ISSN: 1412-033X (printed edition) ISSN: 2085-4722...

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

J o u r n a l o f B i o l o g i c a l D i v e r s i t y V o l u m e 1 2 – N u m b e r 4 – O c t o b e r 2 0 1 1

FIRST PUBLISHED: 2000

ISSN:

1412-033X (printed edition) 2085-4722 (electronic)

EDITORIAL BOARD (COMMUNICATING EDITORS): Abdel Fattah N.A. Rabou (Palestine), Dato A. Latiff Mohamad (Malaysia), Alan J. Lymbery (Australia), Ali Saad Mohamed (Sudan),

Bambang H. Saharjo (Indonesia), Charles H. Cannon Jr. (USA), Edi Rudi (Indonesia), Guofan Shao (USA), Hassan Pourbabaei (Iran), Hwan Su Yoon (USA), Jamaluddin (India), Joko R. Witono (Indonesia), Katsuhiko Kondo (Japan), Livia Wanntorp (Sweden), Mahendra K. Rai (India), María La Torre Cuadros (Peru), Mariela A. Marinoff (Argentine), Mochamad A. Soendjoto (Indonesia),

Salvador Carranza (Spain), Shahabuddin (Indonesia), Sonia Malik (Brazil), Sugiyarto (Indonesia), Thaweesakdi Boonkerd (Thailand)

EDITOR-IN-CHIEF:

S u t a r n o

EDITORIAL MEMBERS: English Literary Editor: I Made Sudiana ([email protected])

Technical Editor & Banking: Solichatun ([email protected]) Distribution & Marketing: Rita Rakhmawati ([email protected])

Webmaster: Ari Pitoyo ([email protected])

MANAGING EDITORS: Ahmad Dwi Setyawan ([email protected])

PUBLISHER: Department of Biology, Faculty of Mathematics and Natural Sciences, Sebelas Maret University, Surakarta and

The Society for Indonesian Biodiversity

ADDRESS: Jl. Ir. Sutami 36A Surakarta 57126. Tel. +62-271-7994097, Tel. & Fax.: +62-271-663375, Email: [email protected]

BANKING: Solichatun, BNI KC Sebelas Maret, Acc. No. 0033691646

ONLINE: biodiversitas.mipa.uns.ac.id

ACCREDITED BY DECREE OF THE DIRECTORATE GENERAL OF HIGHER EDUCATION, THE MINISTRY OF NATIONAL EDUCATION, REPUBLIC OF INDONESIA No. 65a/DIKTI/Kep/2008 (valid until October 2011)

EXPERTISE AND CORRESPONDING EMAIL OF THE COMMUNICATING EDITORS: GENETIC DIVERSITY: Alan J. Lymbery ([email protected]), Hwan Su Yoon ([email protected]), Mahendra K. Rai

([email protected]), Salvador Carranza ([email protected]), Sonia Malik ([email protected]). SPECIES DIVERSITY: Dato A. Latiff Mohamad ([email protected]), Joko R. Witono ([email protected]), Katsuhiko Kondo ([email protected]), Livia

Wanntorp ([email protected]), Thaweesakdi Boonkerd ([email protected]). ECOSYSTEM DIVERSITY: Abdel Fattah N.A. Rabou ([email protected]), Ali Saad Mohamed ([email protected]), Bambang H. Saharjo ([email protected]),

Charles H. Cannon Jr. ([email protected]), Edi Rudi ([email protected]), Guofan Shao ([email protected]), Hassan Pourbabaei ([email protected]), Jamaluddin ([email protected]), Mochamad A. Soendjoto ([email protected]),

Shahabuddin ([email protected]), Sugiyarto ([email protected]). ETHNOBIOLOGY: María La Torre Cuadros ([email protected]), Mariela A. Marinoff ([email protected]).

BIODIVERSITAS ISSN: 1412-033X (printed edition)Volume 12, Number 4, October 2011 ISSN: 2085-4722 (electronic)Pages: 187-191 DOI: 10.13057/biodiv/d120401

Leaf endophytic fungi of chili (Capsicum annuum) and their role in theprotection against Aphis gossypii (Homoptera: Aphididae)

HENY HERNAWATI, SURYO WIYONO♥, SUGENG SANTOSODepartment of Plant Protection, Faculty of Agriculture, Bogor Agricultural University. Jl Kamper, IPB Campus, Darmaga, Bogor 16680, West Java,

Indonesia, Tel.: +62-251-8423064, Fax: +62-251-8629364, ♥email: [email protected]

Manuscript received: 11 April 2011. Revision accepted: 5 August 2011.

ABSTRACT

Hernawati H, Wiyono S, Santoso S (2011) Leaf endophytic fungi of chili (Capsicum annuum) and their role in the protection againstAphis gossypii (Homoptera: Aphididae). Biodiversitas 12: 187-191. The objectives of the research were to study the diversity of leafendophytic fungi of chili, and investigate its potency in protecting host plants against Aphis gossypii Glov. Endophytic fungi wereisolated from chili leaves with two categories: aphid infested plants and aphid-free plants, collected from farmer’s field in Bogor, WestJava. Abundance of each fungal species from leave samples was determined by calculating frequency of isolation. The isolated fungiwere tested on population growth of A. gossypii. The fungal isolates showed suppressing effect in population growth test, was furthertested on biology attributes i.e. life cycle, fecundity and body length. Five species of leaf endophytic fungi of chili were found i.e.Aspergillus flavus, Nigrospora sp., Coniothyrium sp., and SH1 (sterile hypha 1), SH2 (sterile hypha 2). Even though the number ofendophytic fungi species in aphid-free and aphid-infested plant was same, the abundance of each species was different. Nigrospora sp.,sterile hyphae 1 and sterile hyphae 2 was more abundant in aphid-free plants, but there was no difference in dominance of Aspergillusflavus and Coniothyrium sp. Nigrospora sp., SH1 and SH2 treatment reduced significantly fecundity of A. gossypii. Only SH2 treatmentsignificantly prolonged life cycle and suppress body length, therefore the fungus had the strongest suppressing effect on populationgrowth among fungi tested. The abundance and dominance of endophytic fungal species has relation with the infestation of A. gossypiiin the field.

Key words: leaf endophytic fungi, chili, biological control, resistance, Aphis gossypii.

INTRODUCTION

Endophytic fungi are fungi colonize internally planttissue, without giving detrimental effect to the host plant(Petrini 1992; Avezedo 2000). They act as symbiont,mediated plant resistance against biotic stress i.e. pests anddiseases and abiotic stress such as drought and extreme oftemperature. The previous research in temperate regionshowed that endophytic fungi have detrimental effect onsome insects from various taxonomic groups. For instance,endophytic fungi on grasses have been reported to inhibitthe growth and development of the feeding insects. Thecolonization of an endophytic fungus Acremoniumcoenophialum Morgan-Jones et. Gams in tall fescue(Festuca arundinacea Schreb.) deterred the feeding ofRhopalosiphum padi Rondani and Schizaphis graminumRondani (Johnson et al. 1985). In addition, Sabzalian et al.(2004) reported the significant inhibition of populationgrowth of mealybug Phenacoccus solani Ferris and barleyaphid, Sipha maydis Passerini, on fungal endophyte-infected tall and meadow fescues. Moreover, the larvalgrowth of Popillia japonica beetle larvae also inhibited ininfected Taraxacum laxum by an endophyte Neotyphodiumsp. (Richmond et al. 2004).

However up to now, study on this field is conductedmostly in grasses and in some more recent research works,

are on trees. The research on dicotyl-annual plant such aschili, is not available. System chili-Aphis gossypii Glov.was chosen due to the importance of chili as mainvegetable crops in Indonesia and A. gossypii is a vector ofvarious viral diseases. The objectives of the research wereto study the diversity of leaf endophytic fungi of chili, andto examine their effect on the population growth and somebiological aspects of Aphis gossypii.

MATERIALS AND METHODS

Location and timeThe research was carried out in Laboratory of Plant

Mycology and Laboratory of Insect Ecology, Departmentof Plant Protection, Faculty of Agriculture, BogorAgricultural University on April-October 2007.

Isolation, identification and quantification of leavesfungal endophyte

Isolation leaf fungal-endophytes of was carried out bymodified technique of Petrini (1992). Sample of chilileaves without necrotic symptom was obtained from twocategory i.e. aphids-free plant, and plant with aphids, each40 samples, originated from farmers field in Cibungbulang,Bogor, West Java, Indonesia (ca. 150 m asl). The leaves

BIODIVERSITAS 12 (4): 187-191, October 2011188

were disinfected two times with 70% ethanol and 1%sodium hypochloride, each for three minutes, then rinsedby sterilized water and excessive water tapped by towelpaper and plated on medium potato dextrose agar (PDA)pH 5.5. Endophytic fungi were then purified by re-culturing on PDA. After colony age of one week, theisolated fungi was purified and collected. The sporulatedfungal isolates were directly identified. Non-sporulatingfungal-isolates were induced the sporulation by growing inS-medium (CaCO3, sucrose 10 g/L, aquadest 1000 ml) (Hanada et al. 2010), and incubated under near ultra violet(NUV) for 14 days. Identification was conducted up togenus level using identification books of Barnett andHunter (1988) and Hanlinn (1990).

Non sporulating endophytic fungi i.e. SH 1 and SH2were molecular identified based on 18 S rDNA. Extractionof DNA was conducted based on methods of modifiedOrozco-Castillo et al. (1994). Amplification of fungal DNAusing pair of primer ITS1 5’ TCCGTAGGTGAACCTGCGG3’ and ITS4 5’ TCCTCCGCTTATTGATATGC 3’ thatamplify region internal transcribed spacer (ITS) ribosomalDNA (rDNA) (White et al. 1990). DNA resulted from PCRthen sequenced and examined the homology with referencecollections of Genebank using BLAST program(www.ncbi.nlm.nih.gov). Species or genus was determinedbased on percentage of similarity (Arnold and Lutzoni2007; Crozier et al. 2006).

Abundance of leaf endophytic fungi was depicted byfrequency of isolation, in which calculated by the percentageof samples with certain endophyte. The frequency of isolationthen compared between aphid free plants and plant withaphids. The collected endophytic fungi were stored on testtube containing PDA and store at 5°C. Propagation wascarried out by reculturing this isolate on PDA. The 14-daysold colony of endophyte was used for inoculation.

Rearing of aphidsAn adult of A. gossypii from the chili plant in the field

in Bogor was kept on free insect potted chili plant. Afterspecies determined using identification book Blackman andEastop (2000), the progeny was reared on chili plant toobtain homogenous population. First nymph of thepopulation was then used for experiment of biology andalso population growth.

Inoculation of endophytic fungiSuspension of conidia was used as inoculum for

sporulating fungi, and mycelial fragment was applied fornon-sporulating fungi. Conidia of fungi were harvestedfrom 14-days old culture. A PDB-based 14-days old colonyof non-sporulating fungi, filtered, washed with sterilizedwater then mixed with sterilized water and blended withmedium speed for two minutes. Both are assessed thedensity by direct count with a haemacytometer under lightmicroscope with 10 x 10 magnification. Both types ofsuspension were adjusted to 10 4 cfu/mL. Inoculation wasdone twice, first by seed treatment, second by propagulesspraying. Before treatment the seed was treated with hotwater at 52°C for 20 minutes to eliminate possible existingfungi on and inside the seeds. Seeds of chili cv. Hot pepper

was soaked by conidia suspension for 6 hours, then grownin sterilized soil in pot. Conidial spraying was conducted at10 days after transplanting, aided by hand sprayer withapplication volume of 50 mL/individual plants. For control,seeds was only soaked and then the plants sprayed bysterilized water.

Endophyte colonization studyThe aim of this test was to investigate whether the isolated

fungi are able to colonize leaves of chili. Endophytetreatment was carried out by seeds application and sprayingplants leaves at 10 days after transplanting, each treatmentconsisted of ten plants. Leaves of each plant were plated onPDA pH 5.5 at 20 days after transplanting. The growth ofthe fungi the same as inoculated in media indicating thatthe tested fungi are able to colonize the leaves.

The effect of leaf-endophytic fungi on the populationgrowth of A. gossypii

Two first nymph of A. gossypii were inoculated on chilipotted plant. The plant was grown in a cheesecloth cages toavoid migration and attack of natural enemies and laid undergreenhouse. Five plants as replication were used in thisstudy. Treatment consists of endophytic fungi i.e. Aspergillusflavus, Nigrospora sp., Coniothyrium sp., sterile hypha 1(SH1) and sterile hypha 2 (SH2), control (water). One plantwas considered as one replication. The observation wasdone each 3 days with aided by hand counter for 30 days.

The effect of fungal endophyte on the biology of A. gossypiiTreatment consisted of endophytic fungus i.e. Aspergillus

flavus, Nigrospora sp., Coniothyrium sp., sterile hypha 1and sterile hypha 2, and control (water). The detachedleaves of endophyte inoculated plants and control plantswere laid on petridish diameter 9 cm and the basal ofpetiole was covered by moistened cotton. A first nymph ofA. gossypii was laid on leaf, and each 3 days the leaf wasreplaced by the new and similar size from the same plants.The observation was made on the periods of each nymph,pre-natal periods, life cycle, and fecundity. In addition,body length was also measured microscopically usingmicrometer. If the insect produce progeny then itsprogenies was killed. The 20 petridishes were used; onepetridish was considered one replication. The experimentwas designed in randomized complete design.

The effect of leaf-endophytic fungi on body size of A. gossypiiThe aphid treatment was same as in biology experiment.

Each instars of aphid’s nymph was measured longitudinallyusing micrometer, under a compound microscope with 40 x10 magnifications.

Data analysisFrequency of isolation of endophytic fungi was arranged

in cross tabulation, and compared the value for assessingabundance of each fungus. Variables such as life cycle,fecundity and body length were statistically analyzed usinganalysis of variance (ANOVA). When ANOVA resultedsignificant different, Duncan Multiple Range Test (DMRT)was applied for comparing mean of each variables.

HERNAWATI et al. – Leaf endophytic fungi of Capsicum annuum 189

RESULTS AND DISCUSSION

Based on the sample number used in the research (40plants from the field of Bogor), the species diversity offungal endophyte was low. Only five species found i.e.Aspergillus flavus, Nigrospora sp., Coniothyrium sp. andsterile hypha 1 (SH1), and sterile hypha 2 (SH2) (Table 1).SH1 and SH2 did not produce conidia to allow furtherspecies identification morphologically. Further molecularidentification based on 18 S rDNA resulted that SH1similar (99%) to Accession FJ524323 of GeneBank refer toUnculture endophytic fungus clone R3-63, obtained fromwild rice root in China (Yuan et al. 2010) (Table 2). SH2was similar to Accession No FJ612897 of GeneBank,Fungal sp ARIZ B031, endophytic fungus of tree Cecropiainsignis (U’Ren et al. 2009). The rank of species from themost abundant to the least was Nigrospora, SH2, SH1,Coniothyrium sp. and A. flavus respectively. Low speciesdiversity of chili plants may be related to high rate offungicide frequency application in this area (once perweek). Gaitan et al. (2005) noted that fungicide applicationreduced the diversity of endophytic leaf fungi of a tropicaltree Guarea guidonia L.

Table 1. Frequency of isolation of leaf endophytic fungi on chilifrom bogor

Isolation frequency (%)Endophytic fungiAphid-free plant Plant with aphid

Aspergillus flavus 10 10Nigrospora sp. 30 15Coniothyrium sp. 25 20SH1 55 25SH2 60 15Note: number of leaves with aphid and aphid-free, each 40 from40 plants.

Table 2. Molecular identification of non-sporulating endophyticfungi

Isolatenumber Category

GeneBankreferenceaccession

Maximumidentity (%)

SH1 Unculture endophyticfungus clone R3-63

FJ524323 99

SH2 Fungal species ARIZB031

FJ612897 99

Even though there was no difference on the speciesnumber of fungi between aphid-infested and aphid-freeplants, the abundance of each fungus was greatly different.Abundance (indicated by frequency of isolation) ofNigrospora sp., SH 1 and SH2 was higher in aphid-freeplants than of aphid-infested plants (Table 1). Otherendophytic fungi: Aspergillus flavus, Coniothyrium sp. hasno different abundance between aphid-infested and aphid-free plants.

All isolated fungi can act as endophytes proven by theircolonization ability-lowest frequency was A. flavus and

other fungi reached more then 80% frequency of reisolation(Table 3). All of isolated fungi have no potency to bepathogens, indicated by negative result of pathogenicitytests (data not shown). Aspergillus has rarely been reportedas leaf endophyte, but this work resulted that this species asleaf endophyte of chili and proven by colonization test. Therole of Aspergillus as leave endophyte has been reported insoybean and neem trees (Pimentel et al. 2006; Verma et al.2007). Other fungal endophytes isolated in this study wereConiothyrium sp. and Nigrospora sp., the two genera hadbeen reported as leave endophyte in various plants such asQuercus alba L, neem tree, banana tree Ulmus davidianavar. japonica and Parthenium hysterophorus (Fisher et al.1994; Romero et al. 2001; Tomita et al. 2003; Photita et al.2004; Verma et al. 2007). The presence of sterile hypha asendophyte in this research is also common in otherendophyte research on various host plants (Fisher et al.1994; Pimentel et al. 2006; Verma et al. 2007).

Table 3. Frequency of reisolation of leaf endophytic fungi on chili

Endophytic fungi Frequency of reisolation

Control 0Aspergillus flavus. 70Coniothyrium sp. 80Nigrospora sp. 90SH1 80SH2 80

Further test showed that Nigrospora sp., SH1 and SH2reduce population growth of A. gossypii, with SH2 providehighest suppression (Figure 1). This was indicated by delayingpeak of population growth curve and reducing populationdensity by these fungi treatments. Untreated or control hadpeak of population growth at 18 days. Population growthcurve reached a peak at 18, 20 and 20 days for Nigrosporasp. SH1 and SH2 respectively. Nigrospora sp. SH1 andSH2 suppressed population density at average rate of29.05%, 40.36% and 54.37% respectively.. Populationgrowth curve reach a peak at 16 and 18 days andsuppressing rate of 0.00%and 19.23% for Aspergillusflavus and Coniothyrium sp. respectively. It can be said thatAspergillus and Coniothyrium sp. has minor effect onpopulation growth of A. gossypii, consequently those fungiwere not further used in life cycle and fecundity test.

In life cycle test, only SH2 showed the effect i.e. pro-longing life cycle by 10.77%. The endophyte SH2 treatmentprolonged significantly nymph periods, pre-ovipositionperiods and life cycle of A. gossypii (Table 4). Other testedendophytic fungi did not affect these parameters.

All of tested fungi reduced significantly the fecundityof A. gossypii (Table 5). The reduction of fecundity was41.36%, 49.32%, and 53.11% for SH1, SH2 andNigrospora sp. respectively. Aside from suppressingfecundity and prolonged life cycle, SH2 endophyte reducedA. gossypii body length. Other tested fungal endophyte,even though tended to reduce this parameter too, but notsignificant. Again, SH2 endophyte showed the strongestinhibitory effect on A. gossypii.


Day

0 5 10 15 20 25 30

Num

ber o

f aph

ids/

plan

t

0

200

400

600

800

1000

ControlAspergillus flavusConiothyrium sp.Nigrospora sp.SH1SH2

Figure 1. Population growth of A. gossypii on endophyte-infectedchili plants.

Table 4. Life cycle of A. gossypii on endophyte-treated leaves

Treatment Nymphperiods

Pre-ovipositionperiods (days)

Life cycle(days)

Control 5.25±0.13 b 1.25±0.46 a 6.45±0. 31 bNigrospora sp. 5.13±0.05 b 1.35±0.34 a 6.45±0.43 bSH1 5.32±0.12 b 1.25±0.57 a 6.55±0. 27 bSH2 5.85±0.16 a 1.35±0.63 a 7.20±0. 19 aNote: number followed by different symbol in the same column issignificantly different according DMRT test with P<0.05

Table 5. Fecundity of A. gossypii on endophyte-treated leaves

Treatment Total

Control 29.62±3.58 aNigrospora sp. 13.89±5.84 bSH1 17.37±3. 88 bSH2 15.31±4.65 b

Note: number followed by different symbol in the same column issignificantly different according DMRT test with P<0.05

By comparing exploratory data and experimental data,it can be said that there is relation between the abundanceof endophytic fungi and anti insect activity of fungi. Fungihaving no different abundance between aphid-free andaphid-infested, such as Aspergillusflavus and Coniothyrium sp., haveminor effect on the suppression ofaphid population. On the contraryendophytic fungi with highdominance in aphid-free plant, havesignificant suppressing effect onaphid population, and inhibit someother aphid biological attributes i.e.fecundity, life cycle, body size, eventhough the inhibitory effect variedamong species. Thus, the facts showthat colonization of later groups of

endophytic fungi play important role on the protection ofchili plant against aphid in the field.

Previous worker reported that some endophytic fungihas mediated plant resistance on phytophagous insectsfrom various taxa i.e., aphid, grasshopper, cotton ballwormand beetle (Johnson et al. 1985; McGee et al. 2003;Richmond et al. 2004; Sabzalian et al. 2004; Avezedo2000). However, most of research was done with grasses intemperate region. Our finding show for the first time incultivated annual crops i.e. chili that endophytic fungi isable to suppress the growth, development and populationgrowth of A. gossypii. One isolate SH2, beside prolongedlife cycle, also decreased fecundity, therefore had strongesteffect on decreasing population growth of A. gossypii.Other tested endophytic fungi (SH1, SH2 and Nigrosporasp.) decreased fecundity but had no effect on life cycle. Theother important point was some endophytic fungi i.e.Nigrospora sp. and SH2, suppressed the body length ofaphids (Table 6). The reduction of body size of aphids dueto endophyte treatment was also reported on aphidRhopalosiphum padi on ryegrass inoculated by endophyteNeotyphodium lolii (Meister et al. 2006). Thus, the fungiaffected not only the development but also growth of A.gossypii.

The experiment showed obviously that some fungal leafendophyte treatments play a role in protecting chili againstA. gossypii. It is known that non preference and antixenosisare main mechanism in increasing host resistance againstinsects mediated by fungal endophyte (Johnson et al. 1985;Faeth et al. 2002; Lehtonen et al. 2005). Antixenosis isproven in this research showed by suppression offecundity, prolonged life cycle and decreased body size.Non-preference was not elaborated in this study, thereforeneeds further investigation.

Inhibitory effect of endophyte on feeding insects ismostly due to toxin produced by fungal endophyte.Endophytic fungi alone or in association with host plant areable to produce toxin (Petrini 1992; Sumarah and Miller2009). Highly diverse groups of toxin produced by fungalendophyte i.e. alkaloids, terpenoid, steroid, quinone, andflavonoid, phenylpropanoids and lignans, peptides, phenol,phenolic acids and aliphatic compounds (Tan and Zou2001). Siegel et al. (1990) stated that toxin produced ingrasses infected by endophyte Acremonium coenophialumand Epichloe typhina is peramine, lolitrem B andergovaline. Moreover reported that endophytic fungusPhyllosticta sp. and Hormonema dematioides in balsam fir

Table 6. Effect of endophyte-treated leaves on body length of A. gossypii

Body length (mm)Nymph-instarTreatment

1 2 3 4Adults

Control 0.42±0.15 a 0.58±0.25 a 0.73±0.16 a 0.94±0.09 a 1.17±0.06 aSH1 0.42±0.24 a 0.58±0.22 a 0.76±0.18 a 0.91±0.073 a 1.12±0.04 abSH2 0.41±0.22 a 0.57±0.23 a 0.71±0.11a 0.89±0.15 a 1.08±0.03 bNigrospora sp. 0.41±0.19 a 0.61±0.20 a 0.75±0.24 a 0.89±0.11 a 1.12±0.03 abNote: number followed by different symbol in the same column is significantly differentaccording DMRT test with P<0.05

HERNAWATI et al. – Leaf endophytic fungi of Capsicum annuum 191

produce toxic compounds, mainly heptelidic acid andrugulosine (Avezedo 2000; Sumarah et al. 2008).Nodulisporic acid, benzofuran derivates and naphthaleneare also insecticidal substances produced by endophyticfungi (Sumarah and Miller 2009). Possible mechanismother than toxin production is the change of plantmetabolism such as sterol metabolism which not favors theinsects (Avezedo 2000). The exact mechanism and the typeof toxin associated with the increasing chili resistanceagainst A. gossypii mediated by fungal endophyte needfurther investigation.

CONCLUSION

Endophytic fungi isolated from chili in Bogor areAspergillus favus, Coniothyrium sp., Nigrospora sp., sterilehypha 1 (SH1) and sterile hypha 2 (SH2). Colonization ofsome endophytic fungi has important role in the protectionof chili plants against Aphis gossypii. Some of those fungii.e. SH1, SH2, and Nigrospora sp. are able to increaseresistance chili against A. gossypii, in which SH2 has thestrongest effect. This plays an initial basis for using fungalleaf endophytes as biocontrol agent against pests of chili.Better understanding on the aspects related to endophyticfungi of chili leaves, such as mechanism involve, type ofproduced toxin, mode of transmission, spectrum of affectedinsect pests, host-environment relation, should befurthermore elaborated to obtain appropriate strategy andtechnique for the use in biological control.

ACKNOWLEDGMENT

Second author acknowledge to Damayanti and Efi T.Tondok member of Laboratory of Plant MycologyDepartment of Plant Protection Bogor AgriculturalUniversity for their assistance in molecular work onidentification of endophytic fungi.

REFERENCES

Arnold AE, Lutzoni F. (2007) Diversity and host range of foliar fungalendophytes: are tropical leaves biodiversity hotspots? Ecology 88:541-549.

Avezedo JL (2000). Endophytic microorganisms: a review on insectcontrol and recent advances on tropical plants. E J Biotech3: 40-65

Barnett J, Hunter B (1988) Illustrated genera of imperfect fungi. BurgesPublishing Company. Virginia

Blackman RL, Eastop VF (2000) Aphids on the world crops: Anidentification and information guide. John Wiley and Sons. New York

Crozier J, Thomas SE, Aime MC, Evans HC and Holmes KA (2006)Molecular characterization of fungal endophytic morphospecies isolatedfrom stems and pods of Theobroma cacao. Plant Pathol 55: 783-791

Faeth SH (2002) Are endophytic fungi defensive plant mutualists? Oikos98:25-36.

