 94% was seen in mice immunized with

M5-90△bp26 16 days post-challenge, while a rate of 90% was seen in those

immunized with M5-90 (Fig.4). These results indicated that the M5-90△bp26 mutant

can provide a better protection efficiency to M5-90 following challenge.

Bp26 gene expression, purification and Western-blot

E.coli BL21 (DE3) cells were transformed with recombinant pET-28a-bp26

plasmid, with IPTG (1 mmol/L) induction performed at 6 h. The purified product was

evaluated via Western blot and found to be between 25-35 kD, which was consistent

with the expected size of the 28 kD (Fig.5).

M5-90△△△△bp26 mutant and BP26 protein induced cytokine responses

Page 13 of 39



Draft


14

To evaluate the cytotoxicity of M5-90△bp26 in HPT-8 cells, cells were infected

with M5-90 or M5-90△bp26 at MOI of 100 and IL-6, IL-10 and TNF-α level were

examined. IL-6 and IL-10 measurement results were significantly different (P < 0.05),

IL-6 and TNF-α measurement were results significantly different (P < 0.01), IL-6 and

TNF-α measurement results were significantly different (P < 0.05). Furthermore, the

presence of BP26 protein reduced IL-6 levels, while M5-90 and M5-90△bp26

increased levels. BP26 protein, M5-90 and M5-90△bp26 all produced a reduction in

IL-10 levels relative to the control, while stimulating an increase in TNF-α, with the

largest increase seen in the M5-90△bp26 samples (Fig.6).

Clinical symptoms of M5-90 and M5-90 △△△△bp26 immunized mice at different

doses

When mice were inoculated intraperitoneally with 1 × 106 bacteria, clinical

symptoms were more pronounced in the M5-90 inoculated group compared to the

M5-90△bp26 group, but no deaths were noted in either group (Table 2a). Furthermore,

no significant differences in the growth rates were noted when compared to the PBS

control. When the bacterial load was increased to 6 × 106 bacteria, a mortality rate of

50% was noted following M5-90 inoculation, while no mortality was noted in the

M5-90△bp26 group (Table 2b). When examining the growth rate, no significant

difference was observed between the M5-90△bp26 group and the PBS control group,

yet a slower rate was noted in the M5-90 group. Lastly, the mice were inoculated with

2 × 107 bacteria and a mortality rate 80% was noted in the M5-90 group, while no

mortality was noted in the M5-90△bp26 mutant group (Table 2c). When examining

Page 14 of 39



Draft


15

the growth rate, no significant difference was observed between the M5-90△bp26

mutant group and the control, yet a slower rate was noted in the M5-90 group.

Determination of ELISA results

The optimal rabbit anti-sheep antibody dilution was found to be 1:20,000, with

optimal defined as being able to react with the positive serum at a maximum dilution

(OD490nm ≥ 1) (Table 3). To determine the optimal concentration of the coating BP26

antigen, the BP26 antigen was diluted to 1:500 and the negative and positive serum

samples were diluted to 1:80. An OD490nm ≥ 1 was considered a positive result and

OD490nm < 0.2 was considered negative (Table 4). Thus, the optimal concentration of

coating BP26 antigen was determined to be 6.4 µg/ml. To evaluate the determined

concentrations, negative serum was obtained from 100 sheep and diluted 80 fold.

Average values and standard errors were determined at OD490nm, with x̄ + 2S

determined to be the critical value of the negative serum and x̄ being 0.211 and the

value of S being 0.018, thus the critical value was 0.247. Therefore, serum samples at

OD490nm ≥ 0.247 were considered positive.

Comparison of the ELISA and test tube agglutination tests using sheep serum

samples

As established, the coated BP26 antigen was diluted 1:500, the negative and

positive serum were diluted 1:80 and the rabbit anti-sheep antibody diluted 1:20,000.

For the indirect ELISA experiment, BP26 protein was used as the coating BP26

antigen and 42 sheep serum samples were used, with 15 samples deemed positive to

give a positive rate of 35.71% (15/42). For the standard tube agglutination test (STAT),

Page 15 of 39



Draft


16

13 of the 42 samples were found to be positive, thus giving a positive rate of 30.95%

(13/42). For the ELISA, 15 of the 42 examined serum samples were positive, which

were consistent with the 13 serum in the STAT results, and the positive coincidence

rate was 86.67% (13/15) (Fig.7).

The result of sheep serum STAT experiment

Sheep serum samples were examined following inoculation with either M5-90 or

M5-90△bp26. In the M5-90 group (n = 10), all serum samples were BP26 positive,

while all of the M5-90△bp26 samples (n = 10) were negative. For the M5-90 group,

the optimal experimental antibody post-immunization was 1:800 (Table 5).

ELISA detection of M5-90 and M5-90△△△△bp26 in sheep serum

ELISA plates were coated with purified BP26 protein and the presence of BP26

was detected in sheep serum inoculated with M5-90 or the M5-90△bp26 mutant 7, 14,

21, 30, 37 and 45 days post-inoculation (Table 6). The result showed a distinction

between the two strains.

Discussion

Brucellosis is endemic in China and the surrounding areas, with quarantine being

necessary for disease prevention and biosafety (Sun et al. 2016). At present, the

M5-90 vaccine is associated with a high level of virulence, thus making it difficult to

distinguish between natural infection and vaccination(Zhang et al. 2016). These

drawbacks have resulted in people being unwilling to use the vaccine in a wide range

of applications, thus enabling a rebound in brucellosis(Yin et al. 2016). Due to these

limitations, great efforts have been made to develop new vaccine strains and to avoid

Page 16 of 39



Draft


17

potential serological interference that is associated with classical vaccines. Therefore,

the ideal vaccine must be protective, non-virulent for the host and carrying a genetic

marker(Moriyón et al. 2004). Previous studies have shown that a bp26 mutant

possesses reduced persistence in mice and that it induces superior protection, thus

making it a new potential vaccine candidate against Brucellosis (Thavaselvam et al.

2010; Wen-Xing et al. 2011).

In the present study, a bp26 deletion mutant was constructed to confirm that the

reduced survival capability of the mutant was directly related to the deleted bp26

gene(Grilló et al. 2009). The B. melitensis M5-90△bp26 mutant was verified by PCR

and shown to be effective for survival in BALB/c mice and cleared faster than the

M5-90 strain. Furthermore, mice inoculated with M5-90△bp26 showed a lack of

splenomegaly, thus indicating an increased safety, decreased virulence and reduced

inflammatory response. These findings are consistent with previous results and

substantiate that bp26 is involved in Brucella virulence(Wang et al. 2011).

Furthermore, the wild-type strain 16 M and the mutant’s parental strain M5-90

showed similar intracellular replication, while the M5-90△bp26 mutant failed to

replicate in the mouse models, thus suggesting a decreased virulence. Additionally, an

ideal Brucella live vaccine must induce high immunoprotection. Therefore,

immunoprotection was examined in inoculated BALB/c mice and showed that

M5-90△bp26 could provide slightly better protection than M5-90.

To examine any clinical symptoms following bacterial challenge, the mouse

animal model was further employed. Following inoculation with M5-90 or

Page 17 of 39



Draft


18

M5-90△bp26, mice were challenged with bacteria (1 × 106) and the clinical

symptoms were more serious in the M5-90 group relative to the M5-90△bp26, but no

death was noted. When the bacterial load was increased to 6 × 106, a 50% mortality

rate was noted in the M5-90, while no mortality was observed in the M5-90△bp26

group. A further delta was noted after increasing the load to 2 x 106, where still no

mortality was noted in the M5-90△bp26 group. Comprehensive analysis showed that

the virulence of M5-90△bp26 was weaker than that of the parental M5-90 stain and

yet a high degree of protection was provided.

When establishing an indirect ELISA, BP26 protein was used as the coating

antigen and enabled bp26 detection in M5-90 and M5-90△bp26 inoculated sheep

serum. The results showed that all of the M5-90 inoculated sheep serum samples were

positive (n = 10) and all of the M5-90△bp26 inoculated sheep serum samples were

negative (n = 10). These results confirmed that the engineered strain lacked the bp26

gene and thus could not express the BP26 protein. These findings suggest that BP26

could be used as a potential diagnostic antigen in combination with conventional

serological methods to distinguish between vaccine immunization and natural

infection.