Fisher PJ, Petrini O, Petrini E, Sutton BC (1994) Fungal endophytes fromthe leaves and twigs of Quercus ilex L. from England, Majorca andSwitzerland. New Phytol 127:133-137

Gaitán MAG, Wen S, Fetcher N, Bayman P (2005). Effects of fungicideson endophytic fungi and photosynthesis in seedlings of a tropical tree,Guarea guidonia (Meliaceae). Acta Biol Colombiana 10: 41-47

Hanada RE, Pomella AWV, Costa HS, Bezerra JL, Loguercio LL, PereiraJO (2010) Endophytic fungal diversity in Theobroma cacao (cacao)and T. grandiflorum (cupuacu) trees and their potential for growthpromotion and biocontrol of black-pod disease. Fungal Biol 114: 901-910

Hanlinn T (1990). Illustrated genera of Ascomycetes. APS Press. MinnesotaJohnson MC, Dahlman DL, Siegel MR, Bush LP, Latch GCM, Potter DA,

Varney DR (1985). Insect feeding deterrents in endophyte-infectedtall fescue. App Environ Microbiol 49:568-571

Lehtonen P, Helander M, Saikkonen K (2005) Are endophyte-mediatedeffects on herbivores conditional on soil nutrients? Oecologia 142:38-45

McGee P, Dingle J, Mac Arthur D, Creighton N, Istifadah N (2003)Endophytic fungi add to plant defenses. Microbiol Australia 24: 42-47

Meister B, Krauss J, Harri SA, Schneider MV, Mueller CB (2006) Fungalendosymbionts affect aphid population size by reduction of adult lifespan and fecundity. Basic App Ecol 7: 244-252

Orozco-Castillo C, Chalmers KJ, Waugh R, Powel W (1994) Detection ofgenetic diversity and selective gene introgression in coffee usingRAPD markers. Theor App Gen 93:934-940

Petrini O (1992) Fungal endophytes of tree leaves. In: Andrews JH,Hirano SS (eds). Microbiology of leaves. Springer. New York.

Photita W, Lumyong S, Lumyong P, McKenzie EHC, Hyde KD (2004)Are some endophytes of Musa acuminata latent pathogens? FungalDiv 16: 131-140.

Pimentel IC, Glienke-Blanco C, Gabardo J, Stuart RM, Azevedo JL(2006) Identification and colonization of endophytic fungi fromsoybean (Glycine max (L.) Merril) under different environmentalconditions. Braz Arch Biol Technol 49: 705-711

Richmond D, Parwinder S, Grewal S, Cardina J (2004) Influence ofjapanese beetle Popillia japonica larvae and fungal endophytes oncompetition between turfgrasses and dandelion. Crop Sci 44:600-606

Romero A, Carrion G, Rico-Gray V (2001) Fungal latent pathogens andendophytesfrom leaves of Parthenium hysterophorus (Asteraceae).Fungal Div 7: 81-87.

Sabzalian MR, Hatami B, Mirlohi, A (2004). Mealybug, Phenacoccussolani, and barley aphid, Sipha maydis, response to endophyte-infected tall and meadow fescues. Entomol Exp App 113: 205-209

Siegel MR, Latch GCM, Bush LP, Fannin FF, Rowan DD, Tapper BA,Bacon CW, Johnson MC. 1990. Fungal endophyte-infected grasses:alkaloid accumulation and aphid response. J Chem Ecol 16: 3301-3315.

Sumarah MW, Adams GW, Berghout J, Slack GJ, Wilson AM, Miller JD(2008) Spread and persistence of a rugulosin-producing endophyte inPicea glauca seedlings. Mycol Res 112: 731-736

Sumarah MW, Miller JD (2009) Anti-insect secondary metabolites fromfungal endophytes of conifer trees. Nat Prod Commun 4:1497-504.

Tan RX, Zou, WX (2001) Endophytes: a rich source of functionalmetabolites Nat Prod Rep 18: 448-459

Tomita, F. (2003). Endophytes in Southeast Asia and Japan: theirtaxonomic diversity and potential applications. Fungal Div 14: 187-204.

U'Ren JM, Dalling JW, Gallery RE, Maddison DR, Davis EC, GibsonCM, Arnold AE (2009) Diversity and evolutionary origins of fungiassociated with seeds of a neotropical pioneer tree: a case study foranalysing fungal environmental samples. Mycol Res 113: 432-449

Verma VC, Gond SK, Kumar A, Kharwar R (2007) The endophyticmycoflora of bark, leaf, and stem tissues of Azadirachta indica A.Juss (Neem) from Varanasi (India). Microbial Ecol 54:119-125

White T J, Bruns T, Lee S, Taylor J (1990) Amplification and directsequencing of fungal ribosomal RNA genes for phylogenetics. In:Innis M, Gelfand DH, Sninsky JJ, White TJ (eds). PCR Protocols.Academic Press, San Diego.

Yuan ZL, Zhang CL, Lin FC , Kubicek CP (2010) Identity, diversity, andmolecular phylogeny of the endophytic mycobiota in the roots of rarewild rice (Oryza granulate) from a nature reserve in Yunnan, China.Appl Environ Microbiol 76 : 1642-1652


Isolation and identification of an agar-liquefying marine bacterium andsome properties of its extracellular agarases

FATURRAHMAN1,3,♥, ANJA MERYANDINI1, MUHAMMAD ZAIRIN JUNIOR2, IMAN RUSMANA1

1Department of Biology, Faculty of Mathematics and Natural Sciences, Bogor Agricultural University, Darmaga, Bogor 16680, West Java, Indonesia2Department,of Aquaculture, Faculty of Fisheries, Bogor Agricultural University, Darmaga, Bogor 16680, West Java, Indonesia

3Departement of Biology, Faculty of Mathematics and Natural Sciences, Mataram University. Jl.Majapahit 62, Mataram 83125, West Nusa Tenggara,Indonesia. Tel./fax +62-370-646506, email:[email protected]

Manuscript received: 23 June 2011. Revision accepted: 23 August 2011.

ABSTRACT

Faturrahman, Meryandini A, Junior MZ, Rusmana I (2011) Isolation and identification of an agar-liquefying marine bacterium andsome properties of its extracellular agarases. Biodiversitas 12: 192-197. A new agar-liquefying bacterium, designated Alg3.1, wasisolated from Gracilaria samples collected from the Kuta Coast at Central Lombok in West Nusa Tenggara and was identified asAeromonas sp. on the basis of morphology, biochemical-physiological character and 16S rDNA gene sequencing. The bacteriumappeared capable of liquefying agar in nutrient agar-plate within 48 hours of incubation and the agar was completely liquefied after l5days at 29oC. When the isolate was grown in basal salts solution medium B supplemented with peptone and yeast extract, producedextracellular agarases within a short period of time (4-16 h) and the maximum agarase activity was 0.489 nkat/mL at 36h after incubation.

Key words: Gracilaria, agarase, agar-liquefying, Aeromonas.

INTRODUCTION

Indonesia is rich country with various kinds of algae.The results of Sibolga expedition shows that there are 782species of algae in Indonesia which consist of 179 greenalgae, 134 brown algae and 452 species of red algae(Nontji 2007). One group of red alga, agarophyte produceagar-agar, a complex polysaccharide present in the cellwalls, up to 47.34% (Soegiarto and Sulistijo 1985).

Agar-agar can be degraded by several bacterial strainsfrom marine environments and other sources. Agarolyticbacteria are ubiquitous in coastal and estuarine regions;however, they are not exclusively autochthonous in themarine environment, since some reports have shown that theyalso occur in freshwater, sewage and soil (von Hoffsten andMalmqvist 1974; van der Meulen et al. 1976; Agbo andMoss 1979). Some of bacteria isolates have been identifiedand classified in to Actinomyces, Agarivorans, Alterococcus,Alteromonas, Microbulbifer, Cellulophaga, Cytophaga,Streptomyces, Vibrio, Pseudomonas, Saccharophagus,Pseudoalteromonas, Zobellia, and Bacillus (Macian et al.2001; Yoon et al. 1996; Jean et al. 2006; Khambhaty2008). It is possible to utilize of bacteria which canproduced agarase enzymes, which can degrade agar intoamount of oligosaccharides and D-galactose.

D-galactoses can be catabolytic into piruvic acid viaTagatosa or Leloir pathway by yeast or other bacteria,furthermore the fermented of piruvic acid produce largeamounts of alcohol, acetic and formic acids. Beside that,agarase can be used to degrade the cell walls of marinealgae for extraction of labile substances with biological

activities and for the preparation of protoplasts, as well asisolation of monoclonal hybrids. The polysaccharidefractions can be applied for functional foods. Agarase haveapplications in food, cosmetics, and medical industries bydegrading agar. The polysaccharides produced byhydrolysis of agar can promote immunity in mice byabdominal injection or feeding. Some researches haveshown that adding 5% agaropectin to diet suppressedsignificantly the increasing in cholesterol level in plasma ofrats. Anti-hypercholesterolemic effect of rats also wasobserved (Sie et al. 2009)

In our laboratory, we have isolated a few agar-softeningand agar-liquefying bacteria strains from the Kuta Coast ofCentral Lombok to characterize their extracellular agarases.We describe here the identification of a new agarolyticbacteria strain, Aeromonas sp. strain Alg3.1, andidentification of hydrolysis product from agarase, and toasses their possibility to produce bioethanol.


Sampling. Seaweed samples were collected from the KutaCoast at Central Lombok, West Nusa Tenggara, Indonesia.

Enrichment and isolation of agarolytic bacteria.Erlenmeyer flasks (250 mL) containing sterile river water(100 mL), to which 0.1% (w/v) Oxoid agar had been added,were inoculated with samples and incubated at 29oC on arotary shaker for 4 d (Agbo and Moss 1979). Samples (0.1mL) of the cultures were then plated on nutrient agar (withsea water) and a basal salt solution medium B (Hofsten and

FATURRAHMAN et al. – Agar-liquefying marine bacterium 193

Malmqvist 1975) containing (%): NaNO3 (0.2); K2HP04 (0.05);MgS04.7H20 (0.02); MnS04.7H20 (0.002); FeS04.7H20 (0.002);CaCl2.2H2O (0.002); Oxoid no. 3 agar (15); adjusted to pH7.2 before autoclaving at 121oC for 15 min. Plates wereincubated at 28oC and examined daily for agarolyticactivity, assessed by liquefaction or shallow depressionsappearing around the colonies. After 7 d, plates wereflooded with Iodine and the appearance of pale-yellowzones around colonies against a brown-violet backgroundwas considered indicative of some agar-degrading activityin the absence of the visible signs already referred to. Allcolonies showing liquefaction or depressions in the agarwere picked off and purified by streaking out on mineral ornutrient agar (Agbo and Moss 1979).

Representative agar-degrading strains were maintainedin Dubos' solution containing (g L-l): NaNO3 (0.5);K2HPO4 (0.1); MgS04.7H2O (0.5); FeSO4.7H2O (0.01);adjusted to pH 7.2, dispensed into bijou bottles andsterilized at 121 oC for 15 min.

Colonial and cell morphology. Colonial characteristicsand pigmentation were studied on plates of nutrient agar,on marine agar, medium B agar and medium TCBS.Motility (hanging drop), Gram-staining isolates were doneon bacteria grown in peptone (1.5%, w/v) water for 48 h.

Physiological biochemical tests. Strain Alg3.1 wascharacterized and indentified using standard physiologicaland biochemical plate and test tube, API 20E kits (ATBsystem, Biomerieux SA, Marcy-I’Etoile, France). Theability of isolate hydrolyze Starch and cellulose (CMC)was examined by incubating plates of yeast extract agar(Difco) containing 0.2% (w/v) soluble starch for 48h andthen flooding with Lugol's iodine or congo red. Antibioticsensitivity was tested to ampicillin (10 and 30 µg),tetracycline (10µg), vancomycin (30µg), erythromycin(15µg) and rifamicin (5µg) by using paper disk method byJohnson and Case (2007).

Phylogenetic analysis of isolates based on 16S rDNAsequencing. For DNA extraction, bacteria were grown for2 days at 29oC on MA medium. A single colony of isolatewas took with a sterile toothpick, resuspended in 20 mL ofsterile distilled water, and heated at 95oC for 10 min tolyses the cells. The lysate was then cooled on ice, brieflycentrifuged with a microcentrifuge, and used for PCRamplification.

The DNA coding for the 16S rRNA of isolate wasamplified with 63f primer (5’-CAG GCC TAA CAC ATGCAA GTC-3’) and 1387r primer (5’-GGG CGG WGTGTA CAA GGC-3’) (Marchesi et al. 1998). Amplificationwas done as follows: each mixture consisted of 2.0 µL of10x Taq reaction buffer (100 mM Tris-HCl, pH 8.3; 500mM KCl, 20 mM MgCl2), 1.2mM of each primer, 0.2mMof each deoxynucleoside triphosphate (Sigma, St. Louis,MO, USA) and 2.5 units of Taq DNA polymerase (Takara,Cina), and 1 µg of DNA template in a total reaction volumeof 50µL. The reaction mixtures were incubated in athermocycler GeneAmp PCR System 2400 Perkin Elmer,(New Jersey) at 95oC for 5 min and then put through 30cycles of 92oC for 30s, 55oC for 30s, and 72oC for 1 min.Successful amplification were confirmed by electrophoresis of5 µL PCR products on a 1% agarose agar. Finally, the

amplified 16S rDNA was purified by using a QiaquickPCR Purification Kit (Qiagen, Inc., Calif., USA) accordingto the manual instructions. The amplified 16S rDNA weresequenced directly with an automatic DNA sequencer (ABIPRISM 3700 DNA analyzer, Applied Biosystem, FosterCity, CA, USA) by using the same primers. The 16S rRNAgene sequence was compared with sequences in GenBankdatabases (http://www.ncbi.nlm.nih.gov./BLAST) to obtainclosely matched species. The phylogenetic tree of the strainAlg3.1 was constructed using biological software MEGA4.

The best medium for growth and agarase production.To maximize producing of extracelluler agarase, growthand production medium was chosen and the cultureconditions were adjusted. The growth and productionmedium were used marine broth (MB, Merck: Yeast extract0.1%, Casamino acid 0.5%, NaCl 3.0%, MgCl2.6H2O0.23%, and KCl 0.03%), sea water medium (SWM : bacto-peptone 1.0%, filtered sea water 750 mL, aquadest 250 mL,pH 7.2-7.3), basal salt solution medium B (BSM) and BSMwhich supplemented with bacto peptone (0.5%, w/v) andyeast extract (0.1%, w/v). Each of medium supplementedwith 0.2%, (w/v) agar (Oxoid) and incubated at 29oC for 1to 5 d on a rotary shaker (120 rev. min-l). Cultures werethen centrifuged to remove bacteria, the supernatant wasused for qualitative activity test. Qualitative agaraseactivity was measured based on clearance zone of free cell-supernatant of the strain Alg3.1 incubated at 4h on agarplate after that flooding with iodine.

Assay of agarase activity. Selected isolates werecultured in 250 mL Erlenmeyer flasks containing 150 mLbasal salt medium B supplemented with 0.2%, (w/v) agar(Oxoid) and incubated at 29oC for 1 to 5 d on a rotaryshaker (120 rev. min-l). Cultures were then centrifuged toremove bacteria, the supernatant was treated with 0.2 vol.2.5% (w/v) Cetrimide and the resulting precipitate wasremoved by centrifuging. The supernatant was treated with2 vol. acetone at 4oC for 30 min. The precipitate wascollected by centrifuging and redissolved in 5mMKH2PO4/Na2HPO4 buffer (pH 7.4).

The activity of this crude extracellular agarase wasassayed with a solution of agarose (Sigma; 0.2% w/v) in5mM KH2PO4/Na2HPO4 buffer (pH 7.4). The agarasepreparation (0.5 mL) was mixed with 0.5 mL agarosesolution and 2 mL 10mM KH2PO4/Na2HPO4 buffer (pH 7.4)and incubated at 29oC for 1 h. The reaction was stopped byadding 1 mL copper reagent and the reducing sugars weremeasured colorimetrically by the method of Dygert et al.(1965) except that any precipitate of undegraded agarosewas removed by centrifuging (2600g) for 15 min. Blanks ofsubstrate with no enzyme and enzyme with no substratewere treated in the same way. One unit of agarase activitywas defined as the release of reducing groups equivalent to1µmol D-galactose in 1 h at 29oC, pH 7.4.

Thin-Layer Chromatography (TLC). Reactions withpurified agarase and agarose were performed in 50 µLreactions containing 40 µL of partial purified agarase and 5µL of 1% agarose. Galactooligosaccharide, fructooligo-saccharide, and D-galactose (5 µg) were used as standards.The reactions were incubated at 29°C for two hours. Thereaction mixture was performed on a Silica Gel 60 glass


plate (F254 Merck, Damstadt, Germany). The plates weredeveloped with 2:1:1 n-butanol:acetic acid:water solution.Degradation products were visualized by using Handy UVLamp AS ONE 254nm (Japan).


Identification of Gracilaria-associated agarolyticbacterium Alg3.1

A bacterial strain that could produce extracellular agarasewas isolated from the marine seaweed, Gracilaria sp., ofthe Kuta Coast in Central Lombok, West Nusa Tenggara,Indonesia, based on its capability in liquefying of agar orexerting clearance zone on nutrient agar plate containingagar 1.5%. in the bacteriology laboratory. The strain Ag3.1was Gram-negative rods, non-fermentative and highlymotile, encapsulated, pleomorphic, highly motile, whichgrows singly or in short chains. colonies, The colony ofagarolytic strain Alg3.1 was yellow in TCBS (Figure 1A),flat and large, grayish white in nutrients agar medium (datanot shown), appear to like Vibrio species. But strain Alg3.1can utilize lactose so that can not be grouped into Vibrio.Cell-free supernatant of strain Alg3.1 produced 42 mmhalos of clearing in diameter after 6 h of incubation at 29oC(Figure 1B). This strain rapidly produced a crater ofdigested agar on nutrient agar plates, in the mannerillustrated by v. Hofsten and Malmqvist (1975) (Figure1C). Moist nutrient agar plates was completely liquefied inabout l5 day at 29oC (Figure 1D). Agarolytic bacteriaproduce visible changes on agar because of the cleavage ofpolysaccharide chains, ranging from softening of gel toagar pitting and extensive liquefaction (Agbo and Moss1979). Colonies did not produce diffusible pigment andgrowth occurred over a wide temperature range (4 to 40oC)with the optimum at 29oC.

The results of several biochemical and physiologicaltest for strain Alg3.1 are shown in Table 1. The strain wassusceptible to ampicillin, tetracycline, vancomycin,erythromycin and rifamicin. The strain Alg3.1 was aerobic,oxidase positive, arginine dihydrolase positive, urease andgelatinase positive, utilized D-glucose, D-galactose, D-

manitol, D-fructose, sucrose, lactose, agar, agarose,carrageenan, arabinogalactan, galactomannan, and starch assole carbon source, and reduced nitrate to nitrite. StrainAlg3.1 can be distinguished from Aeromonas salmonicidasubsp. pectinolytica MEL and A. salmonicida subsp.salmonicida by its utilization of N-acetyl glucosamine,citrate and indole production.

Phylogenetic analysis of 16S rRNAPartial 16S rDNA sequence of Alg3.1 could be used for

identification taxonomic of isolate. Alignment ofnucleotide sequence of the 16S rDNA with sequence inGenBank database showed maximum homology with thoseof Aeromonas species and appeared to be 98% identical toAeromonas salmonicida subsp. salmonicida strain VA-K2-V5 (Figure 2). However, we must point out that strainAlg3.1 differs from the type strain of this strain in someproperties. Based on Gram staining, morphology,biochemical, physiology and 16S rDNA sequence analysis,the agarolytic strain Alg3.1 was grouped into the genus ofAeromonas. There has not been report on agaraseproduction from this genus. Searching agarolytic bacteriain GenBank database showed that there is not discoverAeromonas species, and phylogenetic tree of someagarolytic bacterium presented in Figure 3. Consequently,these result indicated that the Gracilaria-associatedbacteria strain Alg3.1 is a novel agarolytic bacteriaproducing extracellular agarase enzyme.

Agarolytic activity of strain Alg3.1Most of the reported agar-degrading enzyme producers

are marine microorganisms active in algae cell walldecomposition. Because agarases are the enzymes thathydrolyzes agar, they have been isolated from the surfaceof rotted red algae in the South China Sea coast in HainanIsland, decomposing algae in Niebla in Chile and inHalifax in Canada, and decomposing Porphyra in Japan(Fu and Kim 2010). Curiously, decomposition of agar bymicroorganisms appears to be performed almost entirely bygram-negative bacteria, although few if any gram-positivebacteria have been identified as producers of alginatedegrading enzyme (Khambhaty et al. 2008).

A B C DFigure 1. Agarolytic bacterial colonies on TCBS medium with 2% agar (A), clearance zone of free cell-supernatant of the strain Alg3.1incubated at 4h on agar plate after flooding with iodine (B), and agar liquefying by agarolytic bacterium strain Alg3.1 after incubated 3d (C) and 15 d (D) in solid medium.


Table 1. Phenotypic characteristics of Aeromonas strain Alg3.1

Characteristics Aeromonasstrain Alg3.1

A. salmonicida subsp.pectinolytica MEL Characteristics Aeromonas

strain Alg3.1A. salmonicida subsp.

pectinolytica MELMorphology Rods Rods Substrate utilization:Gram-reaction - - Glucose + NdMotility + - Mannitol + NdAerobic growth + + Sucrose + +Anaerobic growth - - Maltose - NdOptimum pHOptimum temperatureOxidaseUreaseElastasePNPGIndole productionHydrolysis ofGelatinStarchEsculine

7.525-29oC

++

Nd--

+++

Nd++

Nd+

NdNd+

MannoseArabinoseSorbitolLactoseNAceG

K-glukonatCapric acidAdipic acidMalic acid

CitratePhenilacetat acid

--

Nd+-+--+--

NdNd++++

NdNdNd+

NdNitrate + Nd

Alg3.1

As strain VA K2-V5

As strain N20

As strain N8

As strain VA K2-M7

As strain 8

As strain C22

A hydrophila strain M-1

Shewanella sp. VA C1-3

V alginolyticus strain CIFRI V-TSB1

100

70

57

99

23

22

89

0.02

Figure 2. Phylogenetic tree based on 16S rDNA gene sequencing showing the relationships between the agar-degrading strain Alg3.1,Aeromonas spp. and related genera. Their GenBank accession numbers for the bacteria in the tree are: Aeromonas salmonicida subsp.salmonicida strain VA_K2-V5, GQ869652.2; A salmonicida strain N20, HM244937.1; A salmonicida strain 8, HQ533268.1; Asalmonicida strain 8, HQ533268.1; A salmonicida strain C22, HQ259698.1; A salmonicida strain N8, HM244936.1; A. hydrophila strainM-1, HQ609947.1; and Shewanella sp. VA_C1-3, GQ869648.1 and V. alginolyticus, JF784015.1 were used as outgroup.

To clarify the level of agar degradation, the cell growthduring the batch fermentation of the strain Alg3.1 toproduce agar-degrading enzyme and the change of agar-degrading enzyme activity in the supernatants of the culturebroth were investigated. Figure 4 shows the growth curveof Aeromonas Alg3.1 and the production of agarase in thepresence of agar, where is growth and production agarasewalk successive. The strain Aeromonas Alg3.1 readilyreleased agarase into the medium yielding monosaccharideor agarooligosaccharide. The biomass reached maximumand the agar-degrading enzyme activity was 0.425 nkat/mLafter cultivation for 44 h and the maximum activity was0.489 nkat/mL at 36h after incubation. During thelogarithmic phase of growth the enzyme activity showed arapid increase. But the activity decreased before cellentering to the stationary and decline phase.

Figure 4. Time courses for cell growth of strain Alg3.1 and agar-degrading enzyme activity change in culture broth. Cells weregrown in a BSM supplemented peptone and yeast extract at 120rpm at 29oC, pH 7.5. Cell growth was estimated by optical densityat 620 nm (OD).


Simiduia areninigrae strain M2-5

Microbulbifer maritimus strain MTM147

Cellvibrio sp. KY-YJ-3

Alteromonas sp. KMAB2

Alteromonas sp. QM65

Alg3.1

Halomonas sp. KMAB1

Vibrio agarivorans strain 289

Thalassomonas sp. M-M1

Thalassomonas agarivorans strain TMA1

Agarivorans sp. QM34

Pseudoalteromonas sp. QM47

Pseudoalteromonas antarctica

Flavobacteriaceae bacterium ZC1

Agarivorans albus strain QM38 (agarase gen)

100

99

98

7427

36

44

19

9

76

16

9

Figure 3. The genetic relationship between Alg3.1 with other genera of agarolytic bacteria

The activity of agarase crude extract of Alg3.1 is 2.9fold higher than P. antartica N-1, 0.1667 nkat/mL (Vera etal. 1998). Numerous reported data indicate that agarasespurified from genus of Vibrio have lower specificactivities, which are 7.54 and 20.8 U/mg from strain PO303(Araki et al. 1998) and 6.3 U/mg from strain JT0107(Sugano et al. 1993). Agarases from genus Agarivoransshow medium specific activities, which are 57.45 and 76.8U/mg from strain HZ105 (Hu et al. 2008) and 25.54 U/mgfrom strain YKW-34 (Fu et al. 2008). Agarases from genusAlteromonas and Pseudoalteromonas exhibit high specificactivities, which are 83.5 U/mg from Alteromonas sp.SY37-12 (Wang et al. 2006), 234 U/mg from Alteromonassp. C-1 (Leon et al. 1992).