Current serological diagnostic tests such as RBPT, STAT and indirect ELISA are

effective at detecting Brucella with a smooth lipopolysaccharide (LPS)

phenotype(Osman et al. 2016). However, it is difficult to differentiate between the

serum of vaccinated animals and infected animals using these serological

tests(Kianmehr et al. 2015). Herein, serum from M5-90 inoculated mice tested

Page 18 of 39



Draft


19

positive by RBPT and STAT, while M5-90△bp26 inoculated mice tested negative.

These results suggest that the BP26 protein may be useful in the development of a

serological test able to differentiate the 2 strains.

High titers of serum were detected in sheep immunized with M5-90 vaccine

strain after 7 days, but lower titers of serum were detected by STAT and RBPT in

sheep after immunization M5-90△bp26 vaccine 21 days, M5-90△bp26 induced

antibody production capacity is weak compared with the M5-90 strain (Table5),

Possible reasons: First, the traditional STAT and RBPT are mainly for Brucella

immune dominant S-LPS antigen, the lack of BP26 protein in this strain may be affect

the expression of S-LPS antigen; Secondly, the dose of vaccines in this experiment

were 1 × 109 CFU, for the significant decline in the virulence of the M5-90△bp26

strain, the dose may be too small, affecting the body's antibody expression; Thirdly,

Brucella virulence and antigenicity are often positive correlation, the M5-90△bp26

strain virulence significantly reduced, affecting its survival and reproduction in

macrophages, and Brucella invades the body mainly caused by infection-based

immunity, intracellular survival, intracellular viability, causing decreased immunity,

affecting the production of high titer antibodies.

In conclusion, our results indicate that B. melitensis M5-90△bp26 may be a

suitable live vaccine against B. melitensis due to its low virulence and higher

immunoprotectivity following 16M strain challenge when compared to the M5-90

vaccine strain. The examination of humoral responses indicate that M5-90△bp26

elicites an anti-Brucella-specific IgG response, which implicates the BP26 antigen as

Page 19 of 39



Draft


20

an ideal candidate to aid in the distinction between immunization and natural infection.

Therefore, B. melitensis M5-90△bp26 could be considered a potential new vaccine

candidate against brucellosis. In future studies, the mechanisms that contribute to the

humoral immune response in mice will be evaluated and further animal testing will be

explored to determine whether M5-90△bp26 is indeed a good live vaccine candidate.

Acknowledgment

This work was supported by grants from the National Natural Science

Foundation of China (31360610, 31402166, 31460650, 31572491, and 31660705),

the International Science Technology Cooperation Project of China (2015DFR31110).

Disclosure

No conflict of interest.

References

Amani, J., Ghasemi, A., Ranjbar, R., Shabani, M., Zandemami, M., and Golmohammadi, R. 2015.

Immune reactivity of sera obtained from brucellosis patients and vaccinated-rabbits to a fusion

protein from Brucella melitensis. Iran J Basic Med Sci 18(4): 350-355.

De Bolle, X., Crosson, S., Matroule, J.Y., and Letesson, J.J. 2015. Brucella abortus Cell Cycle and

Infection Are Coordinated. Trends Microbiol 23(12): 812-821.

Franco, M.P., Mulder, M., Gilman, R.H., and Smits, H.L. 2007. Human brucellosis. The Lancet infectious

diseases 7(12): 775-786.

Ghasemi, A., Ranjbar, R., and Amani, J. 2014. In silico analysis of chimeric TF, Omp31 and BP26

fragments of Brucella melitensis for development of a multi subunit vaccine candidate. Iran J Basic

Med Sci 17(3): 172-180.

Godfroid, J., Beckmen, K., and Helena Nymo, I. 2016. Removal of Lipid from Serum Increases

Coherence between Brucellosis Rapid Agglutination Test and Enzyme-linked Immunosorbent Assay in

Bears in Alaska, USA. J Wildl Dis.