To maximize producing intracellular agarase, growth andproduction medium was chosen and the culture conditionswere adjusted. Table 2 showed that the best medium forproduce intracellular agarase is basal salt solution medium(Medium B) which supplemented with bacto peptone(0.5%, w/v) and yeast extract (0.1%, w/v). Strain Alg3.1needs growth factor such as bacto peptone and yeast extractto grow optimum, and the production of agarase influencedby salt concentration. In medium B, we can regulate saltconcentration as according to need of the bacteria.

Table 2. Growth and qualitative agarase activity of Alg3.1 strainin various medium for 24h incubation. Qualitative activity wasmeasured based on diameter of clearing zone by using cell-freesupernatant which incubated in solid medium for 4 h at 29oC

Growth media Growth(cfu/mL)

Clearingzone (mm)

Marine broth 6.0 x 107 26.5Sea water medium 7.4 x 107 32.5Basal salt solution medium B 4.1 x 107 21BSM + peptone + yeast extract 1.1 x 108 38

Identification of reaction productThe result of visualization with UV 254 nm shows a

large amount of two kind of agarooligosaccharide as majorproduct (Figure 5). These result indicated that this strainhave multi extracellular agarase enzymes, which couldcleavage agarose into neoagarotetraose by agarase I, then,neoagarotetraose is cleaved at by neoagarotetraosehydrolase-or agarase II-to yield neoagarobiose. Finally,neoagarobiose is degraded by periplasmic -neoagarobiosehydrolase to the D-galactose and 3,6-anhydro L-galactose,which are metabolized by intracellular enzymes.

Figure 5. TLC of the products of agarose hydrolyzed by thepartial purified agarase enzyme. Standard (1,2), Abn1.2 (3),Alg3.1 (4), neoagarooligosaccharide (5), fructooligosaccharide (6)and D-galactose (7)

Numerous reports show that agarolytic bacteria canproduce agarase enzyme that vary. A part of these strainsonly produce agarase type I like Pseudomonas SK38, otherhas only agarase II like Agarivorans JAMB-A11, there alsothat can to produce agarase I and II like in P. atlantica.


Possibility to produce bioethanol from agarophyteIncrease on world’s energy demand and the progressive

depletion of oil reserves motivate the search for alternativeenergy resources, especially for those derived fromrenewable materials such as biomass (Saxena et al. 2009).Global concern about climate change and the consequentneed to diminish greenhouse gases emissions haveencouraged the use of bioethanol as a gasoline replacementor additive (Balat et al. 2008). Bioethanol may also be usedas raw material for the production of different chemicals,thus driving a full renewable chemical industry.

Substitution bioethanol as one of energy source hasbeen selected as an alternative source for the fossil fuelsubstitution. The marine seaweed, such as Agarophyte, canbe used for the production of bioethanol. The maincomponent of agarophyte such as Gracilaria consists of acomplex biopolymer cellulose, hemicelluloses, agar orcarrageenan (Abbot and Dawson 1978). Agar is composedof two fractions, agarose and agaropectin. Agarose, themain constituent, is a neutral polysaccharide that forms alinear chain structure consisting of repeating units ofagarobiose, which is an alternating polymer of D-galactoseand 3,6-anhydro L-galactose linked by alternating β-(1, 4)and -(1,3) bonds (Allouch et al. 2003; Flament 2007). Theproduct of agar-degradation consist of neoagarotetraose asthe major end product, neoagarobiose, D-galactose and 3,6-anhydro L-galactose (Hosoda et al. 2003; Michel et al. 2006).

This strain can degrade and utilized several complexpolysaccharides, such as agar, agarose, starch, andcarrageenan. Although Alg3.1 can hydrolyze carboxymethyl cellulose but can not utilize it as carbon sourcesolely (Table 3). These results suggest that agar-liquefyingAlg3.1 might be a good candidate as a producer bioethanolfrom agarophyte, because if we mix this strain with otherbacteria or yeast so D-galactoses can be catabolytic intopiruvic acid via Tagatosa or Leloir pathway, furthermorethe fermented of piruvic acid produce large amounts ofalcohol, acetic and formic acids.

Table 3. Polysaccharides degradation and utilization by the strainAlg3.1

Polysaccharides Degradation Utilization

Agar + +

Agarose + +

Soluble Starch + +

carrageenan + +

CMC + -

CONCLUSION

The Gracilaria-associated bacteria strain alg3.1 is anew report of agarolytic bacteria from Aeromonas generawhich can produce extracellular agarase enzyme. Thisstrain have two kind of agarooligosaccharides as majorproduct and can degrade and utilized various of complexpolysaccharides, such as agar, agarose, starch, andcarrageenan.

REFERENCES

Abbot IA, Dawson EY (1978) How to know the seaweed. McGraw-Hill, Boston.Agbo JAC, Moss MO (1979) The isolation and characterization of agarolityc

bacteria from a Lowland river. J General Microbiol 115: 355-368Allouch J, Jam M, Helbert W, Barbeyron T, Kloareg B, Henrissat B,

Czjzek M (2003) The three-dimensional structures of two β-agarases.J Biol Chem 278: 47171-47180

Araki T, Lu Z, Morishita T (1998) Optimization of parameters forisolation of protoplasts from Gracilaria verrucosa (Rhodophyta). JMar Biotechnol 6:193-197.

Balat M, Balat H, Öz C (2008) Progress in bioethanol processing.Progress in Energy and Combustion Science 34: 551-573.

Dygert S, Li L, Florida D, Thoma JA (1965) Determination of reducingsugar with improved precision. Anal Biochem 13: 367-374.

Flament D. 2007. Alpha–agarase define a new family of glycosidehyrolases, distinct from beta-agarase families. J Appl EnvironMicrobiol 73: 4691-4694

Fu XT, Kim SM (2010) Agarase: Review of major sources, categories,purification method, enzyme characteristics and applications. MarDrugs 8: 200-218

Fu XT, Lin H, Kim SM (2008) Purification and characterization of a novelβ-agarase, AgaA34, from Agarivorans albus YKW-34. ApplMicrobiol Biotechnol 78:265-273

Hoffsten B, Malmqivst M (1974) Degradation of agar by gram-negatrivebacteria. J General Microb 87:150-158

Hosoda A, Sakai M, Kanazawa S (2003) Isolation and characterization ofagar-degrading Paenibacillus spp. associated with the rhizosphere ofspinach. Biosci Biotechnol Biochem 67: 1048-1055

Hu Z, Lin BK, Xu Y, Zhong MQ, Liu GM (2008) Production andpurification of agarase from a marine agarolytic bacteriumAgarivorans sp. HZ105. J Appl Microbiol 106:181-190

Jean WD, Shieh WY, Liu TY (2006) Thalassomonas agarivorans sp.nov., a marine agarolytic bacterium isolated from shallow coastalwater of An-Ping Harbour, Taiwan, and emended description of thegenus Thalassomonas. Int J Syst Bacteriol 56: 1245-1250.

Johnson TR, Case CL (2007) Laboratory experiment in microbiology.Pearson Benjamin Cummings, Singapore.

Khambhaty Y, Modi K, Jha B (2008) Purification, characterization andapplication of a novel extracellular agarase from a marine Bacillusmegaterium. Biotechnol Bioprocess Engineer 13: 584-591

Michel G, Nyval-Collen P, Barbeyron T, Czjzek M, Helbert W (2006)Bioconversion of red seaweed galactans: a focus on bacterial agarasesand carrageenases. J Appl Microbiol Technol 71:23-33

Macian MC, Ludwig W, Schleifer KH, Pujalte MJ, Garay E (2001) Vibrioagarivorans sp. nov., a novel agarolytic marine bacterium. Int J SystBacteriol 51: 2031-2036.

Marchesi JR (1998) Design and evaluation of usefull bacterium-specificPCR primers that amplify gens coding for bacterial 16S rRNA. J ApplEnviron Microbiol 64 : 795-799

Nontji A (2007) Ocean of Nusantara. Djambatan, Jakarta. [Indonesia]Saxena RC, Adhikari DK, Goyal HB (2009) Biomass-based energy fuel

through biochemical routes: a review. Ren Sust Ener Rev 13: 167-178.Sie YF, Yang HC, Lee Y (2009) The Discovery of agarolytic bacterium

with agarase gene containing plasmid, and some enzymologycharacteristics. Int J Appl Sci Engineer 1:25-41

Soegiarto A, Sulistijo (1985) The potential of marine algae forbiotechnology products in Indonesia. In: Workshop on marine algaebiotechnology; Jakarta, 11-13 December 1985. [Indonesia]

Sugano Y, Terada I, Arita M, Noma M (1993) Purification andcharacterization of a new agarase from a marine bacterium, Vibrio sp.strain JT0107. Appl Environ Microbiol 59:1549-1554

Van der Meulen HJ, Harder W (1976) Characterization of theneoagarotetrase and neoagarobiase of Cytophaga flevensis. Antonievan Leeuwenhoek 42:81-94.

Vera J, Alvares R, Murano E, Slebe JC, Leon O (1998) Identification of amarine agarolityc Pseudoalteromonas isolate and characterization ofits extracellular agarase. J Appl Environ Microbiol 64: 4374-4383

Wang JX, Mou HJ, Jiang XL, Guan HS (2006) Characterization of a novelβ-agarase from marine Alteromonas sp. SY37-12 and its degradingproducts. Appl Microbiol Biotechnol 71:833-839.

Yoon JH, Kim IG, Kang KH, Oh TK, Park YH (1996) Alteromonas sp.nov. isolated from sea water of the East Sea in Korea. Int J SystBacteriol 23: 1625-1630.


Soil microorganisms numbers in the tailing deposition ModADAareas of Freeport Indonesia, Timika, Papua

IRNANDA AIKO FIFI DJUUNA1,♥, MARIA MASORA2, PRATITA PURADYATMIKA3

1Department of Soil Science, Faculty of Agriculture and Agriculture Technology, State University of Papua, Amban Campus, Manokwari 98314, WestPapua, Indonesia. Tel.: +62-986-211974. Fax. +62-986-211455. ♥email: [email protected]

2Department of Biology, Faculty of Mathematics and Science, State University of Papua, Manokwari98314, West Papua, Indonesia.3Department of Environmental, Freeport Indonesia, Timika, Papua, Indonesia.


ABSTRACT

Djuuna IAF, Masora M, Puradyatmika P (2011) Soil microorganisms numbers in the tailing deposition ModADA areas of FreeportIndonesia, Timika, Papua. Biodiversitas 12: 198-203. The objective of this study was to examine the number and distribution ofbacteria, fungi and actinomycetes in the inactive tailing deposition areas of Freeport Indonesia Mining and Gold Company, Timika. Onehundred ninety eight composite samples (0-20 cm) were taken from four location of inactive tailing ModADA (Modification AijkwaDeposition Areas) namely double levee-bottom (fine texture); double levee-middle (medium texture); double levee-top (coarse texture);Mile 21 and transmigration areas of I to V. The conventional method of dilution and Plate Count Agar were used to examine thepopulation of soil bacteria, fungi and actinomycetes. pH and moisture content were also analyzed. The numbers of bacteria in the tailingdeposition areas are in the range from 3.48x105 CFU/g soil to 102.83x105 CFU/g soil, soil fungi from 1.51x105 CFU/g soil to106.61x105 CFU/g soil and actinomycetes range from 0.32x104 CFU/g soil to 113.74x104 CFU/g soil. While in some transmigrationareas, the number of soil bacteria, fungi and actinomycetes were lower than in the tailing areas. The number of soil bacteria and fungiwere higher than actinomycetes. However, the coefficient of variation of actinomycetes (107%) was higher than soil fungi (89%) andbacteria (68%). Tailing deposition areas are considered as a good habitat for soil microorganisms. Overall, the number of soil organismin the tailings areas are considered medium to high, however to understand their functioning in each location under different land usesystem, more research are needed to evaluate their roles especially in the decomposition of soil organic matter.

Key words: tailing deposition, soil bacteria, fungi, actinomycetes.

INTRODUCTION

Tailings are small sized residue of mined material thatgenerated from the separation process of copper, gold andsilver by flotation technique of the concentrate rock(Mahler and Sabirin 2008). The production of copper, goldand silver of Freeport Indonesia Company produce a bigamount of tailing in average of 230,000 tons/day which aredeposited in the lowland area called Modified AjkwaDeposition Area (ModADA) (PTFI 2003, 2005, 2007).

Tailing deposit has a particle size varies from coarse tofine, with less organic matter and contains very littlenutrients. Taberima et al. (2011) has reported that tailingdeposited in ModADA areas deficient in some macronutrients, while base cations and some micro nutrients areabundant. Some of the nutrients from tailing deposit areasare generally not in the available form for plants, thereforeits fertility level is very low. The availability of naturalorganic matter is very low affected by climate factor(rainfall, temperature, sunlight, humidity), organic matteravailability, soil reaction, and the variety of decomposermicroorganism. Soil microorganism especially decomposermicroorganism is very important to the stability of organicmatter weathering.

The information about the variation and status of soilmicroorganism such as bacteria, fungi and actinomycetes isneeded to improve the fertility and productivity of tailing.These microorganisms are the largest group of soilmicroorganism (micro biota living in the natural habitatincluding tailing area. Bacteria is a dominant group ofmicroorganisms in the soil with population of >108 CFUper gram soil and 104-106 units? number of species.Actinomycetes is the second largest group ofmicroorganisms with density of population about 106-107

CFU per gram soil, while fungi in the third position withpopulation density of 104-106 CFU per gram soil (CelentisAnalytical 2003; Handayanto and Hairiah 2007). Thesegroups of organisms are useful as quality and healthyindicator of soil. They have ecosystem function as one ofsensitive biological marker and useful to identify thedisturbance and damage of ecosystem (Roper and Ophel-Keller 1997).

Therefore, basic data about soil microorganismbiodiversity especially the group of soil decomposer whichis beneficial for plant growth in tailing deposition area isvery important in the management and reclamationplanning of tailing area. This information will be used as animportant factor in the evaluation and identification ofalterations occurred in the tailing deposition area.

DJUUNA et al. – Soil microorganisms of Freeport tailing deposition 199

As an effort to identify the availability of bacteria,fungi, and actinomycetes from the tailing deposition areas,the isolation and identification of this micro biota groupfrom the tailing aiming to find out the micro biotapopulation and distribution from several locations ininactive tailing deposit area (ModADA) and transmigrationagricultural area as a standard of comparison.


Soil sampling and analysisInactive tailing sample is taken from the depth of 0-20

cm in 8 locations of ModADA areas and TransmigrationArea i.e. lower-ADA (fine deposit); middle-ADA (mediumdeposit); upper-ADA (coarse deposit); old-ADA (inactivedeposit area); Double Levee; Mil 21; and transmigrationarea SP I, II, IV and V. Research site and point of sampletaken is presented on Figure 1A. The laboratory analysiswas conducted in Timika Environmental Laboratory (TEL)Freeport Indonesia Company, for soil pH and soil moisturecontent. For the observation of microorganism population,it was conducted in Water Microbiology Laboratory, PublicHealth and Malaria Control, Freeport Indonesia Company,Kuala Kencana, Timika and continued in Soil BiologyLaboratory Faculty of Agriculture and AgriculturalTechnology) and Microbiology Laboratory of Faculty ofMathematics and Natural Sciences of University of PapuaManokwari.

Soil samples were taken compositely in the depth of 0-20 cm by using a soil auger in each 200 m interval, but inthe location which its width was smaller than the distancebetween points, was 50-100 m. In each point, sample wastaken as many as 10 augers with 1 meter distance circularlyin order to get composite sample from each point.

Coordinate point of each sample point was determined byGlobal Positioning System (GPS). The number of thewhole samples taken was 198 points, or as many as 1980composed auger samples.

Isolation and identification of bacteria, fungi andActinomycetes

The isolation of soil bacteria, fungi and actinomyceteswas conducted by dilution method using NaCl 0.85% as asolvent with the dilution series of 10-1-10-7. Sample (100μL) was poured into a petridish contained Nutrient Agar(NA) for bacteria, Potato Dextrose Agar (PDA) media forfungi and Starch-Casein Agar (SCA) media foractinomycetes which was then incubated in the incubator oftemperature at 27-300C. After 2-3 days incubation(bacteria); 3-5 days (fungi); and 5-7 days (actinomycetes),observation was conducted based on 30-300 colony/platethinning. The amount of colonies was counted by usingPlate Count Method (Lay 1994).

All microorganisms were identified by isolating eachmicroorganism by using universal media as a growingmedia for soil microorganism. Each microorganism could bepurified in a special media. Afterward, the microorganismin pure culture was identified microscopically by Wetmounts and Gram stain, and biochemical test.Morphological observation of the microorganism found bymicroscope included cell size, form of mycelia and othercharacteristics, and then it was identified based on thecharacteristics of microorganism found and followed byBergey’s Manual Handbook of identification for bacteria;identification of fungi using the method of Cappuccino andSherman (2001) and Atlas (1995), and for actinomycetesusing the method from Sembiring (2000), Sembiring et al.(2000) and Prescott et al. (1999).

A B C

Figure 1. Research site map and point of sample taken in tailing deposition area of PT. Freeport Indonesia, Timika (A); and distributionmap of soil pH (B) and soil moisture content (C).


Microbial Biomass Carbon (MBC) with Fummigation-Extraction method (Vance et al. 1987; Sparling 1990).

Data analysisAll data were then analyzed by using statistic analysis

which consists of two stages: (i) data distribution was doneby using conventional statistic (mean, minimum,maximum, median, standard deviation, skewness, kurtosisand coefficient of variation, and histogram), which wasassumed implicitly that observation conducted wasindependent to every sample point; and (ii) GeostatisticalAnalysis was used to analyze the distribution of soilmicroorganisms, based on the location the samples wastaken. Krigging interpolation was used to estimate data onone or more points not taken as a sample.

Microorganism distribution map was created by usingGIS software ArcView/ArcMap ® (version 9.2 ESRI), withSpatial Analyst and Geostatistical Analyst extensions.


Soil characteristics (pH and moisture content)Data on soil pH and moisture content in the tailing

areas is presented in Table 1. In general, the range of soilpH in the tailing areas was from 4.61 to 8.67 with the meanof 7.00. While the moisture content ranged from 2.40 to62.00% with the mean of 20.13%. Soil pH and moisturecontent were factors that affected the number anddistribution of soil microorganism in the soil.

The distribution of soil pH and moisture content in thetailing areas is presented in Figure 1B and 1C. It showedthat most of the tailing areas have high value of soil pH,however only few locations have had lower soil pH (4.6-4.9). In contrast, only few areas in Mile 21 and 23 have>45.7 % of soil moisture content. This might be caused byhigh level of rain and the areas were located nearby river.

Population and distribution of soil microorganismsIsolation result showed that bacteria, fungi and

actinomycetes population in all study location were variedand ranged between 3.48x105-102.83x105 CFU/g (bacteria),1.51x105-106.61x105 CFU/g (fungi) and 0.32x104-113.74x104 CFU/g (actinomycetes). If it is comparedbetween these three microorganisms, it can be seen thatbacteria and fungi population were higher thanactinomycetes. However, the Coefficient of Variation (CV)of actinomycetes was higher (107%) than fungi (89%) andbacteria (68%) (Table 2). In other words, the higher thecoefficient of variation values the more the number ofvariation in the soil.

The comparison of soil microorganism population intailing area and transmigration area (SP I, II, IV and V)was presented in Table 2. The total number of soilmicroorganism in tailing area tended to be higher than theaverage population of soil microorganism in transmigrationarea. The average population of microorganism in tailingarea was 16.84x105 CFU/g (bacteria), 11.83x105 CFU/g(fungi), and 9.94x105 CFU/g (actinomycetes). While the

Table 1. Mean of soil pH and moisture content in the tailing and transmigration areas

VariableMean

(x105CFU/gdried soil)

Median(x105 CFU/g

dried soilSD Kurtosis Skewness

Min(x105 CFU/gdried soil)

Max(x105 FU/gdried soil)

CV(%)

Soil moisture content (%) 20.13 17.95 11.05 0.40 0.81 2.40 62.00 54.92pH H2O (1:2) 7.00 7.42 1.13 -0.93 -0.64 4.61 8.67 16.09

Table 2. The average population of bacteria, fungi and actinomycetes (0-20cm) in PTFI tailing area and transmigration area SP I, II, IVand V, Mimika District

VariableMean

(x105CFU/gdried soil)

Median(x105 CFU/g

dried soilSD Kurtosis Skewness

Min(x105 CFU/gdried soil)

Max(x105 FU/gdried soil)

CV(%)

PTFI tailing area (n=190)Bacteria 16.84 12.82 11.34 16.19 2.73 3.48 102.83 67.36Fungi 11.83 8.44 10.45 34.95 4.39 1.51 106.61 88.35Actinomycetes 9.94 7.01 10.53 49.57 5.55 0.32 113.74 105.91

Transmigration areas (n=8)Bacteria 7.37 7.04 2.37 0.76 0.56 3.88 11.70 32.14Fungi 5.47 4.83 1.90 -0.92 0.50 2.92 8.31 34.67Actinomycetes 5.63 5.80 2.41 -1.73 -0.26 2.47 8.52 42.90

PTFI tailing area and transmigration area (n=198)Bacteria 16.46 12.38 11.28 16.23 2.74 3.48 102.83 67.99Fungi 11.57 8.12 10.32 35.71 4.44 1.51 106.61 89.06Actinomycetes 9.77 6.95 10.36 51.17 5.64 0.32 113.74 106.83

Note: SD= Standard Deviation, CV= Coefficient of Variation


average population of microorganism in transmigrationarea was 7.37x105 CFU/g (bacteria), 5.47x105 CFU/g(fungi), and 5.63x105 CFU/g (actinomycetes).

Kriging interpolation result showed that the distributionof bacteria, fungi and actinomycetes in tailing area tendedto be the same that was following the distribution ofvegetation and soil characteristics such as pH and soilmoisture content. Generally, soil pH and soil moisturecontent were the factors which could affect the totalnumber, activity and distribution of microorganism in soil(Figure 2A, 2B, and 2C). The population of bacteria, fungiand actinomycetes was higher on secondary forestvegetations and natural succession area compared with thelocation planted by some agricultural crops.

Microbial Biomass Carbon (MBC)The MBC in tailing deposition areas of ModADA

ranged from 26.25 to 4957.29 ppm with the mean of1774.61 ppm. Microbial Biomass C is one parameter thathas been used to determine the amount of C in the soilmicrobe, therefore the MBC value has been indirectlycorrelated to soil C. The MBC in the tailing areas was tendto follow the distribution of soil texture, which is on thefine texture areas, the MBC was higher compare to coarsetexture areas. This pattern can be affected the number ofmicroorganisms in the tailing areas.

Based on the isolation result of the amount of soilmicroorganism found, therefore identification result of soilmicroorganism in tailing area and its surrounding wasfound 10 species of bacteria i.e. Nitrosomonas sp.,Clostridium sp., Bacillus cereus, Bacillus subtilis, Thiobacillussp., Arthrobacter sp., Desulfovibrio sp., Serratia marcescens,Chromobacterium violaceum, and Pseudomonas sp.; fourspecies of fungi i.e. Aspergillus fumigatus, Aspergillus sp.,Aspergillus niveus, and Penicillium chrysogenum; and also

three species of actinomycetes i.e. Micrococcus,Mycobacterium, and Arthrobacter.

Results of soil microorganism population showed thatthe high number of soil microorganism in tailing area andits surrounding was not followed by range of this soilmicroorganism species in all of sample taken points.

Population and distribution of soil organisms are highlyvaried in the soil depended on soil types andcharacteristics, land cultivation and vegetation growing onit. Differences of land use resulted in different populationof bacteria, fungi and actinomycetes (Gofar et al. 2007).There were three main factors which influenced populationand biodiversity of soil microorganisms i.e. (i) weather,especially precipitation and humidity; (ii) soilcondition/characteristic, particularly the acidity, humidity,temperature and the availability of soil nutrients; and (iii)type of vegetation such as forests, bushes and grass field(Hanafiah et al. 2005). In general the number of bacteria inthe soil was higher compared to the number of othermicrofloras such as fungi, actinomycetes and algae,however individually the number was lower (Alexander1977). This also could be seen toward comparison of thenumber of bacteria, fungi, and actinomycetes in tailing areaand its surroundings. Bacteria were a group ofmicroorganism in the soil which was the most dominantand included half of microbe biomass in the soil (SubbaRao 1944). Number of bacteria in the soil usually rangedbetween 108-109 CFU/g soil, while number of fungi andactinomycetes respectively ranged between 107-108 and105-106 CFU/g soil.

Number and activity of soil microorganism wasinfluenced by climate, vegetation and habitat of itssurroundings including the soil characteristics and land usepattern. Vegetation difference and land use pattern intailing area and transmigration area resulted the difference

A B C

Figure 2. Distribution map of soil (A) bacteria, (B) fungi and (C) Actinomycetes in tailing area PT Freeport Indonesia, Timika.


on number of soil microorganism, because generally landsused for agricultural crops conservation, some treatmentssuch as the continual application of chemical fertilizer andpesticide could influence the number and distribution ofsoil microorganism. In the contrary, in some location intailing area, the number and distribution of soilmicroorganism was low. It could be happened due to theorganic matter content of the soil was low. Generally soilwith highly sand content has low organic matter content.

The species of soil microorganism found in all points ofsample taken generally could exist and grow mostly inseveral species of soil such as Pseudomonas sp andBacillus sp; however, their normal population in the soilwas categorized as low. These bacteria were also known aszymogene and fermentative microorganism that neededenergy from outside the soil (Subba Rao 1994). Included inthis bacteria group was cellulose decomposed bacteria,nitrogen consumption bacteria and bacteria which couldbreak ammonium into nitrate. Besides, among the bacteriaspecies found in the study location, it was also foundseveral colonies of bacteria resembling Chromobacteriumviolaceum (natural antibiotics producer bacteria“violacein”), and Thiobacillus and Desulfovibrio which arealso species of bacteria which could oxidize and reducesulfur so they were called the group of sulfur bacteria.

Majority, these bacteria exist and grow well in waterlogor anaerobe areas, but Thiobacillus bacteria group couldalso exist in aerobe condition. Thiobacillus is a type ofbacteria that could oxidize inorganic sulfur compound so itwas called special bacterium. This bacterium could producesulfate acid if sulfur element was added in the soil todecrease soil pH as low as 2.0 long after it was incubatedwith the bacteria (Subba Rao 1994). In addition to this,Thiobacillus commercially played very important role inmining industry in the process of acid waste (Horan 1999).Another type of sulfur bacteria like Desulfovibrio, wasreducing inorganic sulfate into sulfide hydrogen so theexistence of this bacterium could reduce sulfur content forplant’s nutrient and because of that it could influenceagriculture production. This bacterium mostly live andgrow well in anaerobe condition and could produce sulfidehydrogen. Some tailing areas which covered by waterlogcondition could potentially be occupied by this type ofbacteria, therefore regular monitoring in this areas canreduce the population of this bacteria.

Generally, the existence of other soil microorganismssuch as fungi and actinomycetes was influenced by qualityand quantity of organic substance in the soil. Fungi liveddominantly in the acid soil and monopolize the use ofnatural substrate in the soil. Group of soil fungi andactinomycetes found in the study location was the group ofsoil fungi and actinomycetes which was generally found inthe soil such as Aspergillus sp. and Streptomyces sp.Aspergillus sp. was one of soil fungi type which producedsubstance which was similar to humic substance in soil andbecause of that it was somewhat important in maintainingsoil organic substance (Subba Rao 1994).

Different with fungi, actinomycetes was not tolerant toacid and their number would decrease at pH 5.0. Usually,actinomycetes would grow well at pH between 6.5 and 8.0.

So was with the level of moisture quite high, the number ofactinomycetes was decreased.

Soil pH was one of soil chemical characteristics whichvery influenced to the number and distribution ofmicroorganism in the soil. Population and distribution ofthis microorganism in tailing area and its surroundingswere influenced by soil pH; however the relationshipbetween pH and the soil microorganism was significantlynegative. In general, number of soil microorganism wouldincrease at soil pH nearly neutral. But several soilmicroorganism species could be also tolerant to the soilwhich was so acid or alkaline. Soil pH which was a littlebit low (4.6-4.9) in several locations of sample taken, couldimpact in the increasing of metal solubility so thatobservation was needed if location of low pH was found.

Besides soil pH, soil moisture was one of environ-mental factors that influenced the number and activity ofmicroorganism in the soil. Generally soil microorganismpreferred the environment which was nearly moist, butseveral organisms were tolerant to dry condition andstagnation. This was the same with the observation resultthat soil moisture level influenced significantly negative tothe population and distribution of soil microorganism intailing area and its surroundings. The higher the level ofsoil moisture content in tailing area, the number of thedistribution of the soil microorganism was low.

Soil organic matter is an important fraction that cansupport population of microorganism in the soil especiallyfor those microorganisms in the organic matter. Microbialbiomass is a living component in the organic matter whichcontains 2-7% from C organic in the soil (Gupta and Roget2003). The total Microbial Biomass C in the tailing areaswas in the range of 26.25-4957.29 ppm (very low to veryhigh). Generally, the total number of MBC on the soilsurface is 250 mg C/kg in the sandy soils and 1100 mgC/kg in the clay soils and high of organic matter. Althoughthe MBC is only small part of organic matter (2-7%), itslive and dynamic properties has been made sensitivity tomost of land management compared to the total organicmatter (Gupta and Roget 2003). Microbial biomass C in thesoil can be used as an indicator to predict the soil fertilityespecially the status of organic matter in the soil (Sparling1992).

Soil microorganism variation comprised number,distribution and species of existed microorganism in tailingarea and its surroundings showed that the tailing area wasone of good habitats for soil microorganism that was notdifferent with other habitats. Because generally the numberand distribution of soil microorganism in this area wascategorized as middle-high from the average number ofmost organisms found in other types of soil. By theexistence of soil microorganism population and distributionin the tailing area also showed that tailing areas was not thetoxic habitat for this microorganism group. But the numberof organism found in the tailing area was not followed byhigh variety of the species. This was caused by thecharacteristic of each organism that was number anddistribution in the soil which was highly influenced byseveral soil characteristics such as physical, chemical andbiological characteristic and other ecologycal factors. Soil


organic matter was one of the factors that highlydetermined the survival of soil microorganism, so that theincreasing of soil organic matter in tailing area was reallyneeded to maintain, to keep and to increase the number andthe type of soil organism. In addition, planting some plantswhich was easily decomposed in tailing area was one of thealternatives that could increase the number and the speciesof soil microorganism and also to keep its balance andstability.

CONCLUSION

Number of soil organism in tailing area and itssurroundings was categorized as middle-high. The averagenumber and population of soil microorganism in tailingarea and its surroundings were 16.46x105 (bacteria),11.57x105 (fungi) and 9.78x104 (actinomycetes) CFU/gsoil. There were 10 species of bacteria i.e. Nitrosomonassp, Clostridium sp, Bacillus cereus, Bacillus subtilis,Thiobacillus sp., Arthrobacter sp., Desulfovibrio sp.,Serratia marcescens, Chromobacterium violaceum, andPseudomonas sp.; four fungi species i.e. Aspergillusfumigatus, Aspergillus sp., Aspergillus niveus, andPenicillium chrysogenum, and also three species ofactinomycetes i.e. Micrococcus, Mycobacterium, andArthrobacter. Majority of bacteria and fungi found wasdecomposer microorganism of organic matter particularlycellulose decomposers and phosphate solubilizers. Thebiodiversity of soil microorganism comprised number,distribution and species of organisms in tailing area and itssurroundings showed that tailing area was also one of agood habitat and was not toxic for soil microorganismwhich was not different with other natural habitats.

ACKNOWLEDGEMENTS

Our gratefulness goes to PT Freeport Indonesia for allof kind helps given in this research through a Cooperationof PT Freeport Indonesia (PTFI) and the State Universityof Papua (UNIPA) Manokwari, West Papua, Indonesia.

REFERENCES

Alexander M (1977) Introduction to soil microbiology. John Wiley &Sons, New York.

Atlas RM (1995) Handbook of media or environmental microbiology.CRC Press. New York.

Cappuccino GJ, Sherman N (2001) Microbiology: A Laboratory Manual.Cummings Publishing Company Inc, New York.

Celentis Analitical (2003) Biological soil test-definitions.www.lifestyleblock.co.nz/general/sfs/213 Soil biologicalTestdefinition.htm

Gofar N, Amin-Diha M, Napoleon A (2007) Diversity of soil microbes incultivated swamp land. J Akta Agrosia 1: 5-10. [Indonesia]

Gupta WSR, Roget DK (2003) Understanding soil biota and biologicalfunctions: Management of soil biota for improved benefits to cropproduction and environmental health. In: Abbott LK , Murphy DV(eds). Soil Biological Fertility-A key to sustainable land use inagriculture. Kluwer, The Nederland.

Hanafiah KA, Anas I, Napoleon A, Ghoffar N (2005) Soil biology:Ecology and soil macrobiology. Raja Grafindo Persada, Jakarta.[Indonesia]

Handayanto, Hairiah K (2007) Soil biology: The fundamental of soilhealth. Pustaka Adipura, Yogyakarta. [Indonesia]

Holt JG (1994) Bergey’s Manual of determination of bacteriology, 9th ed.William & Wilkins, Baltimore, Md.

Horan J (1999) Acid mine drainage experiments. Department of Chemistryand Geochemistry, Colorado School of Mines, Golden, CO, USA.

Lay BW (1994) Analysis of microorganisms in laboratory. Raja GrafindoPersada, Jakarta. [Indonesia]

Mahler A, Sabirin N (2008) From Grasberg to Amamapare: The processof copper and gold mining from highland to lowland. Gramedia,Jakarta. [Indonesia]

PCARD [The Phillipines Council for Agriculture and ResourcesResearch] (1980) Standard methods of analysis for soil, plant tissue,water and fertilizer. Farm Resources and Systems Research Division,Los Banos, The Philippines.

Prescot ML, Harley JP, Klein DA (2005) Microbiology. 6th ed. Mc GrawHill, New York.

PTFI [PT Freeport Indonesia] (2003) Report on environmental monitoringand management. Environmental Department of PT FreeportIndonesia, Kuala Kencana, Mimika, Papua. [Indonesia].

PTFI (2006) Report on environmental monitoring and management of 1stquarterly January, February, March 2006. PT Freeport Indonesia,Jakarta. [Indonesia].

PTFI (2007) Report on environmental monitoring and management of 1stquarterly 2007. PT Freeport Indonesia, Jakarta. [Indonesia].

Roper MM, Ophel-Keller KM (1997) Soil microflora as bioindicators ofsoil health. In: Pankhurst C, Doube BM, Gupta VVSR (eds).Biological indicators of soil health. CAB International, New York.

Sembiring L (2000) Selective isolation and characterization ofStreptomyces assosiated with the rhizosphere of the tropical legume,Paraserianthes falcataria (L) Nilesen. [Ph.D. Dissertation] Universityof Newcastle. Newcastle, UK.

Sembiring L, Ward AC, Goodfellow M (2000) Selective isolation andcharacterization of members of the Streptomyces violaceusniger cladeassociated with the roots of Paraserianthes falcataria. Antonie vanLeeuwenhoek 78: 353-366.

Sparling GP (1990) Soil biomass evaluation. Proceeding ofPACIFICLAND Workshop on the Establishment on Sloping Land.IBSRAM Technical Notes No.4, Bangkok.

Subba-Rao NS (1994) Soil microorganisms and plant growth. 2nd ed.University of Indonesia Press, Jakarta [Indonesia]

Taberima S, Mulyanto B, Gilkes R, Husin Y (2010) Fertility status of soilsdeveloped on an inactive mine tailings deposition area in Papua [P-1094]. 19th World Congress of Soil Science; Soil Solution for AChanging world. Brisbane Australia, 1-6 August 2010.

Vance ED, Brookes PC, Jenkinson DS (1987) An extraction method formeasuring soil microbial biomass C. Soil Biol Biochem 19:703-707.


Inventorying the tree fern Genus Cibotium of Sumatra: Ecology,population size and distribution in North Sumatra

TITIEN NGATINEM PRAPTOSUWIRYO♥, DIDIT OKTA PRIBADI, DWI MURTI PUSPITANINGTYAS,SRI HARTINI

Center for Plant Conservation-Bogor Botanical Gardens, Indonesian Institute of Sciences. Jl. Ir. H.Juanda No. 13, P.O. Box 309 Bogor 16003, Indonesia.Tel. +62-251-8322187. Fax. +62-251- 8322187. ♥e-mail: [email protected]

Manuscript received: 26 June 2011. Revision accepted: 18 August 2011.

ABSTRACT

Praptosuwiryo TNg, Pribadi DO, Puspitaningtyas DM, Hartini S (2011) Inventorying the tree fern Genus Cibotium of Sumatra:Ecology, population size and distribution in North Sumatra. Biodiversitas 12: 204-211. Cibotium is one tree fern belongs to the familyCibotiaceae which is easily differentiated from the other genus by the long slender golden yellowish-brown smooth hairs covered itsrhizome and basal stipe with marginal sori at the ends of veins protected by two indusia forming a small cup round the receptacle of thesorus. It has been recognized as material for both traditional and modern medicines in China, Europe, Japan and Southeast Asia.Population of Cibotium species in several countries has decreased rapidly because of over exploitation and there is no artificialcultivation until now. The aims of this study were: (i) To re-inventory the species of Cibotiun in North Sumatra, (ii) to record theecology and distribution of each species, and (iii) to assess the population size of each species. Field study was carried out by usingrandom search with belt transect. Two species were recorded, namely C. arachnoideum dan C. barometz. The geographical distributionof the two species in North Sumatra is presented. Cibotium is commonly growing terrestrially on opened or rather opened areas insecondary forest and primary forest at hills or lower mountains with a relatively high humidity at 30-90º slopes. C. arachnoideum has astrict distribution and only found at 1740-1770 m a.s.l. in primary forest, whereas C. barometz has a broad distribution in secondaryforest at elevation range from 650-1200 m.

Key words: Cibotium, ecology, distribution, tree fern, Sumatra.

INTRODUCTION

It is now widely recognized that current extinction ratesof plant and animal species are between hundred and athousand times higher than back rates throughout life’shistory of Earth (May 2002). Therefore the world’sbiodiversity should be inventoried and monitored.

As defined by Stork and Samways (1995) biodiversityinventorying is the surveying, sorting, cataloging,quantifying and mapping of entities such as genes,individuals, populations, species, habitats, biotypes,ecosystem and landscapes or their components, and thesynthesis of the resulting information for the analysis ofpattern and processes. Inventory refers to a listing of all thespecies of plants, animals, fungi, protest and microbes in adefined area. Survey refers to methodical exploration of anarea in order to discover the species that live there(Wheeler 1995). Inventories for rare plants may bedesigned to: (i) Locate populations of species; (ii)Determine total number of individuals of species; (iii)Locate all population of rare species within a specific area(often a project area); (iv) Locate all rare species occurringwithin a specific habitat type; (v) Asses and describe thehabitat of rare species (associated species, soils, aspect,elevation); (vi) Asses existing and potential threats to apopulation (Elzinga et al. 2005)

There are three levels of monitoring for plant population:

distribution, population size and demographic monitoring.These can be applied to species according to theirsprotection and management objectives (Menges andGordon 1996). Hutching (1991) described that the statusand trends of plant population may be studied on fourlevels: population distribution, quantitative monitoring ofpopulation size and (or) condition, monitoring ofpopulation structure, and demographic study thepopulation. Basic information about the distribution andregional dynamics of different species is essential forpractical conservation management of rare species, i.e.species with low relative abundance or distribution atcontinental, and particularly at regional and local levels.

Cibotium Kaulfuss is a genus of about 12 species oftropical tree fern (Holttum 1963; Hassler and Swale 2002)which is subject to much confusion and revision. Thereforeit is treated in different family, such as in subfamilyCibotioideae of Cyatheaceae (Holttum 1963), Cibotiaceae(Hassler and Swale 2002; Smith 2006). This genus isdistributed in Central America and Mexico, Hawaii, Assamto southern China, southwards to Western Malesia andPhilippines (Holttum 1963).

Cibotium comprises large ferns with usually prostrate orerect trunk-like rhizome and large bipinnate fronds. Theapex of rhizome is protected by a thick cover of longslender golden yellow-brown hairs. These hairs are alsolong at the base of the stipe and often matted in appearance.

PRAPTOSUWIRYO et al. – Inventorying of the tree fern Genus Cibotium 205

Sori are marginal, at the ends of veins, protected by twoindusia which are alike in texture and diffrent from thegreen lamina of lobes on which they are borne, the outerindusium deflexed so that the sorus appears to be on theside of the lobe, the inner indusium at maturity bendingback towards the costule and elongating, usually becomingoblong, the two indusia joined together for a short distanceat the base, thus forming a small cup round the receptacleof the sorus (Holttum 1963; Large and Braggins 2004).

One species of Cibotium, namely C. barometz, has beenrecognized as material for the traditional medicine andmodern medicines in China, Japan and France (Zamora andCo 1986, Praptosuwiryo 2003). In China the species hasimportant value for medicinal purpose which is known inmedicinal trade as ‘gou ji’ (Jia and Zhang 2001, Smith2009). The gold yellowish-brown hairs on its rhizome andstipes have been used in S.E. Asia and China as a stypticfor a bleeding wound (Zamora and Co 1986, Jia and Zhang2001). The extract of the rhizome (‘gouji’) is also used byChinese and Japanese as an antirheumatic, to stimulate thelever and kidney, to strengthen the spinal, to expel windand damppnesss, and as a prostatic remedy (Zamora andCo 1986).

Population of Cibotium species in several countries hasdecreased rapidly because of over exploitation and there isno artificial cultivation until now. The species has beenincluded in Appendix II of the Convention on InternationalTrade in Endangered Species (CITES) since 1976. In orderto utilize it in sustainable use, NDF (Non DetrimentsFinding) system has to be applied for determining theannual quotas. Biological aspect is one of the importantinformation that is needed to be known, including theecology, population size and distribution. To obtain thosedata, inventories and monitoring of the population need tobe done.

Based on the specimens examined housed at HerbariumBogoriense (BO) there was only one record of Cibotiumcollected from North Sumatra. It was collected by H.Surbeck in on 30 May 1941 (No. Coll.: H. Surbeck 114)Sibuctan south, Lae Pondom (the correct name is LaoPondom), 1100 m, edge of primary forest, and identified asC. barometz. The correct name of this record is C.arachnideum. This paper presents the recently data onecology, population size and distribution of Cibotiumspecies in North Sumatra. For practical consideration, inthis study, populations were defined as spatially distinctassemblages of plants at certain sites, without consideringthe genetic structure of the population. Following thosedefined by Landi and Angiolini (2008) populations weredefined as discrete clusters of plants, separated from othercluster by at least 500 m.

Most studies on the ecology, population and distributionof ferns were based on quantitative methodologicalapproaches, such as Landi and Angiolini (2008; 2010),Banaticla and Buot (2005). However these studies can alsobe approached by using qualitative methodology (Nitta2006; Boonkerd et al. 2008; Rusea et al. 2009). The aims ofthe study were: (i) to re-inventory the species of Cibotiumin North Sumatra, (ii) to record the ecology and distributionof each species, and (iii) to assess the population size of

each species by using random search methodology usingbelt transect.


Site studiesNine localities of Cibotium habitats included in six

subdistrict of three district, Dairi District, Karo District andDeli Serdang District, were successfully surveyed (Table1). There is only one locality of Cibotium population foundin Dairi District, namely Bukit Kota Buluh, Kota BuluhVillage, Tanah Pinem subdistrict. Three localities aresituated at Karo District, namely: (i) Bukit Butar, ButarVillage, Tiga Binanga Subdistrict; (ii) Aik Batu Forest-LauPondom, Aik Hotang Village, Merek Subdistrict; (iii)Samperen Secondary Forest, Bukit Layang, Negeri JuharVillage, Juhar Village. Four localities are included inSibolangit subdistrict, Deli Serdang district, namely: (i)Tikungan Amoi forest, Tahura Bukit Barisan, Bandar BaruVillage; (ii) Betimus River, Wely forest, SukamakmurVillage, and (iii) Kataruman Forest, Takur-Takur Hill,Negeri Suah Village; (iv) Gunung Sibayak II, Treck MataAir Petani, Bandar Baru Village. One locality situated inKota Limbare Subdistrict of Deli Serdang District, namelySungai Sae Binge Forest. Habitat characteristics of the ninelocalities are summarized in Table 2.

ProceduresData on ecology and distribution was based on

observation during field studies and also derived fromherbaria sheet information or collection notes of specimensdeposited at BO (Herbarium Bogoriense). Field studieswere carried out in October-December 2009 in North Sumatraprovince, Indonesia. Voucher specimens are deposited atBOHB (Herbarium of Bogor Botanic Gardens).

Random search with belt transect is set up to estimatethe population size or the abundance of adult plant of C.barometz in a certain area. Belt transect is very commonlyused in studies on population biology of plants (see Lutes2002; Shenoy et al. 2011). In the study of C. barometz thebelt transect was set up in 20x125 m2 or 20 x 250 m2 with20 x 25 m2 subplots (Figure 1). The position and number oftransect were determined based on the spatial distributionpattern of C. barometz in each distribution areas. In generalC. barometz reveals in the same direction of the contour ofhills. Therefore, in this study the belt transect wasestablished in the line of hills contour as this transectmethod is usually very suitable to be applied on the fieldareas having hilly or mountainous contour. One transectwas set up if the population of C. barometz in a certainareas was only found in certain slope. Minimally 3transects were set up in the situation in which C. barometzdistributed from lower slopes to upper slope, viz. lower,middle and upper slopes. Population size data generatedfrom transects were used to estimate the population size ofC. barometz in a certain areas in which its populationperformance were almost similar to the populationperformance in transect. Transects commonly cover 25-30% of the total distribution areas of C. barometz.


Figure 1. Basic sampling unit of C. barometz survey, a long, 20 x250 m belt-transect, with subplots (20 x 25 m).

The activities that have been carried out in this surveycould be described as follows: (i) exploring the habitat ofC. barometz; (ii) morphological diversity observation; (iii)collecting population data; (iv) recording the associatedplants with C. barometz and environmental conditionaround C. barometz vegetation (elevation, slope, airtemperature and humidity, soil type in general, pH andhumidity of soil, the thickness of litter and humus soil).

In collecting population data only the mature plantswere recorded for each species which was determined bythe following categories: (i) rhizome at least 10 cm height,8 cm diam. or more; (ii) lamina more than 60 cm long and(iii) presence of fertile fronds. Cibotium is usually growingsolitary or in a clump (consisted of 2-20 individuals). Inthis research population size was determined by countingindividual plant not clump.

Figure 4. Distribution map ofCibotium in North Sumatra. 1. TanahPinem Subdistrict; 2. Tiga BinangaSubdistrict; 3. Juhar Subdistrict; 4.Merek Subdistrict; 5. Kuta LimbareSubdistrict; 6. Sibolangit Subdistrict.

Table 1. The geographical distribution of Cibotium species in North Sumatra

31

2

4

56


District Subdistrict Locality Species

Dairi Tanah Pinem Bukit Kota Buluh, Kota Buluh Village C. baromertzKota Limbare Sungai Sae Binge forest C. baromertzSibolangit Tikungan Amoi forest, Tahura Bukit Barisan, Bandar Baru Village C. baromertzSibolangit Betimus River, Wely forest, Sukamakmur Country, C. baromertzSibolangit Kataruman Forest, Takur-Takur Hill, Negeri Suah Village C. barometz

Deli Serdang

Sibolangit Gunung Sibayak II, trek Mata Air Petani, Bandar Baru Village C. baromertzTiga Binanga Bukit Butar, Butar Village, C. barometzJuhar Samperen Secondary Forest, Bukit Layang, Negeri Juhar Village C. baromertzMerek Aik Batu Forest-Lau Pondom, Aik Hotang Village C. arachnoideum

Karo


FloristicThere are only two species found in North Sumatra, viz.

C. arachnoideum and C. barometz (Table 1, 2; Figure 2, 3).The two species are distinguished by three characterscombinations: (i) the existence the hairs on costa andcostule of the adult fronds; (ii) the incision of pinnulaesegments, (iii) the pair number of sori. Cibotium barometzdiffers from C. arachnoideum by combination of diagnosticcharacters as follows: C. barometz has sori 2 or more pairson each pinnule-lobe of larger fronds, largest pinnules 20-35 mm wide, pinnules on the two sides of a pinna notgreatly different in length, hairs on lower surface of costaeand costules almost always thin and flaccids and neverspreading. Meanwhile C. arachnoideum always has twopairs of sori on large fronds, largest pinnules 15-26 mmwide, pinnules on basiscopic side of lower pinnae muchshorter than those on acroscopic side, spreading hairslacking, but rigid (often red) appressed hairs always presentand sometimes abundant, small flaccid hairs present onlower surface of lamina between vein. Those characterscombinations are met those specimens described byHolttum (1963).

DistributionGeographical distribution of Cibotium in North Sumatra

is presented in Table 1. and Figure 4. Holttum (1963)reported that C. arachnoideum was only distributed inMalesian region in Central and South Sumatra, Sarawak,and N. Borneo. There was one locality of this species foundin North Sumatra, namely Lau Pondom (Table 1.) Based onthe notation of the specimen examined from BO(Herbarium Bogoriense), this species was found at themargin primary forest in Lau Pondom at 1100 m a.s.l

In North Sumatra C. barometz is more widelydistributed than C. arachoideum (Table 1.). Thegeographical distribution data of C. barometz in NorthSumatra is a new record for science. It would giveimportant information in defining the current and futureoptions available to meet human needs, especially forNorth Sumatra society, in future, and guiding immediateand long term management, policy and decision-makingconcerning the sustainable uses of C. barometz.

In the biogeographic point of view Cibotium providesan excellent example combining several kinds ofdistributional change as well as speciation (Barrington,1993). Cibotium is a Pacific-rim genus of about eightextant species, one in southeastern Mexico (C. schiedeiSchlect. & Cham.), one or perhaps two (C. barometz (L.) J.Sm. and C. cumingii Kze.) in the Old-World tropics fromAssam to China to Western Malesia region) and thePhilippines (Holttum, 1954; Copeland, 1958) and about sixin Hawaiian islands (Becker, 1984; Wagner 1990). Holttum(1963) reported three species of Cibotium in Malesianregion, namely C. arachnoideum (C.CHR.) Holttum, C.barometz (L.) J. SM. and C. cumingii Kze. Holttum (1963)stated that in Malesia C. barometz distributes in MalayPeninsula, Sumatra and Java, but there is no new record ofthis species in Java after Backer and Posthumus (1939).

Habitat characteristicsThe habitat characteristics of two species of Cibotium

are relatively different (Table 1). Cibotium arachnoideumin Lao Pondom is found at elevation range from 1740-1770m. This species grows on a range temperature of 23-23.5ºC, moist condition (RH ± 80%), soil type of sandyquartz-rockery with dust or clay soil, soil acidity of 5.8,humus soil depth 3-4 cm, leaves litter depth 2.5-12.5 cm. Itgrows on the hill with 0-80 % of slopes. C. arachnoideumis found among the terrestrial fern species of Dipterisconjugata, Dicranopteris linearis, Blechnum sp., Pyrrosiasp., Hymmenophyllum sp., Hystiopteris stipulaceae.,Phymatodes sp. and Elaphoglossum sp. In Mt. Kinabalu,Borneo, C. arachnoideum usually grows in cultivatedareas. This species survives burning when land is clearedfor cultivation and persist on steep lading (fields) at 900-1200 m asl. (Parris et al. 1992).

Cibotium barometz has a wide range of habitat, atelevation range from 600-1165 m. It prefers growing onopened areas or shaded areas of secondary forest andmargin primary forest. The optimum canopy coverage of C.barometz is usually in a range from 40-60%. The localitieswith a relatively high population size, such as in secondaryforest of Butar Hill and secondary-primary forest ofKataruman Forest (Takur-takur Hill), the canopy coverageis on a range from 40-60% and 50-70%, respectively. Thisspecies needs warm temperature, 23-30ºC with humidityrange from 30-90%.