Grilló, M.J., Marín, C.M., Barberán, M., de Miguel, M.J., Laroucau, K., Jacques, I., and Blasco, J.M. 2009.

Efficacy of bp26 and bp26/omp31 B. melitensis Rev.1 deletion mutants against Brucella ovis in rams.

Vaccine 27(2): 187-191.

Islam, M.A., Khatun, M.M., Werre, S.R., Sriranganathan, N., and Boyle, S.M. 2013. A review of Brucella

seroprevalence among humans and animals in Bangladesh with special emphasis on epidemiology,

risk factors and control opportunities. Vet Microbiol 166(3-4): 317-326.

Kianmehr, Z., Kaboudanian Ardestani, S., Soleimanjahi, H., Fotouhi, F., Alamian, S., and Ahmadian, S.

Page 20 of 39



Draft


21

2015. Comparison of Biological and Immunological Characterization of Lipopolysaccharides From

Brucella abortus RB51 and S19. Jundishapur J Microbiol 8(11): e24853.

Kim, D., Park, J., Kim, S.J., Soh, Y.M., Kim, H.M., Oh, B.H., and Song, J.J. 2013. Brucella Immunogenic

BP26 Forms a Channel-like Structure. J Mol Biol 425(7): 1119-1126.

Li, Z., Zhang, J., Zhang, K.E., Fu, Q., Wang, Z., Li, T., Zhang, H., Guo, F., and Chen, C. 2015a. Brucella

melitensis 16MΔTcfSR as a potential live vaccine allows for the differentiation between natural and

vaccinated infection. Exp Ther Med 10(3): 1182-1188.

Li, Z.Q., Shi, J.X., Fu, W.D., Zhang, Y., Zhang, J., Wang, Z., Li, T.S., Chen, C.F., Guo, F., and Zhang, H.

2015b. A Brucella melitensis M5-90 wboA deletion strain is attenuated and enhances vaccine efficacy.

Mol Immunol 66(2): 276-283.

Moriyón, I., Grilló, M.J., Monreal, D., González, D., Marín, C., López-Goñi, I., Mainar-Jaime, R.C.,

Moreno, E., and Blasco, J.M. 2004. Rough vaccines in animal brucellosis: structural and genetic basis

and present status. Vet Res 35(1): 1-38.

Osman, A.Y., Abdullah, F.F., Kadir, A.A., and Saharee, A.A. 2016. Immuno-pathophysiological responses

of mouse models to experimental infection with Brucella melitensis and its lipopolysaccharides via

intraperitoneal route. Microb Pathog.

Qiu, J., Wang, W., Wu, J., Zhang, H., Wang, Y., Qiao, J., Chen, C., Gao, G.F., Allain, J.P., and Li, C. 2012.

Characterization of periplasmic protein BP26 epitopes of Brucella melitensis reacting with murine

monoclonal and sheep antibodies. PLoS One 7(3): e34246.

Sun, M.J., Di, D.D., Li, Y., Zhang, Z.C., Yan, H., Tian, L.L., Jing, Z.G., Li, J.P., Jiang, H., and Fan, W.X. 2016.

Genotyping of Brucella melitensis and Brucella abortusstrains currently circulating in Xinjiang, China.

Infect Genet Evol.

Thavaselvam, D., Kumar, A., Tiwari, S., Mishra, M., and Prakash, A. 2010. Cloning and expression of the

immunoreactive Brucella melitensis 28 kDa outer-membrane protein (Omp28) encoding gene and

evaluation of the potential of Omp28 for clinical diagnosis of brucellosis. J Med Microbiol 59(Pt 4):

421-428.

Wang, F., Hu, S., Gao, Y., Qiao, Z., Liu, W.X., and Bu, Z. 2011. Complete genome sequences of Brucella

melitensis strains M28 and M5-90, with different virulence backgrounds. J Bacteriol 193(11):

2904-2905.

Wang, F., Qiao, Z., Hu, S., Liu, W., Zheng, H., Liu, S., Zhao, X., and Bu, Z. 2013a. Comparison of genomes

of Brucella melitensis M28 and the B. melitensis M5-90 derivative vaccine strain highlights the

translation elongation factor Tu gene tuf2 as an attenuation-related gene. Infection & Immunity 81(8):

2812-2818.