Figure 2. Cibotium arachnoideum. a. Rhizome with stipes; b. Lamina; c. Part of pinnulae with fertile lobes showing one row of sori oneach pinnule-lobe; d. Transversal section of basal stipe covered by brown shining hairs and showing the vascular bundles.

Figure 3. Cibotium barometz. a. Rhizome with stipes; b. Lamina; c. Part of pinnulae with fertile lobes showing one row of sori on eachpinnule-lobe; d. Transversal section of basal stipe covered by brown shining hairs and showing the vascular bundles.

Soil type is main factors which affect on the distributionof C. barometz. It is mainly found on yellow podzolik andred inceptisol with soil acidity 5.2-6.6. Nguyen (2009)stated that C. barometz is an acid soil indicator species intropical and subtropical area, but rare in the limesponeareas. This species can grow on hard-rock with very thinhumus soil or litter to humus rich soil with a depth rangefrom 2-15 cm.

In seconday forest C. barometz usually grows with fernpioneer species such as Nephrolepis hirsutula,Dicranopteris linearis, Gleichenia truncate, Blechnumorientale, Pteridium aquilinum, Histiopteris stipulace,Taenitis blechnoides and Dipteris conjugata. In the marginof primary forest this species can be found among the lightshady ferns as well as the opened area ferns. The light

shady ferns which are usually found among the C.barometz are Cyathea recomuttata, Diplazium bantamense,D. cordifolium, D. crenatoserratum, D. tomentosum,Selaginella spp. While the opened area ferns grow with thisspecies are almost similar to those found in secondaryforest areas. C. barometz also survives on burning areaswhen land is cleared for cultivation by producing newshoots from the rhizome. In this condition this species isusually found among and at the margin thicket of P.aquilinum (Figure 3).

Cibotium in the secondary forest community of NorthSumatra can be included in the key species. In NorthSumatra Cibotium often dominates an area where thisspecies occurs, such as in Aik Batu Forest of Lao Pondom,Kataruman Forest of Bukit Takur-Takur, Samperen Forest

C

A B D

C

A B D


Table 2. Distribution, population size and habitat characteristics of Cibotium in North Sumatra

Habitats characteristics of species

Locality, forest type,and Species

Populationsize

(Σmatureindividual/

ha)

Slope( º )

Altitude(m)

Tempe-ratures

Airhumi-dity

Canopycoverage

(%)

Majorsoil type

Leaveslitterdepth(cm)

Humussoil

depth(cm)

Soilacidity(pH)

Terrestrial fern species and seed plants commonly associated

Aik Batu Forest, LaoPondomPrimary forest-secondary forestC. arachnoideum

372/0.25 30-80 1740-1770 23-23.5 80-80.5

50-70 Sandyquartz-rockery withdust or claysoil

2.5-12.5 3-4 5.8 Dipteris conjugata, Dicranopteris linearis, Blechnum sp., Pyrrosia sp.,Hymmenophyllum sp., Hystiopteris stipulaceae., Phymatodes sp. dan Elaphoglossum.Leptospermum flavescens, Dacrycarpus imbricatus,, Podocarpaceae, Myrtaceae,Ericaceae, Melastomataceae, Pandanaceae, Nephentaceae

Bukit ButarSecondary forestC. barometz

1128/1 45-80 Ca. 875-900

24-25 75-80 40-60 Yellowpodzolid

3-10 2.5-4 5.8 Pteriudium aquilinum, Adiantum sp., Taenintis blechnoides, Selaginella sp.,Drypteris sp., Dicarnopteris linearis, Davallia sp. Gleichenia sp, Gleichenia truncateSchima wallichii, Sloanea sigun, Zingiberaceae,, Apocynaceae, Fagaceae, Theaceae

Kataruman Forest ofTakur-takur HillPrimary forest-secondary forestC. barometz

1464/1 30-70 650-817 24-25.5 80-80.5

50-70 Redinseptisol

6.5-12.5 2-6.5 6.4-6.5 Diplazium simplicivenium , Pleocnemia irregilaris, Tectaria sp., Nephrolepis sp.,Diplazium crenatoserratu,Eurya nitida, Arenga pinnata, Arecaceae, Theaceae, Moraceae

Tekungan Amoi Forest(TAHURA BukitBarisan I)Secondary forestC. barometz

17/2 25-35 650-700 23-24 80-85 60-70 Yellowpodzolid

2-4 6-10 6.0-6.4 Cyathea recomuttata, Diplazium bantamense, D. cordifolium, D. crenatoserratum,D. pallidum, D. simplicivenium, D. tomentosum, Selaginella sp, Nephrolepisacuminata, Histiopteris stipulaceae,Araceae, Fagaceae, Elaeocarpaceae

Wely Forest-BetimusRiverSecondary forestC. barometz

13/2 760-780 24-25 80-85 50-60 Yellowpodzolid

10-15 10-12.5 6.4 Diplazium betimusense, Cyathea contaminans, Cyathea sp., Thelypteridaceae,Sellaginela sp.,Syzygium sp., Artocarpus sp., Araceae, Moraceae, Myrtaceae, Theaceae, Fagaceae

Gunung Sibayak II(Trek Mata Air Petani).Primary-secondaryforestC. barometz

4/1 35-40 980-1090 23.3-25.0

80-96 60-70 Yellowpodzolid

5 5-10 5.0 Selaginella sp, Cyathea contaminans, Cyathea sp., Dydimochlaena truncatula,Pleocnemia sp., Thelypteridaceae, Asplenium cf. laserpitiifolium, Diplaziumbantamense var. bantamense, D. bantamense var. alternifolium, D. subserratum, D.betimusense, D. tomentosum, D. xiphophyllum dan D. sorzogonense.Araceae, Moracceae, Myrtaceae, Rubiaceae

Samperen Forest, BukitLayangC. barometz

385/0.5 45-50 1110-1165 27 72 50-75 RedInseptisol

3-7 2-3 6.2 Pteridium aquilinum, Woodwardtia sp., Lindsaea sp., Cheiopleura biscupsis, TaenitisblechnoidesAraceae, Myrtaceae,

Forest of Bukit KutaBuluhSecondary forestC. barometz

402/0.5 30-40 800 29.4 78 30-40 RedInseptisol

3-10 2.5-4 5.5 Dicranopteris linearis, Gleichenia truncata, Pteridium aquilinum, Nephrolepishisutula.Piper aduncum, Moraceae,

Sungai Sae BingeForestSecondary forestC. barometz

163/0.5 0-90 740-760 25-26.4 83-88 40-45 Yellowpodzolid

3 3 5.2-5.8. Blechnum orientale, Lindsaea sp., Taenitis blechnoidesAraceae, Arecaceae, Myrtaceae,

PR

AP

TO

SU

WIR

YO

et al.–Inventorying ofthe

treefern G

enusC

ibotium209


Figure 5. Habitat characteristics of Cibotium barometz. a. and b. Margin of primary forest at Bukit Layang; c. Burning areas ofsecondary forest of Bukit Layang showing three plants of C. barometz; d. Margin of secondary forest at Bukit Butar showing theassociated fern species of C. barometz, Dicranopteris linearis and Gleichenia truncate. White arrow showing individual or clump of C.barometz

of Bukit Layang and Bukit Butar. The species which isusually the dominants or more robust ones in thecommunity, in particular they are those whose populationdynamics has a strong effect on other species in thecommunity is included in key species (Mueller-Dombois2005). In the mature Hawaiian rainforest Cibotium spprevealed the characteristic of key species.

Population sizePopulation size data of Cibotium species in North

Sumatra is presented in Table 2. These are new potentialdistribution of Cibotium in Sumatra. Secondary forest ofBukit Butar and Kataruman Forest, Bukit Takur-Takur,showed a relatively high population size of C. barometz ,more than 1000 adult plants in one hectare areas. BukitLayang and Bukit Kuta Buluh were also revealed a highenough population size as the two localities showed anestimation population size of 350-400 individuals of adultsplant in 0.5 hectare areas. The relative density of C.barometz per hectare is usually determined by distanceamong the individual plants or clumps, clumps size, thedominance of the habit whether solitary or forming aclump.

In comparison with the population of C. barometz thepopulation size C. rachnoideum in Lao Pondom is verysmall as it was only 372 individuals in 2500 m2. Habit typeappears significant in determining the population size ofthe two species. In North Sumatra C. arachnoideum isusually grows solitary or forms a clump which is onlyconsisted of 2-3 plants whereas C. barometz in can form aclump in a range from 2-5 individuals. Habitatcharacteristics are also significant factors on the populationsize (Table 2). Referring the categories the criteria of theIUCN Standarts and Petition Subcommittee (2010) used toevaluate if a taxon belongs in threatened categories(Critically Endangered, Endangered or Vulnerable) C.arachnoideum in North Sumatra is vulnerable as there isonly one population found and the size of population is lessthan 500 individuals in 2500 m2 of the areas occupancy.

CONCLUSION

Two species of Cibotium are recorded in NorthSumatra, namely C. arachnoideum and C. barometz.Cibotium arachnoideum has a strict distribution and is only

C D

A B


found in one locality (Aik Batu Forest, Pondom Stream(Lao Pondom), Aik Hotang Village, Merek Subdistrict,Karo District) and strictly distributed at 1740-1770 m s.l.C. barometz is more widely distributed and found at eightlocalities, namely Butar Hill, Tikungan Amoi Forest,Betimus River, Kataruman Forest, Gunung Sibayak II, trekMata Air Petani, Samperen secondary forest (BukitLayang), Bukit Kota Buluh and Sungai Sae Bingesecondary forest from elevation 650 until 1200 m.Cibotium is commonly growing in open areas and ratheropened areas of secondary forest and primary margin forestof hills and lower montane with a relatively high humiditywith a range from 30-90º slope in acid soil. In NorthSumatra, the two species of Cibotium reveal a relativelydifferent habitat characteristic. The two species will notgrowing together on the same areas because they are livingin different altitudes. Population size of C. barometz inNorth Sumatra showed a relatively high population size infour localities (Bukit Butar, Bukit Takur-takur, BukitLayang, Bukit Kuta Buluh) with the estimation of 700-1500 individuals in 10,000 m2. Cibotium arachnoideum inNorth Sumatra is vulnerable as there is only one populationfound and the size of population is less than 500individuals with an area of occupancy less than 3000 m2.Further studies on spatial distribution and habitatcharacteristics of C. barometz and C. arachnoideum inSumatra are needed. Further studies on biologicalcharacteristics and mechanism triggering the rarity of C.arachnoideum in Sumatra are also very important.

ACKNOWLEDGEMENTS

This research was supported by Center for PlantConservation-Bogor Botanical Gardens, IndonesianInstitute of Science and North Sumatra ConservationAgency (Balai Besar Konservasi Sumber DayaAlam, Sumatra Utara). We wish to thank the Director ofthe Herbarium Bogoriense (BO) which allowed us usematerial and facilities. The present study was supported bya Grant-in-Aid for Scientific Research from DirectorateGeneral of Higher Education, Ministry of NationalEducation, GoI, 18/SU/SP/Insf.-DIKTI/VI/09, under theProgram Insentif Peneliti dan Perekayasa LIPI TA 2009.

REFERENCES

Backer CA, Posthumus O (1939). Varenflora voor Java. Uitgave van’sLands Plantetuin, Buitenzorg.

Banaticla MCN, Buot Jr IE (2005) Altitudinal zonation of pteridophyteson Mt Banahaw de Lucban, Luzon Island, Philippines. Plant Ecol180: 135-151.

Barrington DS (1993) Ecological and historical factors in fernbiogeography. J Biogeogr 20: 275-280.

Becker R (1984) The identification of Hawaiian tree ferns of the genusCibotium. Am Fern J 74: 97-100.

Boonkerd T, Chantanaorrapint S, Khwaiphan W (2008) Pteridophytediversity in the tropical lowland rainforest of Khao Nan National

Park, Nakhon Si Thammarat Province, Thailand. Nat Hist JChulalongkorn Univ 8 (2): 83-97.

Copeland EB (1958) Fern flora of the Philippines. Vol I. Bureau ofPrinting, Manila.

Elzinga CL, Salzer DW, Willoughby JW (2005) Measuring andmonitoring: Plant populations. Nature Conservation, U.S. Departmentof the Interior, Bureau of Land Management. Washington DC.

Hassler M, Swale B (2002) Family Dicksoniaceae genus Cibotium; worldspecies list. http://homepages.caverock.net.nz/~bj/fern/cibotium.htm[Accesed 17 Mei 2008].

Holttum RE (1954) Fern of Malaya. Goverment Printing Office,Singapore.

Holttum RE (1963). Cyatheaceae. Flora Malesiana Ser II. Vol 1 (2): 164-166.Hutchings MJ (1991) Monitoring plant populations: cencus as an aid to

conservation. In: Goldsmith EB (ed) Monitoring for conservation andecology. Chapman & Hall, London.

IUCN Standarts and Petition Subcommittee (2010). Guidelines for usingthe IUCN Red List Catagories and Criteria. Version 8.1.http://intranet.iucn.org/webfiles/doc/SSC/RedListGuidelines.pdf

Jia J-S, Zhang X-C (2001) Assessment of resources and sustainableharvest of wild Cibotium barometz in China. Med Pl Conserv 7: 25-27.

Landi M, Angiolini C (2008) Habitat characteristics and vegetationcontext of Osmunda regalis L. at the southern edge of its distributionin Europe. Botanica Helvetica 118: 45-57.

Landi M, Angiolini C (2010) Population structure of Osmunda regalis inrelation to environmental and vegetation: An example in theMediterranean area. Folia Geobot. DOI 10.1007/s12224-010-9086-1

Large MF, Braggins JE (2004) Tree ferns. Timbers Press, Portland.Lutes DC (2002) Assessment of line transect method: An examination of the

spatial patterns of down and standing dead wood. USDA ForestService Gen.Tech. Rep. PSW-GTR-181, Washington DC.

May RM (2002) The future of biological diversity in a crowded world.Curr Sci 82 (11): 1325-1331.

Menges ES, Gordon DR (1996). Three levels of monitoring intensity forrare plant. Nat Areas J 16:227-237.

Mueller-Dombois D (2005) A silviculture approach to restoration ofnative Hawiian Rainforest. Lyonia 8(1): 61-65.

Nguyen T, Le TS, Ngo DP, Nguyen QN, Pham TH, Nguyen TH (2009)Non-detriment finding for Cibotium barometz in Viet Nam. NDF-workshop case studies (in English), Mexico, SC58 Doc. 21.1. Annex 2.

Nitta JH (2006) Distribution, ecology, and systematic of the filmy ferns(Hymenophyllaceae) of Moore, French Polynesia. UCB MooreaClass: Biology and Geomorphology of Tropical Islands, BerkeleyNatural History Museum, UC Berkeley.http://escholarship.org/uc/item/6vt6p2w8

Parris BS, Beaman RS, Beaman JH (1992) The plants of Mount Kinabalu.I. Ferns and fern allies. Royal Botanic Gardens, Kew.

Praptosuwiryo TNg (2003) Cibotium barometz. (L.) J. Smith. In: deWinter WP, Amoroso VB (eds) Plant resources of South-East Asia 15(2) Cryptogams: Ferns and ferns allies. Prosea, Bogor.

Rusea G, Claysius K, Runi S, Joanes U, Haja Maideen KM, Latiff A(2009) Ecology and distribution of Lycopodiaceae Mirbel inMalaysia. Blumea 54: 269-271.

Shenoy A, Johnstone JF, Kasischke ES, Kielland K. (2011) Persistenteffects of fire severity on early successional forests in interior Alaska.For Ecol Manag 261: 381-390.

Smith AR, Pryer KM, Schuettpelz E, Korall P, Schneider H, Wolf PG(2006) A classification for extant fern. Taxon 55: 705-731.

Smith DM (2009) Osteoporosis treatment with Chinese herb Gou Ji?Cibotium or Vegetable Lamb Plant May Help Reduce Bone DensityLoss. http://www.suite101.com/content/osteoporosis-treatment-with-chinese-herb-gou-ji-a163821.

Stork NE, Samways MJ (1995) Inventorying and monitoring. In:Heywood VH, Watson RT (eds) Global biodiversity assessment.United Nations Environment Programme and Cambridge UniversityPress, Cambridge.

Wagner WH (1990) Hawaii’s satchel-sorus tree ferns, Cibotium species:What is their taxonomic status? Fiddlehead Forum 17 (1): 7-8.

Wheeler OD (1995) Systematic, the scientific basis for inventory ofbiodiversity. Biodiv Conserv 4: 476-489.

Zamora PM, Co L. (1986) Economic ferns. In: Guide to Philippines floraand fauna. Vol. II. National Resources Management Centre, Ministryof Natural Resources and University of the Philippines, Manila.

BIODIVERSITAS ISSN: 1412-033X (printed edition) Volume 12, Number 4, October 2011 ISSN: 2085-4722 (electronic) Pages: 212-217 DOI: 10.13057/biodiv/d120405

Species composition and interspecific association of plants in primary succession of Mount Merapi, Indonesia

SUTOMO1,♥, DINI FARDILA2, LILY SURAYYA EKA PUTRI2 1Bali Botanic Garden, Indonesian Institute of Sciences, Candikuning, Baturiti, Tabanan 82191, Bali, Indonesia. Tel. +62-368-21273. Fax. +62-368-

22051. ♥email: [email protected] 2Biology Department, Faculty of Science and Technology, Syarif Hidayatullah State Islamic University, South Tangerang 15412, Banten, Indonesia.


ABSTRACT

Sutomo, Faradila D, Putri LSE (2011) Species composition and interspecific association of plants in primary succession of Mount Merapi, Indonesia. Biodiversitas 12: 212-217. Primary succession refers to the establishment of plant species and subsequent changes in composition following major disturbance such as volcanic activity. The study of succession may assist in recognizing the possible effects of species interactions (i.e. facilitation or inhibition). The barren landscapes created by volcanic disturbance on Mount Merapi, Java, Indonesia, provide excellent opportunities to study primary succession. Fifty-six species belonging to 26 families were recorded in the five nuées ardentes deposits. The highest number of species belonged to the Asteraceae, then Poaceae, followed by Fabaceae and Rubiaceae. In Mount Merapi primary succession, the ecosystem may be developing with time as indicated by the increase in the number of species associations. The number of positive associations was generally higher than the number of negative associations, except in the 2001 deposit where it was equal. Native and alien invasive species had different patterns of interspecific associations. This research demonstrates that in primary succession sites on Mount Merapi, positive interspecific association increased as time progressed, which may support the view that facilitation is more prominent in a severely disturbed habitat as compared to competition.

Key words: primary succession, interspecific association, interaction, facilitation, pioneer, Mount Merapi.

INTRODUCTION

Volcanoes has shape many of the Earth landscapes (Dale et al. 2005a). More than half of the active terrestrial volcanoes encircle the Pacific Ocean and are known as the ‘ring of fire’. Hence, there are many parallel situations in the world where volcanic activity has become a major disturbance such as in Hawaii (Mount Mauna Loa), New Zealand (Mount Ruapehu), USA (Mount St. Helens), and Indonesia (Mount Krakatau). Indonesia is particularly unique because of a series of active volcanoes which stand in line from the Sumatran Island to Java Island. With 130 active volcanoes lies on its region, Indonesia has become the most volcanic country on Earth (Weill 2004).

Primary succession refers to establishment of plant species and their changes in composition following major disturbance such as volcanic disturbance (Walker and del Moral 2003). One type of volcanic disturbance is nuées ardentes or pyroclastic flows. Nuèes ardentes are hot turbulent gas and fragmented material resulting from a collapsed lava dome that rapidly moves down the volcanic slope (Dale et al. 2005b). The accumulation of this material is called a nuées ardentes deposit and it may be up to 10 m thick (Franklin et al. 1985). Volcanic eruptions are strongly linked to depositions of volcanic materials avalanche to form “un-vegetated” barren areas which started primary succession. Primary succession commence on a barren substrate that does not have any biological legacies and

does not support any organism (Walker and del Moral 2003). Vegetation establishment on volcanic deposits has been documented in many parts of the world such as in USA, Italy and Japan and their rates have been shown to vary (Eggler 1959; Tsuyuzaki 1991; Aplet et al. 1998; Dale et al. 2005c). For example, plant establishment and spread on the debris-avalanche deposit were slow during the first years after eruption of Mt St Helens in USA (Dale et al. 2005c).

Species interactions are of central importance in the study of succession. The study of succession may assist in recognizing the possible effects of species interactions (i.e. facilitation or inhibition) (Connell and Slatyer 1977; Walker et al. 2007). Facilitation promotes establishment and in the context of succession, facilitation can be defined as any role of plants that influences a change in species composition to the next stage (Walker and del Moral 2003). Previous studies have shown that in a severely disturbed habitat, the role of facilitation will be more prominent for species change and restoration, whereas competition tends to be significant in a more productive and established habitat (Callaway and Walker 1997; Walker et al. 2007). The barren landscapes created by volcanic disturbance provide excellent opportunities to examined the role of pioneer species in facilitating or inhibiting later species in succession (Morris and Wood 1989; Walker and del Moral 2003). However, initial interactions occurring during primary succession that drive

SUTOMO et al. – Species composition and plants association of Mount Merapi

213

the subsequent community composition remain studied in only a few locations (Connell and Slatyer 1977; Bellingham et al. 2001).

The nuées ardentes deposits found in Mount Merapi are relatively young, with the last known eruptions occurring between 1994 and 2006. Here we examine whether or not early interaction patterns among species can be identified by examining their interspecific association and test the hypothesis that positive association will more apparent compared with negative association over time.


Study sites Merapi is one of the most active volcanoes in

Indonesia which is located 30 km North of Yogyakarta Province in Java Island at 7º35’ S and 110º24’ E (Figure 1).

Climatologically, based on Schmidt and Fergusson’s climate classification, the Merapi area is classified as a type B, tropical monsoon area, which is characterized by high intensity of rainfall in the wet season (November-April) and then the dry season (April-October). Its annual precipitation varies from 1,500-2,500 mm. The variation of rainfall on Merapi slope is influenced by orographic precipitation. Like in many other tropical monsoon areas, there are minor temperature and humidity variations. Merapi’s relative humidity varies from 70-90% with daily average temperatures varying from 19-30° C (Forest Office of Yogyakarta 1999).

The research sites were located in the southwest flank forests of Mount Merapi within Merapi National Park. These sites are the most prone to and most often affected by volcanic disturbance due to the nuées ardentes that tend to flow down the hills in this direction. Using chronosequence (space for time substitution) method, we

Figure 1. Map of Mt. Merapi National Park’s eruption deposits. Circular symbols refer to the position of sampling sites in each deposit. The rectangle refers to the site position of an undisturbed forest in Kaliurang, Yogyakarta.

Scale 1:25.000

BIODIVERSITAS 12 (4): 212-217, October 2011 214

chose five areas that were affected by nuées ardentes deposits between 1994 and 2006 (Figure 1). The five deposit sites were located in a lower montane zone (Montagnini and Jordan 2005). The 1994 sampling site or the late primary succession site is located in an area surrounding the Kuning River, at an altitude of ± 1,180 m. In this late primary successional site the vegetation is generally composed of Eupatorium odoratum (Asteraceae) and Imperata cylindrica (Poaceae).

Sampling Vegetation on the five nuées ardentes deposits was

sampled in 2008. We sampled ten 250 m2 circular plots in each deposit (50 plots in total), assigned at random to grid cells on a map Dale et al. 2005c). Each plot was located in the field with reference to a compass and a handheld Global Positioning System GPS (Garmin E-Trex Legend). We measured plant abundance as density, a count of the numbers of individuals of a species within the quadrate (Kent and Coker 1992; Endo et al. 2008). We noted both local plant name and scientific name (when known). Whenever there was any doubt about species name, a herbarium sample was made. Drying and sample identification were done in Laboratory of Dendrology, Faculty of Forestry, Universitas Gadjah Mada, Yogyakarta. Vascular plant nomenclature is based on Backer and Bakhuizen van den Brink (1963). Although homogeneity of the sites was taken into account when choosing sample sites, differences in site conditions were likely to occur. Hence, for each circular plot, site attributes (altitude and slope) were measured. Altitude was measured using a GPS and referenced against 1:25,000 topographic maps. A clinometer (Suunto PM-5) was used to determine the slope (in degrees) (Le Brocque 1995).

Data analysis Species composition

Plant community composition between deposits was described by Curtis and McIntosh’s Importance Value Index or IVI (1950).

IVI = RD+RF IVI = Importance Value Index RD = Relative Density Relative Density of A species =

100% x species all of individualnumber Total

speciesA of individual ofNumber

RF = Relative Frequency Relative Frequency of A species = 100% x

species all of valuefrequency TotalspeciesA of valueFrequency

Interspecific association Interspecific association between species was measured

using the chi-square (χ2) test of the species presence/ absence data on a 2 × 2 contingency table (Ludwig and Reynolds 1988; Kent and Coker 1992; Supriyadi and Marsono 2001).

Species B

Present Absent ∑ Present Absent

a c

b d

a+b c+d

Species A

∑ a+c b+d N = a+b+c+d

a = the number of sampling unit (SU) where both

species occur b = the number of SUs where species A occur but not B c = the number of SUs where species B occur but not A d = the total number of SUs Then a chi square test statistic is employed to test the

null hypotheses of independence in the 2 × 2 table:

d)(c d)(b c)(a b)a (

N ) bc - ad ( x2

2

++++=

The significance of the chi-square test statistic is

determined by comparing it to the theoretical chi-square distribution (P = 0.05, df = 1) There are two type of association:

Positive, if x2 test > x2 theoretical and observed a > expected a, Where expected a =

Nc)(a b)(a ++ , that is the

pair of species occurred together more often than expected. Negative, if x2 test > x2 theoretical and observed a <

expected a, that is to say that the pair of species occurred together less often than expected.