Wang, F., Qiao, Z., Hu, S., Liu, W., Zheng, H., Liu, S., Zhao, X., and Bu, Z. 2013b. Comparison of genomes

of Brucella melitensis M28 and the B. melitensis M5-90 derivative vaccine strain highlights the

translation elongation factor Tu gene tuf2 as an attenuation-related gene. Infect Immun 81(8):

2812-2818.

Wen-Xing, L., Sen, H., Zu-Jian, Q., Wei-Ye, C., Lin-Tao, L., Fang-Kun, W., Rong-Hong, H., Zhi-Gao, B., and

Xiang-Rui, L. 2011. Expression, purification, and improved antigenic specificity of a truncated

recombinant bp26 protein of Brucella melitensis M5-90: a potential antigen for differential

serodiagnosis of brucellosis in sheep and goats. Biotechnol Appl Biochem 58(1): 32-38.

Willett, J.W., Herrou, J., Briegel, A., Rotskoff, G., and Crosson, S. 2015. Structural asymmetry in a

conserved signaling system that regulates division, replication, and virulence of an intracellular

pathogen. Proc Natl Acad Sci U S A 112(28): E3709-3718.

Page 21 of 39



Draft


22

Yao, L., Wu, C.X., Zheng, K., Xu, X.J., Zhang, H., Chen, C.F., and Liu, Z.F. 2015. Immunogenic response to

a recombinant pseudorabies virus carrying bp26 gene of Brucella melitensis in mice. Res Vet Sci 100:

61-67.

Yin, D., Li, L., Song, D., Liu, Y., Ju, W., Song, X., Wang, J., Pang, B., Xu, K., and Li, J. 2016. A novel

recombinant multi-epitope protein against Brucella melitensis infection. Immunol Lett 175: 1-7.

Zhang, Y., Li, T., Zhang, J., Li, Z., Zhang, Y., Wang, Z., Feng, H., Wang, Y., Chen, C., and Zhang, H. 2016.

The Brucella melitensis M5-90 phosphoglucomutase (PGM) mutant is attenuated and confers

protection against wild-type challenge in BALB/c mice. World J Microbiol Biotechnol 32(4): 58.

Page 22 of 39



Draft


23

Fig.1 Survival capabilities of different Brucella strains in HPT-8 embryonic

trophoblast cells. Cells were infected with M5-90 or M5-90∆bp26 at a multiplicity of

infection of 100. At the indicated time points, cells were lysed and bacterial loads

were quantified by plating serial dilutions on tryptone soy agar plates. *P < 0.05 and

**P < 0.01.

Fig.2 Clearance of M5-90△bp26 after infection. BALB/c mice were infected with 1

× 106 CFU/mouse of B. melitensis M5-90△bp26 or M5-90. At 1, 3, 7, 14 and 28 days

post-infection, spleens were harvested and individual spleens were assessed for (A)

colonization and (B) weight. Values are displayed as a mean per individual mouse ±

SD (n = 5 per time point). Differences in splenic weight and colonization were

determined via an unpaired t-test between M5-90△bp26 and M5-90; *P < 0.05.

Fig.3 Protection conferred by M5-90△bp26 against 16M. Twenty mice for each group

were challenged with 1 × 106 CFU of living B. melitensis 16M. At 2 weeks

post-challenge, spleens were harvested and the Log CFU in spleens of vaccine mice.

Fig.4 M5-90△bp26 and M5-90 challenge in BALB/c mice. Each group of mice (n =

20) were challenged with 1 × 106 CFU of living B. melitensis 16M. Mouse survival

was observed for up to 16 days post-challenge.

Page 23 of 39



Draft


24

Fig.5 The expression and Western-blot analysis recombinant BP26 protein. When

DE3 bacteria grow to logarithmic growth phase, IPTG was added to a final

concentration 1 mmol/L, induced 16h at 28℃, BP26 protein expression was observed

at a place 25-35kD specific bands, Western-Blot test showed that the strip with the

expected size of the protein is consistent 28kD. Line M: Protein Molecular Weight

Marker; Line 1: Uninduced E. coil DE3; Line2-5: SDS-PAGE analysis of the

expression of recombinant BP26 protein in E. coil DE3 2h, 4h, 6h, 8h; Line 6:

Purified BP26 protein; Line 7:Western-blot analysis of recombinant BP26 protein.

Fig.6 Concentrations of cytokines induced by B. Melitensis M5-90, M5-90△bp26 and

BP26 protein. HPT-8 cells were treated with M5-90△bp26, M5-90 or PBS in a total of

1 mL DMEM at a MOI of 100 for 24 h. The culture supernatants were collected and

IL-6, IL-10 and TNF-α level were determined by ELISA. The results are displayed as

a mean ± SD (n = 3). Significant differences between M5-90△bp26 and M5-90 are

indicated by *P < 0.05.

Fig.7 Detection in sheep serum samples using the ELISA method. Forty-two serum

samples were examined by ELISA using antigen (1:500), sheep serum (1:80) and

HRP AffiniPure Rabbit Anti-Sheep IgG (1:20,000). The critical value to deem a serum

sample positive was 0.247.

Page 24 of 39



Draft

92x74mm (300 x 300 DPI)

Page 25 of 39



Draft

152x50mm (300 x 300 DPI)

Page 26 of 39



Draft

125x75mm (300 x 300 DPI)

Page 27 of 39



Draft

104x75mm (300 x 300 DPI)

Page 28 of 39



Draft

101x129mm (300 x 300 DPI)

Page 29 of 39



Draft

67x49mm (300 x 300 DPI)

Page 30 of 39



Draft

327x242mm (300 x 300 DPI)

Page 31 of 39



Draft

Table 1 primer used in this work

Primer

name Sequence(restriction enzyme)(5’-3’) length Locus(gene)

up-F TCTAGAGGGCCCGGGGGACTCGAA 1100bp

bp26

upstream up-R GAGCTCCCATGGTCGTCCGACGAGC

dn-F TCTAGAGGGCCCGGGGGACTCGAA 1000bp

bp26

downstream dn-R GAGCTCCCATGGTCGTCCGACGAGC

sa-F GAGCTCGGGCTGGAAGAGCAGACCGCTA 1500bp SacB

sa-R GAGCTCGCTTATTGTTAACTGTTATTGTCC

wb-F AGCAGAACAGGCACGACTC 1279bp

wb-R GCGTTTTGTATCAGGTGGC

bp-F CCATGGCTAGCAATTTTCTCGCAG 753bp bp26

bp-R CTCGAGTTACTTGATTTTCAAAAACGAC

Page 32 of 39



Draft

Table 2a Clinical symptoms of mice inoculated with Brucella (1 x 106)

Mouse

number

Clinical symptoms of the mice

inoculated with the M5-90


inoculated with the M5-90△bp26

1 d 3 d 7 d 9 d 1 d 3 d 7 d 9 d

1 A B C D B C D D

2 A B C D B C D D

3 A B C D B C D D

4 A B C D B C D D

5 A B C D B C D D

6 A B C D B C D D

7 A B C D B C D D

8 A B C D B C D D

9 A B C D B C D D

10 A B C D B C D D

A) Lassitude; B) Turn better; C) Get right; and D) No apparent change.

Page 33 of 39



Draft

Table 2b Clinical symptoms of mice inoculated with Brucella (6 × 106)

Mouse

number





1d 3d 7d 9d 1d 3d 7d 9d

1 A C D E F

2 A C D E F

3 B A C D E F

4 B C A C D E F

5 B C C A C D E F

6 B C D E C D E F

7 B D E F C D E F

8 B D E F C D E F

9 B D E F C D E F

10 B D E F C D E F

A. Death; B. Prostrate, chills, clusters; C. Lassitude; D. Turn better;

E. Get right; F. No apparent change

Page 34 of 39



Draft

Table 2c Clinical symptoms of mice inoculated with Brucella (2 × 107)