The strength level of the association was measured using the Ochiai index, which is equal to 0 at ‘no association’ and to 1 at ‘complete/maximum association’(Kent and Coker 1992).

c)(a b)(a

a Index Ochai++

=


Fifty-six species belonging to 26 families were recorded in the five nuées ardentes deposits which mostly comprise of species belonged to the Asteraceae (herbs), then Poaceae (grasses), followed by Fabaceae (N2 fixing tree seedling) and Rubiaceae (shrub). Based on vegetation analysis with IVI computation, we found that each deposit has almost similar set of species composition except for the latest deposits sites namely 2006 and 2001 (Figure 2).

Some species such as Anaphalis javanica, Eupatorium riparium and I. cylindrica showed consistency of their appearance in almost all of the deposits (Figure 3). It is interesting to see that these species have fluctuated over time except for invasive pioneer I. cylindrica which was


215

declining in IVI index. This phenomenon may reflect that the abundance and domination of I. cylindrica decreasing as the community developed over time. The presence of other pioneer species such as A. javanica and invasive species such as E. riparium may have suppressed the domination of I. cylindrica in more developed sites.

00.10.20.30.40.50.60.70.80.9

Pas

palu

mA

thyr

ium

Pin

usD

odon

aeP

olyg

onum

Ana

phal

isE

upat

oriu

mA

thyr

ium

Cyp

erus

Impe

rata

Pan

icum

Eup

ator

ium

Ana

phal

isA

naph

alis

Pol

ytria

sE

upat

oriu

mIm

pera

taC

yper

usC

allia

ndra

Ath

yriu

mP

olyt

rias

Ana

phal

isP

olyg

ala

Impe

rata

Eup

ator

ium

Mel

asto

ma

2006 2001 1998 1997 1994

Deposits and Species

IVI

Figure 2. Dominant species based on Importance Value Index in each deposits of primary succession on Mount Merapi

00.050.1

0.150.2

0.250.3

0.350.4

0.450.5

2006 2001 1998 1997 1994

Deposits

IVI

Athyrium macrocarpumAnaphalis javanicaEupatorium ripariumImperata cylindrica

Figure 3. Changes in IVI of some pioneer species of interest in each deposits of primary succession on Mount Merapi.

0

5

1 0

1 5

2 0

2 5

3 0

3 5

2 0 0 6 2 0 0 1 1 9 9 8 1 9 9 7 1 9 9 4

D e p o sits

Numb

er of

asso

ciatio

n

P o sitiv ea sso cia tio nN e g a tiv ea sso cia tio n

Figure 4. Interspecific association of species in each deposit at primary succession sites of different age.

The number of positive associations was generally

higher than the number of negative associations, except in the 2001 deposit, where it was equal (Figure 4). Positive associations were highest in 1994, lowest in 2001 and 1998 and intermediate value in 2006 and 1997 deposits. Generally, the number of negative associations for each deposit was less than positive associations. Less variability occurred in the negative associations. Negative associations were lowest in 2001 and 1998, but almost similar for 2006, 1997 and 1994 deposits.

Native and invasive species had different patterns of interspecific associations (Table 2). Among the native species, A. javanica possessed the highest number of negative associations with other species, followed by Pinus merkusii. In contrast, Calliandra calothyrsus had the highest number of positive interspecific association compare to Athyrium macrocarpum. A. macrocarpum had the most tendencies to co-occur (or to absent together) with Polygala paniculata as shown by their strongest positive association. Among the invasive species however, I. cylindrica is very aggressive and may become dominant in the site as indicated by the absence of other co-occurring species in all deposit sites. E. riparium was more likely to occur together with Melastoma affine, whereas the presence of Calliandra calothyrsus is more likely with Cyperus rotundus (Table 2).

The nitrogen fixing legume, C. calothyrsus showed the highest number of positive associations with other species, mostly grasses such as C. rotundus and Eleusine indica. Native from Mexico, this species is now widely introduced in many tropical regions. C. calothyrsus is able to grow on a wide range of soils types, including the moderately acidic volcanic origin soils that are a common feature in the Southeast Asia (Palmer et al. 1994). This species is now naturalized in Asia including Indonesia (Palmer et al. 1994)

The mistflower (E. riparium) had a higher number of positive associations as compared to negative associations (Table 2). This species is also the dominant groundcover species in Kaliurang, an intact forest on the southern slope of Mount Merapi (Sutomo 2004). This species may have indirectly facilitated co-occurring species such as Gnaphalium japonicum and M. affine by assisting in stabilizing and preventing erosion on the deposit site (Heyne 1987). However, over domination by this invasive species could be a problem itself. Eupatorium is native to South America, and this unpalatable and highly competitive species has become a problem elsewhere, such as in Nepal (Kunwar 2003).

Cogon grass (Imperata cylindrica) did not exhibit any association with other species in any deposits (Table 2). I. cylindrica is an aggressive alien invader that has a long record of colonizing cleared lands in Indonesia (A. Hamblin, personal communication, 28 May 2009). I. cylindrica domination in Mount Merapi nuées ardentes deposits is presumably due to its wide-spread rhizomes and its wind-dispersed seeds (Jonathan and Hariadi 1999). I. cylindrica may have contributed indirectly to the increase in the number of species colonizing the deposits, especially in the early stages, by altering the soil properties (Walker and del Moral 2003; Collins and Jose 2009).

Species changes are do not only occurring in response to changes in physical environment, but can also be the result of interaction with another species, thus species interactions are also an important indicating factor in succession and ecosystem development (Walker and del Moral 2003; Muller 2005). Species co-occurrence observations may be seen as the first attempt to detect species interaction (i.e. facilitation and inhibition) and niche processes that structure a community (Walker and del Moral 2003; Widyatmoko and Burgman 2006).

BIODIVERSITAS 12 (4): 212-217, October 2011 216

While the general explanation of why two species are positively associated is because they favor the same environmental conditions, this explanation is not always as apparent as might first appear and may be over-simplistic (Kent and Coker 1992; Belyea and Lancaster 1999; Ruprecht et al. 2007). There are other factors such as plant species strategies, competition and interaction that also need to be considered (Belyea and Lancaster 1999; Dukat 2006). Facilitation may have a more vital role in species change and restoration in a severely disturbed habitat, whereas competition will tend to be important in a more productive and established habitat (Callaway and Walker 1997; Walker et al. 2007). Furthermore, one of the most important questions in plant community assembly rules may be generated from this observation: “which combination of species occurs together and why?” (Bond and Wilgen 1996).

In primary succession on Mount Merapi, the primary succession ecosystem may be developing to later stages with time as indicated by the increase in the number of species associations. Differences in the number of occurrences of positive associations with the negative associations were also recorded. Generally positive association was more apparent as compared with negative association as time progressed. This observation might support the view that in a severely disturbed habitat where primary succession is occurring, the role of facilitation will have a stronger role in species change as compared to

competition (Callaway and Walker 1997). Primary succession on Mount St. Helen was reported to be very slow due to isolated and physically stressful habitat however, facilitation by nitrogen fixing species such as Lupinus lepidus may have also occurs (del Moral and Wood 1993). Positive interaction in plant communities is more common than negative interaction in high-elevation ecosystems (Callaway 1998; Endo et al. 2008). However, there has been accumulating evidence that stated facilitation is the dominant form of interaction in many ecosystems (Callaway 2007).

Plant association has also been found in other volcanic sites across the globe. Early associations comprised of Honckenya peploides, a low-growing, sand-binding pioneer, lyme grass, Elymus arenarius, and the lungwort, Mertensia maritima, have contributed to the development of a relatively unstable ecosystem on Surtsey, a volcanic island in Iceland 30 years after eruption (Thornton 2007). On the volcanic island of Krakatau in Indonesia, the beach-creepers Ipomoea pes-caprae and Canavalia rosea, and the grasses I. cylindrica (alang-alang) or Saccharum spontaneum (glagah), have been found to form association related to the slowly growing sand dunes community on the island (Thornton 2007). Furthermore, on a volcanic desert of Mount Fuji, Japan, a dwarf pioneer shrub Salix reinii was clumped together and positively associated with the tree seedling Larix kaempferi and has shown its role as nurse-plant in primary succession (Endo et al. 2008).

CONCLUSION

This research has demonstrated that in Mount Merapi primary succession sites, positive interspecific association increased as time progressed, which supports already establish view that facilitation is more prominent in a severely disturbed habitat as compared to competition. This result could have important value for restoration programs, which could concentrate on re-planting subsequent species that have positive association with native pioneer species, perhaps preferably focusing on legume species to enhance the barren substrates.

ACKNOWLEDGEMENTS

We would like to thank Dr. Viki Cramer and Prof. Richard Hobbs from the University of Western Australia for insightful discussion, Soewarno HB from the Faculty of Forestry, Gadjah Mada University, Tri Prasetyo, the head of the Merapi

Table 2. Association tests using chi-squared test statistic (χ2) between discriminating native and invasive pioneer species.

Species Paired species Result of chi-squared test

Type of asso-

ciation

Ochiai Index

Debregeasia longifolia Associated - 0 Humata repens Associated - 0

Anaphalis javanica

Rubus fraxinifolius Associated - 0 Polygala paniculata Associated + 1 Athyrium macrocarpum Polygonum chinense Associated - 0.4 Crassocephalum crepidioides Associated + 0.84 Cyperus rotundus Associated + 1 Polygala paniculata Associated + 0.84 Panicum reptans Associated - 0.4 Eleusine indica Associated + 0.77 Polytoca bracteata Associated + 0.70

Calliandra calothyrsus

Polytrias amaura Associated - 0.4 Gnaphalium japonicum Associated + 0.84 Stachytarpheta jamaicensis Associated - 0

Eupatorium riparium*

Melastoma affine Associated + 1 Imperata cylindrica* n.a. Not

associated n.a. n.a.

Polygala paniculata Associated - 0.28 Pinus merkusii Shuteria vestita Associated - 0

Note: Association is significant at 0.05 levels. Values of the Ochiai Index (strength of association) are equal to 0 at ‘no association’ and to 1 at ‘complete/maximum association’. An asterisk (*) indicates an invasive species.


217

National Park (BTNGM) for permission to enter the national park and conduct the field data collections, Mbah Maridjan, the late caretaker and gatekeeper of the Merapi Mountain, and also the fieldwork team: Gunawan, Ali, Iqbal, and Indri, many thanks for the kind help.

REFERENCES

Aplet GH, Hughes RF, Vitousek, PM (1998) Ecosystem development on Hawaiian lava flows: biomass and species composition. J Veg Sci 9 (1): 17-26.

Backer CA, Bakhuizen van den Brink RC (1963) Flora of Java (Vol. 1). The Rijksherbarium, Leiden.

Bellingham PJ, Walker LR, Wardle DA (2001) Differential facilitation by a nitrogen-fixing shrub during primary succession influences relative performance of canopy tree species. J Ecol 89 (5): 861-875.

Belyea LR, Lancaster J (1999) Assembly rules within a contingent ecology. Oikos 86 (3): 402-416.

Bond WJ, Wilgen BWV (1996) Fire and plants (1st ed.). Chapman and Hall, London.

Callaway RM (1998) Are positive interactions species-specific? Oikos 82: 202-207.

Callaway RM (2007) Positive interac tions and interdependence in plant communities. Springer, Dordrecht.

Callaway RM, Walker LR (1997) Competition and facilitation: a synthetic approach to interactions in plant communities. Ecology 78: 1958-1965.

Collins AR, Jose S (2009) Imperata cylindrica, an exotic invasive grass,changes soil chemical properties of forest ecosystems in the Southeastern United States. In: Kohli RK, Jose S, Singh HP, Batish DR (eds.) Invasive plants and forest ecosystems. CRC Press, London.

Connell JH, Slatyer RO (1977) Mechanisms of succession in natural communities and their role in community stability and organization. Amer Nat 11: 1119-1144.

Curtis JT, McIntosh RP (1950) The interrelations of certain analytic and synthetic phytosociological characters. Ecology 31(3): 435-455.

Dale VH, Swanson FJ, Crisafulli CM (2005a) Disturbance, survival and succession: understanding ecological responses to the 1980 eruption of Mount St. Helens. In: Dale VH, Swanson FJ, Crisafulli CM (eds.) Ecological responses to the 1980 Eruption of Mount St. Helens. Springer, New York.

Dale VH, Acevedo JD, MacMahon J (20053) Effects of modern volcanic eruptions on vegetation. In: Marti J, Ernst G (eds.) Volcanoes and the environment. Cambridge University Press, New York.

Dale VH, Campbell DR, Adams WM, Crisafulli CM, Dains VI, Frenzen PM (2005c) Plant succession on the Mount St. Helens Debris-Avalanche deposit. In: Dale VH, Swanson FJ, Crisafulli CM (eds.) Ecological responses to the 1980 eruption of Mount St. Helens. Springer, New York.

del Moral R, Wood DM (1993) Early primary succession on the volcano Mount St. Helens. J Veg Sci 4: 223-234.

Dukat BZ (2006) Analysing associations among more than two species. Appl Ecol Environ Res 4 (2): 1-19.

Eggler WA (1959) Manner of invasion of volcanic deposits by plants, with further evidence from Parricutin and Jorullo. Ecol Monogr 29(3): 267-284.

Endo M, Yamamura Y, Tanaka A, Nakano T, Yasuda T (2008) Nurse-plant effects of a dwarf shrub on the establishment of tree seedlings in

a volcanic desert on Mt, Fuji, Central Japan. Arctic, Antarctic Alpine Res 40 (2): 335-342.

Forest Office of Yogyakarta (1999) general plan of protected area management. Special Province of Yogyakarta, Yogyakarta.

Franklin JF, MacMahon JA, Swanson FJ, Sedell JR (1985) Ecosystem responses to catastrophic disturbances: lesson from Mount St. Helens. National Geographic Res 1: 198-216.

Heyne K (1987) Tumbuhan berguna Indonesia (Vol. 1). Yayasan Sarana Wana Jaya, Jakarta.

Jonathan J, Hariadi BPJ (1999) Imperata cylindrica (L.) RaeuschelIn. In: de Padua LS, Bunyapraphatsara N, Lemmens RHMJ (eds.) Plant resources of South-East Asia No. 12 (1): medicinal and poisonous plants 1. Backhuys Publisher, Leiden.

Kent M, Coker P (1992) Vegetation description and analysis: a practical approach. John Wiley and Sons, New York.

Kunwar RM (2003) Invasive alien plants and Eupatorium: biodiversity and livelihood. Him J Sci 1(2): 129-133.

Le Brocque AF (1995) Vegetation and environmental patterns on soils derived from Hawkesbury Sandstone Narrabeen substrata in Ku-ring-gai Chase National Park, New South Wales. Australian J Ecol 20: 229-238.

Ludwig JA, Reynolds JH (1988) Statistical ecology: a primer on methods and computing. John Wiley and Sons, Singapore.

Montagnini F, Jordan CF (2005) Tropical forest ecology: the basis for conservation and management. Springer, Berlin.

Morris WF, Wood DM (1989) The role of Lupine in succession on Mount St. Helens: facilitation or inhibition? Ecology 70(3): 697-703.

Muller F (2005) Ecosystem indicators for the integrated management of landscape health and integrity. In: Jørgensen SE, Costanza RE, Xu FL (eds.) Ecological indicators for assessment of ecosystem health. CRC Press, London.

Palmer B, Macqueen DJ, Gutteridge RC (1994) Calliandra calothyrsus: a multipurpose tree legume for humid locations. In: Gutteridge RC, Shelton MH (eds.) Forage tree legumes in tropical agriculture. Queensland Tropical Grassland Society of Australia Inc., Brisbane.

Ruprecht E, Bartha S, Botta-Dukát Z, Szabó A (2007) Assembly rules during old-field succession in two contrasting environments. Comm Ecol 8 (1): 31-40.

Supriyadi, Marsono D (2001) Manual laboratory of forest ecology. Laboratory of Forest Ecology, Department of Forest Resources Conservation, Faculty of Forestry, Gadjah Mada University, Yogyakarta. [Indonesia]

Sutomo (2004) Biomass and community structure of below ground plant in Kaliurang protected forests: studies at plot 7 RPH Kaliurang. Gadjah Mada University, Yogyakarta. [Indonesia]

Thornton I (2007) Island colonization, the origin and development of island communities: ecological reviews. Cambridge University Press, Cambridge.

Tsuyuzaki S (1991) Species turnover and diversity during early stages of vegetation recovery on the volcano Usu, Northern Japan. J Veg Sci 2: 301-306.

Walker LR, Walker J, del Moral R (2007) Forging a new alliance between succession and restoration. In: Walker LR, Walker J, Hobbs RJ (eds.) Linking restoration and ecological succession. Springer, New York.

Walker RL, del Moral R (2003) Primary succession and ecosystem rehabilitation. Cambridge University Press, Cambridge.

Weill A (2004) Volcanoes. Saddleback Educational Publishing, California.

Widyatmoko D, Burgman MA (2006) Influences of edaphic factors on the distribution and abundance of a rare palm (Cyrtostachys renda) in a peat swamp forest in Eastern Sumatra, Indonesia. Austral Ecol 31: 964-974.


Establishing a long-term permanent plot in remnant forest of CibodasBotanic Garden, West Java

ZAENAL MUTAQIEN♥, MUSYAROFAH ZUHRI♥♥

Cibodas Botanic Garden- Indonesian Institute of Sciences (LIPI), Sindanglaya, Cipanas, Cianjur 43253, West Java, Indonesia, Tel./Fax.: +62-263-512233, email: [email protected], [email protected]

Manuscript received: 4 December 2010. Revision accepted: 5 September 2011.

ABSTRACT

Mutaqien Z, Zuhri M (2011) Establishing a long-term permanent plot in remnant forest of Cibodas Botanic Garden, West Java.Biodiversitas 12: 218-224. Cibodas Botanic Garden (CBG) has unique characters; almost 10% of which is forested area adjacent to thenatural forest of Mt. Gede Pangrango National Park. The area is a transition between natural forest and artificial habitat which mostlyconsists of exotic plant species. The permanent plot in CBG was established in 2007-2009. Two hundred and eighty four units of 10x10square meters sub-plot were established in four locations, i.e. Wornojiwo, Kompos, Jalan Akar, and Lumut forest. Vegetation analyseswere conducted for trees, saplings, shrubs, and herb species. The inventory found 137 species plants consisting of 74 tree speciesdominated by Villebrunea rubescens (Bl.) Bl. and Ostodes paniculata Bl., 30 shrub species dominated by Strobilanthes hamiltoniana(Steud.), 24 herb species dominated by Cyrtandra picta Bl., 6 fern species mainly consisted of Diplazium pallidum Moore, and 3climber species dominated by Calamus reinwardtii Mart. In comparison with the natural forest of Mt. Gede Pangrango National Park,the CBG permanent plot showed a good representative of the vegetation of lower montane forest. A regular monitoring during thesuccessive years is needed to maintain diversity, monitor forest dynamics and anticipate the spread of invasive plant from CBG.

Key words: Cibodas Botanic Garden, permanent plots, remnant forest.

INTRODUCTION

Cibodas Botanic Garden (CBG) was used as an experi-mental plot for the introduction of Cinchona to Indonesia.When it was stated as a biological station and forest reserve,the area was extended up to 1,200 ha covering from Cibodasto the summit of Mount Gede and Pangrango (Dakkus 1945;van Leeuwen 1945; Soerohaldoko et al. 2006). It was awell-known area for classical spot of botanicalinvestigation. More than 8,000 studies were conducted inthis area. Some of them were conducted by famous botanistsuch as; Reinwardt, Blume, Junghuhn, Treub, Zollinger,Teysmann, Koorders, Backer, Bakhuizen van den Brink Jr.,von Faber, van Leeuwen and van Steenis (Meijer 1959; vanSteenis 1972; Arrijani 2008).

CBG is managed by the Indonesian Institute of Sciences(LIPI) at present. It conserves about 6,764 individual plantsfrom 1,270 species and 204 families. Ten percent of CBG isa forested area. It consists of fragmented forest and borderforest adjacent to the natural forest of Mount GedePangrango National Park. The forested area is important tomaintain genetic diversity which uncovered by the smallnumber of plant collection of botanic garden (Hurka et al.2004). Remnant forest of CBG also played important roleas buffer zone between the garden and Mount Gede-Pangrango National Park to restrict the alien species plantpossibly escape from CBG collection. Some researchershave been addressed non-native species colonization at theinterface between protected areas and human-dominated

systems (Pysek et al. 2003; Alston and Richardson 2006).The establishment of buffer zones around protected areas isoften included on management strategy of plant invasions(Llewellyn et al. 2010).

The remnant forest of CBG has a potential to be developedas a field laboratory and environmental education. Thecomposition and the dynamic of the forest are interesting tobe studied. The 2.84 hectare plot was build in 2007 to2009. It was set to monitor plant diversity and to collectlong-term data on the growth, mortality, regeneration, anddynamics of forest. Ten years observation is needed to stateit as a long term permanent plot (Bakker et al. 1996).

This paper aims to assess the eligibility of permanentplot in CBG which presented by the preliminary forestinventory data and it comparison with the natural forestvegetation. Hopefully our permanent plot will be a modelfor lower montane tropical forest vegetation dynamics.


Cibodas Botanic Garden is located on the foothill ofMount Gede, Cipanas, Cianjur, West Java. CBG is situatedat lower montane zone (1,300-1,425 m asl.). The annualrainfall is 2,950 mm/year, average temperature is 20o C andrelative humidity is 80%. Permanent plots were establishedon four of remnant forests sites inside CBG, i.e. Wornojiwo(PW), Kompos (PK), Jalan Akar (PJA), and Lumut Forest(PL). Wornojiwo and Kompos are fragmented forests

MUTAQIEN & ZUHRI – Permanent plot in forest of Cibodas Botanic Garden 219

2nd plot

inside the CBG and two others are forest border of MountGede Pangrango National Park (Figure 1).

The plots are divided into 10x10 m2 sub-plots. Totalarea and number of sub-plots on each site are presented onTable 1. Sub-plot numbers on each site were limited bylarge area and topographical aspect.

A rapid vegetation assessment was conducted in April-June 2010. Vegetation data was collected using purposiverandom sampling. Stands were classified into trees,saplings, shrubs, and herbs. Each tree were identified,marked, tagged, and measured (diameter at breast height(dbh), height, and canopy size). Saplings, shrubs, and herbswere identified and their abundance were measured.

Table 1. Total area and number of sub-plots

Site Area (ha) Number of sub-plots

Wornojiwo Forest (PW) 3.934 180Kompos Forest (PK) 2.555 60Jalan Akar Forest (PJA) 1.086 32Lumut Forest (PL) 0.855 12Total 8.43 284

The result of plot inventory data was compared to twoplots (1 ha in each) of natural forest vegetation. One plotwas located at the edge of the Mount Gede-PangrangoNational Park (200 m from the garden) and another one

was located at the interior of the national park forest (1 kmfrom the garden). Parameter such as species richness,Shannon-Wienner diversity index (Odum 1971), speciesevenness (Heip 1974) and similarity index (Krebs 1999)was used to compare it.


Vegetation of CBG’s remnant forestThere are 137 plant species at the remnant forest, which

consists of 74 tree species, 30 shrub species, 23 herbspecies, 6 fern species, and 4 climber species (Table 2).Only 36 tree species reach more than 10 cm in diameter,while 61 species were found as sapling (dbh<10 cm). Treedensity was reached 306 tree/ha and tree biomass wasachieved 699.24 ton/ha.

Table 2. Total species in the life form classes of CBG’s remnant forest

Life form Number of species

Tree 74Shrub 30Herb 23Fern 6Climber 4Total 137

Figure 1. Location ofpermanent plot on CibodasBotanical Garden


Figure 2. Distribution of tree class diameter of CBG’s remnant forest

Villebrunea rubescens and Ostodes paniculata are thetwo most common trees, but they never reach more than 50cm in diameter (Table 3). As the small diameter trees, their

high abundance is related to colonizationand turnover rate in the disturbed forest(Whitmore 1975). Furthermore,hurricane occurring in 1976 (Yamada2010. pers. comm. 17 July) and 1984 inCibodas (Whitten and Whitten 1996)might change the dynamics and increasethe abundance of typical species ofsecondary forest (V. rubescens) and thepioneer species (i.e. O. paniculata).Disturbance in secondary forest wouldbe advantageous for short-lived, lightdemanding, and fast growing species aswell as for most pioneer species at gapsites in mature forests (Brokaw 1985).These growth traits affect largely thestand structure (Yoneda 2006).

Castanopsis argentea (chestnut) ispresents almost in all class diameter andrelatively easy to be found. This plant isrelatively big and has heavy fruit whichmakes it poorly adapted for long-distance dispersal. It is typical oflaurophyl forest dominated by evergreenFagaceae. Heriyanto et al. (2007) statedthat the highest distribution of C.argentea is around 1,400 m asl.

Altingia excelsa is one of theemergent trees in the lower montaneforest. The biggest A. excelsa founded inthis study reaching 170 cm diameter andlaid in C. argentea canopy. A. excelsa ismajor trees species in the altitude 1,500-1,800 m asl and give the highestcontribution to its community (Seifriz1923; Arrijani 2008). Therefore, Seifriz(1923) was divided the vegetation ofMount Gede into 5 zone, one of whichwas rasamala (A. excelsa) sub-zone.

Distribution of tree diameter is a toolto describe the forest regenerationthrough age structure of tree. In our

study, the distribution of tree in the CBG’s remnant forestbased on class diameter follows J-inverse curve (Figure 2).This shape showed the common patterns of tropical forestdynamics (Ogawa et al. 1965), similar to Meijer plot onlower mountain forest of Mount Gede (Meijer 1959),natural forest of Mount Papandayan (Setiawan andSulistyawati 2008), lowland forest of Batang GadisNational Park (Kartawinata et al. 2004), lowland forest inNorthern Siberut (Hadi et al. 2009) and lowland forest inBatanta Island, Raja Ampat (Mirmanto 2009).