Mouse

number





1d 3d 7d 9d 1d 3d 7d 9d

1 A C D E F

2 A C D E F

3 A C D E F

4 B A C D E F

5 B A C D E F

6 B C A C D E F

7 B C A C D E F

8 B C C A C D E F

9 B C D E C D E F

10 B C D E C D E F

A. Death；B. Prostrate, clusters, chills, difficulty walking；C. Prostrate, chills；

D. Lassitude, clusters, chills；E. Get right; F. No apparent change

Page 35 of 39



Draft

Table 3 Direct ELISA for detecting antibody to M5-90

HRP-Rabbit

anti-sheep

antibody

dilution ratio

Sheep positive serum dilution ratio

1:10 1:20 1:40 1:80 1:160 1:320

1:19000 1.145 1.115 1.118 1.120 1.055 1.002

1:20000 1.119 1.028 1.044 1.007 0.975 0.929

1:21000 1.045 0.934 0.768 0.822 0.702 0.758

1:22000 0.931 0.749 0.761 0.737 0.736 0.650

1:23000 0.866 0.709 0.697 0.473 0.260 0.289

Page 36 of 39



Draft

Table 4 Test of indirect ELISA for detecting Brucella antigen and rabbit anti-sheep antibody to BP26

HRP-Rabbit

anti-sheep

antibody dilution

ratio

Sheep Brucella Positive and Negative serum dilution ratio

1:10 1:20 1:40 1:80 1:160

＋－＋－＋－＋－＋－

1:100 1.963 0.189 1.951 0.192 1.901 0.196 1.873 0.165 1.426 0.129

1:200 1.942 0.187 1.751 0.194 1.654 0.178 1.533 0.139 1.130 0.106

1:300 1.860 0.143 1.557 0.108 1.658 0.180 1.397 0.162 1.307 0.102

1:400 1.629 0.146 1.667 0.106 1.459 0.113 1.255 0.107 1.126 0.104

1:500 1.428 0.109 1.546 0.128 1.256 0.105 1.109 0.117 0.486 0.096

1:600 1.178 0.196 1.155 0.175 0.880 0.098 0.634 0.077 0.314 0.076

1:700 0.908 0.093 0.893 0.072 0.558 0.064 0.504 0.017 0.310 0.024

＋Brucella Positive serum; －Brucella Negative serum

Page 37 of 39



Draft

Table 5 The STAT result of the sheep serum after inoculated M5-90 and M5-90△bp26

respectively

Strains Days post-infection

0d 7d 14d 21d 30d 45d

M5-90 －＋＋＋＋＋

M5-90△bp26 －－－－－－

＋：Positive result of STAT; －: Negative result of STAT

Page 38 of 39



Draft

Table 6 The ELISA result of the sheep serum after inoculated M5-90 and

M5-90△bp26 respectively

BP26

protein

dilution

ratio

The sheep serum after inoculated

M5-90 PBS

control

The sheep serum after inoculated

M5-90△bp26

7d 14d 21d 30d 37d 7d 14d 21d 30d 37d

1:100 1.100 1.672 1.781 1.753 1.747 0.081 0.267 0.418 0.572 0.531 0.372

1:200 0.983 1.513 1.586 1.681 1.693 0.083 0.219 0.257 0.403 0.306 0.226

1:400 0.889 1.338 1.302 1.409 1.511 0.079 0.207 0.220 0.246 0.234 0.213

1:500 0.832 1.322 1.273 1.358 1.432 0.080 0.178 0.193 0.198 0.189 0.185

1:800 0.771 1.119 1.154 1.125 1.109 0.088 0.155 0.173 0.185 0.177 0.161

1:1200 0.722 0.990 0.971 0.958 0.948 0.078 0.132 0.156 0.168 0.159 0.150

1:1600 0.584 0.835 0.793 0.772 0.765 0.088 0.110 0.119 0.139 0.124 0.117

1:2400 0.568 0.697 0.676 0.659 0.641 0.066 0.082 0.092 0.113 0.105 0.088

Page 39 of 39



Date post:	26-Jul-2019
Category:	Documents
Upload:	dokien
View:	215 times
Download:	0 times

Draft - University of Toronto T-Space · Draft Brucella melitensis M5-90 bp26 as a potential live...

Documents