Strobilanthes hamiltoniana (Steud), Dichroa febrifugaLour., Polyalthia subcordata (Bl.) Bl., and Dendrocnidestimulans (L.f.) Chew are the most common species inshrub layer (Table 4). In the herb layer, Cyrtandra pictaBl., Calathea lietzei E. Morren, Elatostema nigrescensMiq, and E. cuneatum Wight are abundant. Diplaziumpallidum (Bl.) T. Moore and Calamus reinwardtii Mart. arealso abundant at the fern and climber life form, respectively.

Table 3. Class diameter of trees of CBG’s remnant forest

Class diameter

Tree species

10-2

0 cm

21-3

0 cm

31-4

0 cm

41-5

0 cm

51-6

0 cm

61-7

0 cm

71-8

0 cm

> 80

cm

Tre

e nu

mbe

r

Villebrunea rubescens (Bl.) Bl. 33 3 1 1 38Ostodes paniculata Bl. 7 11 3 3 24Macropanax dispermum (Bl.) Kuntze 8 5 5 18Castanopsis argentea (Bl.) A. DC. 1 1 1 2 1 7 13Ficus ribes Reinw. Ex Bl. 8 1 9Saurauia pendula Bl. 2 2 4Decaspermum sp. 4 4Cestrum aurantiacum Lindl. 3 1 4Ficus fistulosa Reinw. Ex Bl. 2 1 3Elaeocarpus oxypirens Koord. & Val. 2 1 3Dysoxylum nutans Miq 1 1 1 3Castanopsis javanica (Bl.) A.DC 3 3Altingia excelsa Noronha 2 1 3Saurauia reinwardtiana Bl. 1 1 2Lithocarpus indutus (Bl.) Rehder 2 2Ficus variegata Bl. 2 2Ficus heterophylla Blanco 2 2Viburnum sambucinum Reinw. ex Bl. 1 1Turpinia sphaerocarpa Hassk. 1 1Trema orientalis Bl. 1 1Toona sureni Merr. 1 1Schima wallichii Choisy 1 1Saurauia cauliflora DC. 1 1Rauvolfia javanica Koord. & Val. 1 1Prunus arborea (Bl.) Kalkman 1 1Persea rimosa Zoll. Ex Meissner 1 1Neonauclea obtusa Bl. 1 1Lithocarpus pallidus (Bl.) Rehder 1 1Helicia serrata Bl. 1 1Fagraea sp. 1 1Ficus lepicarpa Bl. 1 1Eurya sp. 1 1Elaeocarpus sphaericus Schum. 1 1Elaeocarpus angustifolius Bl. 1 1Bridelia sp. 1 1Acer laurinum Hassk. 1 1

81 30 11 8 5 5 2 14 156


Forest stratification wasdescribed by tree height.Figure 3 shows five strata onWornojiwo forest. Theemergent species isCastanopsis argentea. Itsstratification is correlated withstand basal area which isalmost a half of percentagebasal area occupied byFagaceae (Table 5). Thisvalue, 32.67 m2 ha-1, washigher than the basal areaoccupied by Fagaceae in atropical montane forest of DoiInthanon National Park,Northern Thailand; 8.17 m2

ha-1 (Noguchi 2007). Thepercentage of Facaeae in CBGremnant forest (49.95%) ismuch higher than in Padang atthe elevation above 700 m;>10% (Nishimura et al. 2006;Fujii et al. 2006). Thedominance of Fagaceae isresulting from its vigorousgrowth rate and low loggingimpact because of its lowtimber quality (Yoneda et al.2006).

The complexity ofWornojiwo forest describedby 5 strata of plant i.e. 0-10m, 10-20 m, 20-30 m, 30-40m and above 40 m. Richards(1952) consider the tropicalrain forest to be the mostcomplex and highly organizedterrestrial community in theworld, has five or six distinctstrata. It is similar with themontane humid forests inMeghalaya, northeast India,which have five-layereddistribution of plant species inthe community (Jamir et al.2006). In the second layerMacropanax dispermumrelatively abundant in themaximum height achieves 40m. It is similar to thevegetation layer of MountManglayang, West Java(Mutaqien et al. 2008).

The canopy with relativelycontinuous gap occurring inseveral places was importantfor regeneration. Forestregeneration showed a goodresult, indicated by almost all

Table 4. Species of shrub, herb, fern, and climber, as well as saplings of CBG’s remnant forest

Shrub SaplingAllophylus cobbe (L.) Raeusch Acer laurinum Hassk.Ardisia crenata Sims Alangium rotundifolium (Hassk.) Bloemb.A. villosa Roxb. Alangium sp.A. fuliginosa Bl. Antidesma tetrandrum Bl.Ardisia sp. Bonnetia sp.Bocconia frutescens L. Casearia coriacea Vent.Breynia microphylla (Kuzweil ex Teijsm. Castanopsis argentea (Bl.) A. DC.& Binn.) Müll. Arg. C. javanica (Bl.) A.DCBridelia multiflora Zipp. ex Scheff. C. tungurrut (Bl.) A.DCClerodendrum eriosiphon Schau Cestrum aurantiacum Lindl.**Coffea sp. Cryptocarya ferrea Bl.Dichroa febrifuga Lour. Decaspermum sp.Ficus ampelas K.D. Koenig ex Roxb. Dysoxylum excelsum Bl.F. cuspidata Reinw. ex Bl. D. nutans MiqDendrocnide stimulans (L. f.) Chew Elaeocarpus obtusus Bl.Lasianthus laevigatus Bl. E. oxypyren Koord. & Val.L. stercorarius Bl. E. pierrei Koord. & Val.L. rigidus Miq. E. sphaericus Schum.Lasianthus sp. Euonymus javanicus Bl.Magnolia candollei Link Ficus alba Reinw. Ex Bl.Maoutia diversifolia Bl. F. fistulosa Reinw. Ex Bl.Maoutia sp. F. ribes Reinw. Ex Bl.Mycetia cauliflora Reinw Ficus sp.Pavetta montana Reinw. ex Bl. Flacourtia rukam Zoll. & MoritziPolyalthia subcordata (Bl.) Bl. Glochidion cyrtostylum Miq.Psychotria angulata Korth Glochidion sp.Saprosma dichotomum (Korth.) Boerl. Helicia serrata Bl.Solanum ferox L. Lithocarpus indutus (Bl.) RehderS. verbascifolium L. L. pseudomoluccus (Bl.) RehderStrobilanthes hamiltoniana (Steud.)* Litsea noronhae Bl.Strobilanthes sp. Macropanax dispermum (Bl.) Kuntze

Mastixia trichotoma Bl.Herb Meliosma ferruginea Bl.Achyranthes bidentata Bl. Michelia montana Bl.Alpinia sp. Mischocarpus fuscescens Bl.Amomum coccineum (Bl.) K. Schum. Neonauclea lanceolata (Bl.) Merr.Boehmeria rugosissima Miq. Ostodes paniculata Bl.Calathea lietzei E. Morren Persea rimosa Zoll. Ex MeissnerCommelina sp. Phoebe grandis (Nees) Merr.Curculigo capitulata (Lour.) Kuntze Platea latifolia Bl.Curculigo recurvata W.T. Aiton Polyalthia subcordata (Bl.) Bl.Elatostema cuneatum Wight Polyosma sp.E. nigrescens Miq. Pygeum sp.Cyclosorus sp. Pyrenaria serrata Bl.Cyrtandra picta Bl.* Rauvolfia javanica Koord. & Val.Forrestia mollisima (Bl.) Koord. Saurauia cauliflora DC.Impatiens chonoceras Hassk. S. pendula Bl.I. platypetala Hassk. S. reinwardtiana Reinw. Ex Bl.Musa acuminata Colla Schima wallichii ChoisyNervilia punctata Makino Sloanea sigun (Bl.) K. Schum.Pilea angulata (Bl.) Bl. Symplocos cochinchinensis (Lour.) S. MooreP. melastomoides (Poir.) Wedd. Symplocos sp.Schismatoglottis acuminatissima Schott Syzygium pycnanthum (Bl.) Merr. & L.M. PerryZingiber inflexum Bl. S. racemosum (Bl.) DC.Z. odoriferum Bl. Toona sureni Merr.

Trevesia sundaica Miq.Fern Turpinia montana (Bl.) KurzCyathea contaminans (Wall. ex Hook.) Copel. T. sphaerocarpa Hassk.Diplazium bantamense Bl. Viburnum lutescens Bl.D. javanicum Makino Villebrunea rubescens (Bl.) Bl.D. pallidum* (Bl.) T.MooreD. repandum Bl.Nephrolepis biserrata (Sw.) Schott

ClimberCalamus reinwardtii Mart. *Plectocomia elongata Mart. ex Bl.Tetrastigma papillosum Planch.Smilax zeylanica L.Note: * dominant/abundant species; ** alien species


tree species had the sapling stage. Our detailed surveyfound 61 sapling species as pointed out in Table 4. Saplingcan be found easily especially in Jalan Akar and Lumutforest which adjacent to natural forest of Mount GedePangrango National Park as seed source.

Table 5. Basal area in tree family of CBG’s remnant forest

Rank Family Basal area(m2 ha-1) % Basal area

1 Fagaceae 32.67 49.952 Euphorbiaceae 12.3 18.813 Urticaceae 10.25 15.694 Araliaceae 5.09 7.795 Hamamelidaceae 1.87 2.866 Moraceae 1.24 1.907 Meliaceae 0.34 0.528 Lauraceae 0.29 0.459 Aceraceae 0.28 0.44

10 Actinidiaceae 0.28 0.43

Is the CBG’s permanent plot representing the naturalvegetation?

Forest inventory on CBG permanent plot werecompared to natural forest vegetation at the edge and theinterior of Mount Gede Pangrango National Park to getevidence of its representation of lower montane vegetation(Table 6). Although the vegetation of both CBG’spermanent plot and the natural forest vegetation plot onMount Gede Pangrango National Park are located at thesame vegetation zone i.e. lower montane zone (Whitmore1984), the natural forest vegetation has lower number of

species than CBG’s permanent plot but have higher valueof H’ and species evenness. It may be caused by; (i) naturalfactor, such as in the tropical regions tree species richness(trees > 10 cm dbh in 1 ha plot), decreases with increasingaltitude (summarized in Aiba et al. 2002), (ii) loggingwhich occurs in national park, although it is a protectivearea but some people living around this area are collectingforest natural resource easily. As found for forest islands inWisconsin, disturbance contributes significantly tovariability in the number of species (Dunn and Loehle1988); (iii) effect of the existence of CBG which conservesmany non-native plant species which could escape intoforest; and (iv) edge effect which may increase biodiversityin adjacent area (CBG permanent plot). Natural forestcloser to CBG has the highest value of tree density and H’,but the % basal area is lower than the farther of naturalforest plot. This points out that the first plot of naturalforest has younger succession stage than the second one.

Species composition of the CBG permanent plotrepresented the lower montane forest vegetation of Java. InJava, the lower montane are dominated in terms ofabundance by the Oaks (Lithocarpus and Quercus),Chestnuts (Castanopsis), and numerous species of Laurels(Fagaceae and Lauraceae, respectively) but theMagnoliaceae, Hamamelidaceae and Podocarpaceae arealso well represented (Sukardjo 1978; Mukhtar and Pratiwi1991; van Steenis 1972). Only Castanopsis javanicapresent in the all plot (Table 7). Cestrum aurantiacum asinvasive alien species is dominant spread in the CBGpermanent plot only. Their canopy would inhibit nativesapling growth (Galbraith-Keith and Handel 2008).

Figure 3. Profile diagram of Wornojiwo forest of CBG’s remnant forest


Table 6. Comparison of tree stand of CBG permanent plot and plots in the natural forest vegetation of Mount Gede Pangrango NationalPark

CBG permanent plot First plot of natural forest Second plot natural forest

Distance from CBG Inside CBG 200 m (edge forest) 1 km (interior of the forest)Altitude (m asl) 1,300-1,425 1,450-1,500 1,594-1,611Number of tree species 74 63 51Tree density (tree/ ha) 306 408 314Basal area (%) 0.447 0.428 0.347Shannon’s Diversity Index (H’) 2.84 3.29 3.20Species Evenness 1.52 1.82 1.87

Table 7. Comparison the tree stand important value index (IVI) of the CBG permanent plot and natural forest vegetation in Mount GedePangrango National Park

CBG permanent plot First plot of natural forest Second plot of natural forestSpecies IVI Species IVI Species IVI

Villebrunea rubescens 49.70 Castanopsis tungurrut 26.88 Schima wallichii 57.13Ostodes paniculata 43.02 Villebrunea rubescens 18.94 Turpinia sphaerocarpa 32.55Macropanax dispermum 29.90 Sloanea sigun 14.92 Vernonia arborea 12.48Castanopsis argentea 37.31 Altingia excelsa 14.33 Saurauia pendula 11.09Ficus ribes 16.21 Ostodes paniculata 14.09 Macaranga rhizinoides 9.72Cestrum aurantiacum** 7.40 Castanopsis argentea 13.29 Manglietia glauca 9.53Decaspermum sp. 5.84 Laportea stimulans 11.06 Persea rimosa 9.28Saurauia pendula 7.36 Macropanax dispermum 10.13 Lithocarpus pseudomoluccus 5.93Altingia excelsa 9.39 Castanopsis javanica 9.60 Saurauia blumiana 5.72Castanopsis javanica 9.33 Turpinia sphaerocarpa 9.11 Castanopsis javanica 5.35Note: ** alien species

In general, plant composition of the remnant forest ofCBG’s plot is more similar to the first plot of natural forestrather than the second one. Table 8 shows that CBGpermanent plot has 39% similarity to first plot of naturalforest and only 31% similar to the second plot of naturalforest. Both plots located in natural forest have the highersimilarity, i.e. 52%. Jacob (1981) said that no two hectareshave exactly the same species composition in the rainforest. It is indicated the remnant forest of CBG showedgood representative of Mount Gede Pangrango forestvegetation. The representation will be best if the alienspecies (C. aurantiacum) removed from the permanent plot.

Table 8. Similarity index among the remnant forest of CBG’s plotand the plots at natural forest of Mount Gede Pangrango NationalPark

CBGpermanent

plot

First plotof natural

forest

Second plotof natural

forestCBG’s remnant forestplot

1 0.39 0.31

First plot of naturalforest

0.39 1 0.52

Second plot of naturalforest

0.31 0.52 1

Due to the small size and high degree of fragmentation,the CBG’s remnant forest is susceptible to abiotic andbiotic disturbance. Edge effects increased susceptibility toinvasions by exotic plants and animals (Ross et al. 2002;Ecroyd and Brockerhoff 2005). In spite of climatic change,the presence of invasive species is one of the greatestthreats to biodiversity (Primack and Miller-Rushing 2009).It refers to their adaptability to disturbance and to a broaderrange of biogeographic conditions and environmentalcontrols (Burgiel and Muir 2010). The presence of invasivealien species i.e Cestrum aurantiacum and Brugmansiacandida 100 m away from CBG proved the spread ofinvasive species from CBG was out of control. Monitoringin the successive years is needed to maintain diversity,monitor forest dynamics and also the spread of invasiveplant from CBG.

CONCLUSION

There were 137 plants species consisting of 74 treespecies, 30 shrub species, 24 herb species, 6 fern species,and 4 climber species present in CBG permanent plot. Thedominance of fagaceous (Castanopsis argentea),Villebrunea rubescens and Ostodes paniculata indicatedthe remnant forest of CBG is secondary lower montaneforest. In comparison with natural forest, the remnant forest


of CBG showed good representative of Mount GedePangrango forest vegetation. It is indicated by 39% of itsspecies composition are similar with the edge forest and31% are similar with the forest interior.

ACKNOWLEDGEMENTS

We would like to express gratitude to DIPA Tematik2009 for funding this research. Sincerely thanks are alsoconveyed to Yati Nurlaeni, Emus, Nudin, Wagino, Sopian,Wiguna Rahman and Eka A.P. Iskandar whose help us a lotin the fields and the preparation of this manuscript.

REFERENCES

Aiba S, Kitayama K, Repin R (2002) Species composition and species-area relationships of trees in nine permanent plots in altitudinalsequences on different geological substrates of Mount Kinabalu.Sabah Parks Nat J 5: 7-69.

Alston KP, Richardson DM (2006) The roles of habitat features,disturbance, and distance from putative source populations instructuring alien plant invasions at the urban/wildland interface on theCape Peninsula, South Africa. Biol Conserv 132: 83-198.

Arrijani (2008) Montane zone vegetation structure and composition ofGunung Gede Pangrango National Park. Biodiversitas 9 (2): 134-141[Indonesia]

Bakker JP, Olff H, Willems JHM, Zobel M (1996) Why do we needpermanent plots in the study of long-term vegetation dynamics? J VegSci 7: 147-156.

Brokaw NVL (1985) Treefalls, regrowth, and community structure intropical forests. In: Pickett STA, White PS (eds.) The ecology ofnatural disturbance. Academic Press, Seattle.

Burgiel SW, Muir AA (2010) Invasive species, climate change andecosystem-based adaptation: Addressing multiple drivers of globalchange. Global Invasive Species Programme (GISP), Washington DCand Nairobi.

Dakkus IV (1945) The botanical garden at Tjibodas. In: Honig P (eds)Science and scientists in the Netherlands Indies. Board for theNetherlands Indies. New York City.

Dunn CP, Loehle C (1988) Species-area parameter estimation: testing thenull model of lack of relationship. J Biogeogr 15; 721-728.

Ecroyd CE, Brockerhoff EG (2005) Floristic changes over 30 years in aCanterbury Plains Känuka forest remnant, and comparison withadjacent vegetation types. N Z J Ecol 29 (2): 279-290.

Fujii S, Nishimura S, Yoneda T (2006) Altitudinal distribution ofFagaceae in West Sumatra. Tropics 15 (2): 154-163.

Galbraith-Kent SL, Handel SN (2008) Invasive Acer platanoides inhibitsnative sapling growth in forest understorey communities. J Ecol 96:293-302.

Hadi S, Ziegler T, Waltert M, Hodges JK (2009) Tree diversity and foreststructure in Northern Siberut, Mentawai Islands, Indonesia. Trop Ecol50 (2): 315-327.

Heip C (1974) A new index measuring evenness. J Mar Biol Assoc UK54: 555-557.

Heriyanto NM, Sawitri R, Subandinata D (2007) Studies on theregeneration ecology of Saninten (Castanopsis argentea (Bl.) A.DC.)Mount Gede Pangrango National Park, West Java. Bul Plasma Nutfah13(1): 34-42. [Indonesia]

Hurka H, Neuffer B, Friesen N (2004) Plant genetic resources in botanicalgardens. In: Forkmann G Michaelis S (eds) Proc 21st IS on BreedingOrnamentals, Part II. Acta Hort 651: 35-44.

Jacobs M (1981) The last tropical rain forest, a first encounter. Springer,Leiden.

Kartawinata K, Samsoedin I, Heriyanto M, Afriastini JJ (2004) A treespecies inventory in a one-hectare plot at the Batang Gadis NationalPark, North Sumatra, Indonesia. Reinwardtia 12 (2): 145-157.

Krebs CJ (1999) Ecological methodology, 2nd ed. Addison-Wesley, NewYork.

Llewellyn C, Foxcroft , Jarocic V, Pysek P, Richardson DM, Rouget M(2010) Protected-area boundaries as filters of plant invasions.Conserv Biol 25 (2): 400-405

Mirmanto E (2009) Vegetation analyses of Dipterocarpaceae forest inPulau Batanta, Raja Ampat, Papua. J Biol Indon 6 (1): 79-96[Indonesia]

Meijer W (1959) Plantsociological analysis of montane rainforest nearTjibodas, West Java. Acta Botanica Nederlandica 8: 277-291.

Mukhtar AS, Pratiwi (1991) Diversity of tree species and its problems inSitu Gunung forest, Gunung Gede-Pangrango National Park WestJava Indonesia. Bul Penel Hutan 533:1-12.

Mutaqien Z, Santoso P, Kusmoro J (2008) Vegetation study of montanerain forest of Mt. Gunung Manglayang, West Java. Widyariset 11 (2):157-164. [Indonesia]

Nishimura S, Yoneda T, Fujii S, Erizal M, Abe H, Kubota D, Tamin R,Watanabe H (2006) A study of altitudinal zonation of vegetation inthe Padang region, West Sumatra, Indonesia. Tropics 15 (2): 137-152.

Noguchi H, Itoh A, Mizuno T, Sri-ngeryuang K, Kanzaki M, Teejuntuk S,Sungpalee W, hara M, Ohkubo T, Sahunalu P, Dhanmmanonda P,Yamakura T (2007) Habitat divergence in sympatric Fagaceae treespecies of a tropical montane forest in northern Thailand. J Trop Ecol23: 549-558.

Odum BP (1971) Fundamental of ecology. 3rd ed. W.B. Saunders, NewYork.

Ogawa H, Yoda K, Ogino K, Shidei T, Ratnawongse D, Apasutaya C.(1965) Comperative ecological study on three main types in S.E. Asiaof forest vegetation in Thailand. I. Structure and floristic composition.Nat Life 4: 13-48.

Primack RB, Miller-Rushing AJ (2009) The role of botanical gardens inclimate change research. New Phytologist 182: 303-313.

Pysek P, Jarosık V, Kucera T (2003) Inclusion of native and alien speciesin temperate nature reserves: an historical study from Central Europe.Conserv Biol 17 (14): 14-24.

Richards PW (1952) The tropical rain forest: An ecological study.Cambridge University Press, Cambridge.

Ross KA, Fox BJ, Fox MD (2002) Changes to plant species richness inforest fragments: fragment age, disturbance and fire history may be asimportant as area. J Biogeogr 29: 749-765.

Seifriz W (1923) The altitudinal distribution of plants on Mt. Gedeh, Java.Bull Torrey Bot Club 50 (9): 283-306.

Setiawan NN, Sulistyawati E (2008) Succession following reforestationon abandoned fields in Mount Papandayan, West Java. Proceeding ofInternational Conference on Environmental Research and Technology(ICERT) 2008. Penang, 28 April-30 May 2008.

Soerohaldoko S, Naiola BP, Nasution RE, Danimihardja S, PurwantoroRS, Soegiarto KA, Supena, Mardi D, Saputra DS, Nurdin DA,Suryana N, Suhatman A, Solihin, Supriyadi H, Hidajat A, Amiruddin(2006) The history of Cibodas Botanic Garden. UPT BKT KebunRaya Cibodas-LIPI, Cianjur.

Sukardjo S (1978) Introducing the forest of Mt. Tilu. Bul Kebun Raya3:153-156. [Indonesia]

van Leeuwen WM (1945) The Tjibodas Biological Station and ForestReserve III, The Flora of Tjibodas. In: Honig P, Verdoonn (eds.)Science and scientist in the Nederlands Indies. Board for NetherlandIndies, Suriname and Quaracao, New York City

van Steenis CGGJ (1972) The mountain flora of Java. E. J. Brill, LeidenWhitten T, Whitten J (1996) Determinants of vegetation. Indonesian

Heritage: Plants. Archipelago Press, Singapore.Whitmore TC (1975) Tropical rain forests of Far East. Clarendon Press,

Oxford.Yoneda T, Mizunaga H, Nishimura S, Fujii S, Tamim R (2006) Stand

structure and dynamics of a tropical secondary forest-A rural forest inWest Sumatra, Indonesia. Tropics 15 (2): 189-199


Analysis of epiphytic orchid diversity and its host tree at three gradientof altitudes in Mount Lawu, Java

NINA DWI YULIA♥, SUGENG BUDIHARTA, TITUT YULISTYARINIPurwodadi Botanic Garden, Indonesian Institute of Sciences, Jl. Raya Surabaya-Malang Km. 65, Purwodadi, Pasuruan 67163, East Java, Indonesia.

Tel./Fax.: +62-341-426046; email: [email protected]

Manuscript received: 10 December 2010. Revision accepted: 3 May 2011.

ABSTRACT

Yulia ND, Budiharta S, Yulistyarini T (2011) Analysis of epiphytic orchid diversity and its host tree at three gradient of altitudes inMount Lawu, Java. Biodiversitas 12: 225-228. The aim of this study was to observe epiphytic orchid diversity and their host trees atthree different altitudes (1796, 1922 and 2041 m asl.) at southern part of Mount Lawu, District of Magetan, East Java. Line transect of10 x 100 m was set up and then divided into ten plots (as replicates) of 10 x 10 m. At each plot, species name and number of individualof epiphytic orchids, and species name, number of individual and diameter at breast height (dbh) of host trees were recorded. The resultshowed that there were 19 species of epiphytic orchid recorded at the study sites. There were significantly different among gradientaltitude in number of epiphytic orchid species (F = 3.7; df = (2, 27); P < 0.05). The highest number of species of epiphytic orchid wasrecorded at the altitude of 1922 m asl. (6.6 species/100 m2) while the highest number of individual was recorded at the altitude of 1796m asl. (1337.7 individuals/100 m2). The study site at altitude of 1922 m asl. was recognized as the denser and richer in species of hosttrees (2.3 species/100 m2 and 3.5 individuals/100 m2 respectively). However, the highest basal area of host tree was recorded at thealtitude of 2041 m asl. (4558 cm2/100 m2).

Key words: orchid diversity, host trees, gradient of altitudes, southern part, Mount Lawu.

INTRODUCTION

Epiphytic plant is one component of forest vegetationthat still requires much research to maximize its potentialuses (Setyawan 2000). Epiphytic plant needs other type ofplants either tree or herb as its host (Dressler 1990; Hietz1997). Despite by micro climate, the diversity of epiphyticplant is also influenced by typical condition of its host treespecies such as canopy type, bark characteristic, and bio-chemistry processes (Setyawan 2000). In tropical forest,epiphytic plant is an important element since it contributesup to 25% of all vascular plant species in the tropics andrepresents 10% of plant diversity worldwide (Hietz 1997;Nieder 2001; Gravendeel 2004). According to Annaselvamand Parthasarathy (2001), epiphytic plants in Varagalairtropical evergreen forest include are Orchidaceae (54%),Piperaceae and Araceae (each 8%).

Kindlmann and Vergara (2009) highlight the importanceof research in orchid especially in the topics of speciesdiversity, such as species-area and species-abundancerelationships. Two important factors for predicting orchiddiversity and endemism in large and montane islands inWest Indies are area and elevation (Ackerman et al. 2007).Van Steenis (1972) mentioned that generally, orchids growwell in mountain areas with altitude ranging from 500to1500 m asl, and their variation decreases in out site ofthis range (below 500 m asl. or above 2000 m asl).According to Setyawan (2001) forest vegetation in MountLawu is relatively stable since there is no volcanic activity

for long period and the low level of disturbances eithercaused by human or nature (such as forest fire, storm andlandslide). The aim of this study is to observe the diversityof epiphytic orchids and their host trees at three gradient ofaltitudes (1796, 1922 and 2041 m asl.) in southern part ofMount Lawu, District of Magetan, East Java, Indonesia.


Study sitesMount Lawu is located along the border of East Java

and Central Java with 5.719,4 ha in extent and the highestpeak is 3.265 m asl. It is divided into two zones which areproduction zone and buffer zone (Perum Perhutani 2010).This study was conducted between 1 and 8 October 2010 atforest areas in Mount Lawu, Sub-district of Plaosan,District of Magetan (S 07º39’28.7”-07º39’42.1” and E 111º11’39.6”-111º 13’02.5”). Purposive sampling was used bydetermining three study sites representing different altitude,were Mojosemi (1796 m asl; S 07°39’42.1” and E111°13’02.5”), Tirtogumarang (1922 m asl; S 07°40’03.5” and E111º11’30.2”) and Cemorosewu (2041 m asl; S07°39’28.7” and E 111°11’39.6”) (Figure 1). These threesites are reserve forests managed by Kesatuan PemangkuanHutan or Forest Management District (KPH/FMD)Southern Lawu under Perum Perhutani (State OwnedForest Company). The climate at these sites is relatively cooland dry with temperature 19-26ºC and humidity 70-80%.


Figure 1. Location of study site at Mount Lawu, Sub-district of Plaosan, District of Magetan (B) and detailed map of three sites (C): 1.Mojosemi (1796 m asl), 2. Tirtogumarang (1922 m asl), 3. Cemorosewu (2041 m asl).

Vegetation types at the study areas are natural sub-montaneforest, mixed secondary forest and agricultural lands. Somedominant tree species are Casuarina junghuhniana (cemaragunung), Pinus merkusii (tusam), Altingia excelsa(rasamala), Lithocarpus sundaicus (pasang), Acer laurinumand Acmena sp.

Data collection and analysisLine transect of 10x100 m2 were made at three study

sites (Mojosemi, Tirtogumarang and Cemorosewu) andthen divided into ten plots (and treated as replicates) of10x10 m2 (Annaselvam and Parthasarathy 2001; Focho etal. 2010). At each plot, species name and number ofindividual of epiphytic orchids, and species name, numberof individual and diameter at breast height (dbh) of hosttrees were recorded. All living collections were thencollected at Purwodadi Botanic Garden for identification.

All data recorded were calculated for average numberof orchid species and individuals, and average number ofhost tree species, individual and basal area. Theseparameters were then analyzed using one-way Analysis ofVariance (ANOVA) to test the difference among threegradients of altitudes. The ANOVA test was performedusing PopTools version 3.0.6 (Hood 2008) and alpha wasset at 0.05.


Epiphytic orchidThe result showed that the highest number of species of

epiphytic orchid was recorded at Tirtogumarang (1922 masl) with average 6.6 + 3.57 species/plot, followed byMojosemi (1796 m asl) and Cemorosewu (2041 m asl) withaverage 4.7+3.27 and 3+1.7 species/plot respectively(Figure 2A). The ANOVA test showed that there wassignificant difference among three gradient of altitudes interm of species number of epiphytic orchid (F = 3.7; df =(2, 27); P < 0.05). The result of this test suggested thatelevation is an important factor that influences speciesrichness of epiphytic orchid.

The composition of orchid species changes incessantlywith increasing elevation. The result of this study is inaccordance with Van Steenis (1972) that the variation ofepiphytic orchid will decreased up to elevation above 2000m asl. In addition, Jacquemyn et al. (2005) stated thatelevation also influenced species evenness in negativerelation (species evenness decreased significantly withincreasing altitude). In sub-montane forest in Mount Lawu,the altitude of 2000’s m asl. seems as a critical point interm of relation between species richness of epiphyticorchid and elevation as noted in this study. However,

B

A

C

1

2

3

YULIA et al. – Epiphytic orchid of Mount Lawu, Java 227

another study stated that the tropical orchids largelydistributed below 1600 m asl. and reach maximum richnesson the altitudes between 400 and 800 m asl. (Jacquemyn etal. 2005). Another factor affecting orchid diversity ishuman disturbance. At low elevation with high level ofhuman disturbances, the species richness of orchid is likelylower than species richness at higher altitude since mosthuman activities are concentrated at low elevation (Tian etal. 2008).

The composition of orchid species is influenced byneighboring elevation belts that similarity index tends to behigher between sites with closer distant and more similaraltitude. In this study, total species of epiphytic orchid atthree gradients of altitudes was 19 species (Table 1).

Table 1. The composition of epiphytic orchid recorded at threegradients of altitudes in southern part of Mount Lawu (Mojosemi= 1796 m asl, Tirtogumarang = 1922 m asl. and Cemorosewu =2041 m asl)

Altitude (m asl)Species name

1796 1922 2041Bulbophyllum angustifolium + + +Bulbophyllum mutabile - + -Bulbophyllum sp.1 + - -Bulbophyllum flavidiflorum - + +Bulbophyllum ovalifolium + - -Bulbophyllum sp.2 - + -Coelogyne miniata + + +Dendrochilum longifolium - + -Dendrochilum sp.1 + - -Dendrochilum sp.2 + - +Eria multiflora + + +Eria moluccana - + +Eria lamonganensis - - +Flickingeria luxurians + - -Liparis pallida + - -Pholidota globosa - + +Pholidota ventricosa + - +Luisia zollingeri - - +Tuberolabium odoratissimum - + -Note: + = found;-= not found; all habitus: epiphytic; Distributionstatus: widespread

Orchid species recorded on the study sites are typicalorchid for elevation 500-2000 m asl. (Mahyar and Sadili2003; Puspitaningtyas et al, 2003) and known aseuryecious orchids (kind of orchid that is usually adaptableto various types of environment and has wide-ranginggeographic distribution). There were three species orchidthat recorded at three study sites, which are Bulbophyllumangustifolium, Coelogyne miniata and Eria multiflora.

The highest number of individual was noted atMojosemi (1796 m asl) with average 1337.7±1626.20individuals/plot, followed by Cemorosewu (2041 m asl)and Tirtogumarang (1922 m asl) with average1278.1±1296.87 and 536.1±465.82 respectively (Figure2B). The high value of standard deviation indicates thatthere is high variation of orchid abundances at the studysites. The one-way ANOVA test resulted that there is nosignificant difference on orchid abundance among threegradient of altitudes (F = 2.97; df = (2, 27); P-value >0.05).This means that altitude ranging from 1800’s to 2000’s isnot a key factor on the abundance of epiphytic orchids inMount Lawu.

The high abundances of epiphytic orchid at Mojosemiare due to environmental condition that favorable forspecific orchid to grow. Orchid grow is mainly influencedthe micro site condition such as light, temperature, windspeed and water availability (Parnata 2005). Beside thosefactors, the establishment of epiphytic orchid also dependson altitude, the existence of lower plants that ease orchidseeds to trap and aerial fallouts, providing suitable microsites for growth (Focho et al. 2010).

Host treeIn this study, total species of host tree at three gradients

of altitudes is 11 species (Table 2). The highest number ofspecies of host tree was recorded at Tirtogumarang (1922m asl) with average 2.3±1.5 species/plot, followed byMojosemi (2041 m asl) and Cemorosewu (1796 m asl) withaverage 2.8±1.93 and 1.3±0.95 species/plot respectively(Figure 2C). The similar pattern also showed in the resultof individual number of host tree that Tirtogumarang hasthe highest densities with average 2.8±1.93individuals/plot, followed by Mojosemi with 3.5±2.8individuals/plot and Cemorosewu with 1.3±0.95

0

2

4

6

8

10

12

2041 m asl 1922 m asl 1796 m asl

Altitude

Num

ber o

f spe

cies

/plo

t

0

500

1000

1500

2000

2500

3000

3500

2041 m asl 1922 m asl 1796 m asl

Altitude

Num

ber o

f ind

ivid

ual/p

lot

0

0.5

1

1.5

2

2.5

3

3.5

4

2041 m asl 1922 m asl 1796 m asl

Altitude

Num

ber o

f spe

cies

/plo

t

0

1

2

3

4

5

6

7

2041 m asl 1922 m asl 1796 m asl

Altitude

Num

ber o

f ind

ivid

ual/p

lot

0

2000

4000

6000

8000

10000

2041 m asl 1922 m asl 1796 m asl

Altitude

Bas

al a

rea

(cm

2/pl

ot)

A B C D E

Figure 2. Average number of species of epiphytic orchid (A); Average number of individual of epiphytic orchid (B); Average numberof species of host tree (C); Average number of individual of host tree (D); Average basal area of host tree (E). Three gradients ofaltitudes are Cemorosewu (2041 m asl), Tirtogumarang (1922 m asl) and Mojosemi (1796 m asl). Stacked bars indicate standarddeviation.


individuals/plot (Figure 2D). These results suggest that eitherspecies richness or abundance of host trees in the studysites is relatively low. One-way ANOVA test resulted thatgradient of altitudes ranging between 1800’s and 2000’s masl. did not influence significantly either on species numberof host tree (F= 2.94; df = (2, 27); P-value > 0.05) or itsindividual number (F= 3.04; df = (2, 27); P-value > 0.05)

Table 2. The composition of host tree recorded at three gradientsof altitudes in southern part of Mount Lawu (Mojosemi = 1796 masl, Tirtogumarang = 1922 m asl. and Cemorosewu = 2041 m asl)

Altitude (m asl)Species name1796 1922 2041

Acmena acuminatissimum + + -Acer laurinum - + +Astronia spectabilis + + -Canthium glabrum - + -Castanopsis javanica + + -Glochidion littorale + - -Lithocarpus sundaicus + + +Lupinus sp. - + -Macropanax concinnus + + +Schima wallichii - - +Tree stump - - +Note: + = found;-= not found

All three study sites are located in buffer zone of forestarea in Mount Lawu. The most dominant host tree at threesites is pasang (Lithocarpus sundaicus). The highabundances of host trees at Tirtogumarang is probably dueto the succession process at this site has not reach theclimax level yet which is indicated by lowest basal area2975.23±1931.43 cm2/plot, compared to Cemorosewu4558.01±4525.40 cm2/plot and Mojosemi 4295.73±3875.18 cm2/plot (Figure 2E). The result of one-wayANOVA showed that basal area of host tree was notsignificantly different among three gradient of altitudes (F= 0.55; df = (2, 27); P-value > 0.05).

Local micro site factors, such as soil, as well as macroenvironmental factors, such as precipitation and elevationare the key variables that influence tree species distributionin the Albertine rift forests (Eilu et al. 2004).

CONCLUSION

In sum, our study suggests that elevation rangingbetween 1796 m asl. and 2041 m asl. is an influence factoron epiphytic orchid species richness but not on theirabundance. The number of host tree species and theirabundance are not influenced by the altitude on this range.Our result showed that there was 19 epiphytic orchidspecies at three gradients of altitudes in southern part ofMount Lawu. The number of species is significantly lowerat higher altitude. The highest number of epiphytic orchidspecies (6.6 species/100 m2) was recorded at site withaltitude 1922 m asl, while the highest number of individual(1337.7 individual/100 m2) was noted at site with altitude1796 m asl. Altitude of 1922 m asl. was noted as the sitewith the highest number of species and individual of hosttrees (2.3 species/100 m2 and 3.5 individuals/100 m2

respectively). However, the highest basal area of host treewas recorded at the altitude of 2041 m asl. (4558 cm2/100m2).

ACKNOWLEDGEMENTS

This research is funded by ‘Incentive Program Activityfor Researcher and Engineer, Indonesian Institute ofScience 2010’ on project entitled ‘Evaluation of orchid insouthern part of East Java’. We acknowledge thecontributions of exploration team members (Pa’i andSuhadinoto), local farmer (Pamuji) and Perhutani’s forestrangers during fieldwork.

REFERENCES

Ackerman JD, Trejo-Toress JC, Crespo-Chuy Y (2007) Orchids of theWest Indies: predictability of diversity and endemism. J Biogeogr 34:779-786.

Annaselvam J, Parthasarathy N (2001) Diversity and distribution ofherbaceous vascular epiphytes in a tropical evergreen forest atVaragalaiar, Westren Ghats, India. Biodiv Conserv 10: 317-329.

Dressler RL (1990) The Orchid: natural history and classification. HarvardUniversity Press. USA.

Eilu G, David LN, Hafashimana, Kasenene JN (2004) Density and speciesdiversity of trees in four tropical forests of the Albertine rift, westernUganda. Diversity Distrib 10: 303-312.

Focho DA, Fonge BA, Fongod AGN, Essomo SE (2010) A study of thedistribution and diversity of the family Orchidaceae on some selectedlava flows of Mount Cameroon. Afr J Environ Sci Technol 4 (5): 263-273.

Gravendeel B, Smithson A, Silk FJW, Schuiteman A (2004) Epiphytismand pollinator specialization: drivers for orchid diversity? Phil TransR Soc Lond B 359: 1523-1535.

Hietz P (1997) Diversity and conservation of epiphytes in a changingenvironment. The International Conference on Biodiversity andBioresources: Conservation and Utilization, IUPAC, Phuket,Thailand. 23-27 November 1997.

Hood GM (2008) PopTools version 3.0.6. Commonwealth Scientific andIndustrial Research Organisation (CSIRO). Canberra, Australia.[http://www.cse.csiro.au/poptools].

Jacquemyn H, Micheneau C, Roberts DL, Pailler T (2005) Elevationalgradients of species diversity, breeding system and floral traits oforchid species on Reunion Island. J Biogeogr 32: 1751-1761.

Kindlmann P, Vergara C (2009) Objective measures of orchid speciesdiversity. In: Pridgeon AM, Suarez JP (eds) Proceedings of theSecond Scientific Conference on Andean Orchids. UniversidadTécnica Particular de Loja, Loja, Ecuador.

Mahyar UW, Sadili A (2003) Orchid of Gunung Halimun National Park.Biodiversity Conservation Project LIPI-JICA-PHKA. Bogor.[Indonesia]

Nieder J, Prosperí J, Michaloud G (2001). Epiphytes and their contributionto canopy diversity. Plant Ecol 153: 51-63.

Parnata AS (2005) Guidance on propagation and treatment of orchid.Agromedia Pustaka. Jakarta. 23-39. [Indonesia]

Perum Perhutani (2010) General Data of BKPH Lawu Selatan, KPH LawuDS [http://www.kphlawuds.perumperhutani.com/index.php] [Indonesia]

Puspitaningtyas DM, Mursidawati S, Sutrisno, Asikin D (2003) Wildorchid in conservation areas in Java Island. Bogor Botanic Garden-LIPI. Bogor. [Indonesia]

Setyawan AD (2000) Epiphytic plants on stand of Schima wallichii (D.C.)Korth. at Mount Lawu. Biodiversitas 1 (1): 14-20. [Indonesia]

Setyawan AD (2001) Review: Possibilities of Mount Lawu to be aNational Park. Biodiversitas 2 (2): 163-168. [Indonesia]

Tian H, Zing F (2008) Elevational diversity patterns of orchids in NanlingNational Nature Reserve, northern Guangdong Province. BiodiversityScience 16 (1): 75-82.

Van Steenis CGGJ (1972) Mountain Flora of Java. EJ Brill. Leiden, TheNetherland.


Valuing quality of vegetation in recharge area of Seruk Spring,Pesanggrahan Valley, Batu City, East Java

TITUT YULISTYARINI♥, SITI SOFIAHPurwodadi Botanic Garden, Indonesian Institute of Sciences, Jl. Raya Surabaya-Malang Km. 65, Purwodadi, Pasuruan 67163, East Java, Indonesia.

Tel./Fax.: +62-341-426046; email: [email protected]

Manuscript received: 12 July 2010. Revision accepted: 9 June 2011.

ABSTRACT

Yulistyarini T, Sofiah S (2011) Valuing quality of vegetation in recharge area of Seruk Spring, Pesanggrahan Valley, Batu City, EastJava. Biodiversitas 12: 229-234. A Seruk spring is one of the springs in Batu city which has water debit less than 1 liter per second.Land use changes of Seruk spring recharge area was occurred in 2001. Recharge area of Seruk Spring consists of anthropogenic forest,eucalypts plantation, bamboo forest, pines plantation, horticulture and housing. The aim of this research was to valuing the quality ofvegetation which supported ground water recharge in Seruk spring. Quality of vegetation was determined by vegetation structure, diversity, thethickness of litter and C-stock of each land use systems. Forests, eucalypts plantation and bamboo forests had almost same quality ofvegetation.

Key words: tree species, diversity, composition of vegetation, anthropogenic forest.

INTRODUCTION

Batu City located at the Brantas watershed has manywater springs. An inventory in this area showed that thereare 107 springs in Batu City, East Java. More than half ofthem have decreasing water debit, some even produce nomore discharge (Environmental Impact Management Agency2007). The decrease of spring discharge is often caused bydegradation of the ecosystems which due to land use changefrom forests to agricultural lands. Forest conversions whichchanged structure and composition of vegetation have beenimplicated in reducing biophysical soil properties.

The presence of tree vegetation on a landscape willhave positive impact on balancing the ecosystem in a widerscale. In general, the role of vegetation in an ecosystem isassociated with carbon dioxide balance and generates oxygenin the air, improved physical, chemical and biological soilproperties, ground water hydrology and others (Arrijani2008). High coverage tree canopies, basal area, understoreyspecies and litter layer were very helpful in maintaining thenumber of soil macroporosity and ground water infiltration.Influence coverage of trees on water flow are through: (i)interception of rain water, (ii) protect soil aggregate:vegetation and litter layer protect the soil surface from therain drop that can destroys soil aggregates, resulting in soilcompaction. Crushed soil particles will cause blockage ofsoil macropore thus inhibit the infiltration of groundwater,consequently surface runoff will increase, (iii) waterinfiltration: infiltration depends on surface layer on the soilstructure and various layers in the soil profile. Soilstructure is also influenced by the activity of the soil biotawhich its energy depends on the organic material (litterlayer on the surface, organic exudates by the roots and dead

roots), (iv) uptake of water (van Noordwijk et al. 2004).Seruk springs had debit less than 1 liter/second. The

water of this spring is resource for drinking water, washing,cooking, irrigating and fish farming. Based on geoelectricdata, a Seruk spring occurs where surface topographycauses the water table to intersect the land slope. Thisspring is fed from a shallow aquifer consist of sand whichhas more permeable layer underlain by a less permeablelayer. A Seruk spring can be identified as a contact springwhich is naturally supported by local ground water flowspring (Yulistyarini et al. 2009). A Seruk spring iscomposed in the geological formation of Volcanic RocksPanderman (Qvp), these units belong to the quaternaryvolcanic rocks of breccia composed of volcanic material,lava, tuff, tuff breccia, agglomerate and lava. Volcanicrocks are predicted Late Pleistocene-Holocene age (Santosaand Sumarti 1992).

The recharge area of Seruk spring was estimated inSeruk hill, which is located at the foot of MountPanderman. Previously, the recharge area was mountainforests with the various types of vegetation and bamboospecies. In the early 2000s, the forests were damaged byillegal logging and fires. Recharge area of Seruk Springcovers an area of 20.04 hectares consists of forests(2.18%), eucalypts (Eucalyptus alba) plantation (9.91%),bamboo forests (9.08%), pine (Pinus merkusii) plantations(51.72%), horticulture (5.88%) and housing (22.17%). Theinformation from local people noted that Seruk springdischarge decreased when the degradation of the forestsoccurred in 2001. However, measurement of the actualspring discharge has never been done, so how much thedecrease in discharge was still unknown. Based onmeasurement of debit in 2009, the maximum discharge of


this spring 1.28 l.sec.-1 and the minimum 0.57 l.sec.-1

(Yulistyarini et al. 2009).Spring debit depends on the large of recharge area and

the quantity of water infiltrating the soil (Todd and Mays2005). Seruk springs that tend to be affected by more localgroundwater flow systems and thus are at risk fromactivities that threaten the shallow water table. From thereason, debit of this spring are depended on thecharacteristics of recharge area. Besides geophysics andbiophysical soil data, the characteristics of recharge areawere determined by quality of vegetation. This study wasaimed to value the quality of vegetation which supportsground water recharge in Seruk spring of Batu, East Java.


Seruk springs is located in Batu City, East Java, at thegeographical position of 07⁰53’02,7” latitude, 112⁰30’15,4” longitude and altitude of 1233 meters above sealevel. Delineation the recharge area of Seruk spring couldbe estimated using the Micro Watershed Area maps that

were made by overlay topography (scale 1: 25.000),contour and drainage maps (Figure 1). Then, land use ofthis recharge area was delineated based on the result oflocation surveys. There were six Land Use Systems (LUS)in the recharge area, consisting of anthropogenic forests,eucalypts plantations, bamboo forests, pines plantations,horticulture and housing land uses (Table 1.) (Yulistyariniet al. 2009). However, vegetation analyses were only infour land use systems which have potency as recharge area,i.e. anthropogenic forests, Eucalypt plantations, bambooforests and pine plantations.

Table 1. Land use systems in recharge area of Seruk Spring

Land use systems Large of area (ha) Percentage (%)

Anthropogenic forests 0.44 2.18Eucalypt plantations 1.97 9.91Bamboo forests 1.80 9.08Pine plantations 10.27 51.72Horticulture 1.17 5.88Housing 4.40 22.17Total 20.04

Figure 1. Location of Seruk spring on upstream Brantas watershed, Batu City, East Java (B) and delineation of Seruk Spring recharge area (C).

200 m

B

A

C

YULISTYARINI & SOFIAH – Quality of vegetation in recharge area of Seruk Springs 231

Vegetation in a sampling unit were classified into threeclasses, e.g. trees, small trees and groundcovers. Trees witha diameter at breast height (dbh) of more than 30 cm wereregistered within plots 100 m x 20 m. Whereas small treeswith dbh less than 30 cm and groundcovers species weresampled in sub plots of 40 m x 5 m and sub plots of 0.5 mx 0.5 m, respectively (Hairiah and Rahayu 2007).

Quality of vegetation was shown by composition andstructure of vegetation, plant diversity and thickness oflitter. Vegetation structure was described by verticalstratification of plants. Vertical stratification wasdetermined based on trees canopy height, consisted of fivestrata. Strata A were height trees greater than 30 m, strata B(20-30 m in height), strata C (4 to 20 m in height), strata D(1-4 m in height) and strata E (ground cover 0-1 m inheight) (Indriyanto 2005). Structure and composition ofvegetation across LUS also have been compared in termsspecies richness, density and domination species. Speciesrichness indicated the number of species per area unit.Whereas, domination of species was determined byImportant Value Index (IVI). Species names, individuals’height and dbh as well as abundance were recorded in eachplot. IVI of each species (tree, small tree and ground cover)for each plot was calculated by summing the relativefrequency and relative density cover. The species diversitywas calculated by Shannon-Wiener diversity index (H’).The formula Diversity Index is H’= Σpi.

2log pi (Ludwig andReynolds 1988). While the thickness of litter was sampledon the plot size of 0.5 m x 0.5 m in the plot 40 x 5 m2, inaccordance with the instructions used by a TSBF (TropicalSoil Biology and Fertility). Litter thickness was measured10 times by pressing the litter then shove thrust slowly(Hairiah and Rahayu 2007).

The quality of vegetation was also determined by thecapacity of vegetation to store and emit carbon. All treeand small tree diameters at breast height were measured,and data were converted into aboveground biomass with anallometric equation as presented in Table 2. C-stock oftrees was counted with formula C = 0.46 x trees biomass(Hairiah and Rahayu 2007).

Table 2. List of allometric equations used to estimate biomass ofvarious land use systems (Hairiah and Rahayu 2007)

Biomass category Allometric equations Source

Branching trees Biomass = 0.11 ρ D 2.62 Ketterings 2001

Non branching trees Biomass = π ρ H D2 / 40 Hairiah 2002

Pines Biomass = 0.0417 D2.6576 Waterloo 1995

ρ data are notavailable

Biomass = 0.118 D 2,.53 Brown 1997

All variable quality of vegetation were comparedbetween anthropogenic forest and other land uses typeusing analysis of variance (F-test). Statistical analysesconducted with Minitab 14.0. program, only values of P <0,05 were consider significant.


Structure and composition of vegetationThe canopy height was graphed for each land uses,

which height of trees varied to 37 m. Five vertical stratawere identified in two LUS, namely anthropogenic forestsand eucalypts plantation. Both land uses were dominatedby woody plants which had a height of 1 to 19.9 m (stratumC). The density of plants in forest was highest in stratum Cand D (Figure 2A). In anthropogenic forests could stillfound some trees with a height of more 30 m as much as 7individual, i.e. Tremna orientalis (6 individual) and Ficusracemosa (1 individu). Bamboo and pine plantations hadfour vertical strata. Bamboo forests were dominated bystratum C and D, whereas pine plantations were dominatedby stratum B.

From the above results are known that forests, eucalyptsand Bamboo had stratification systems nearly complete, sothat infiltration and ground water recharge more rapidly.Infiltration rate of forest (50.2 cm jam-1) was higher thanpines plantation (39.9 cm jam-1) in Ngantang Subdistrict,Malang District, East Java (Saputra 2008). While bambooforests had highest infiltration rate (60.8 cm jam-1 ).

Anthropogenic forests had significantly the highestspecies richness of tree and small trees (P< 0,05), about 65species.ha-1 and 600 species.ha-1, respectively (Figure 2B).There were founded some native species like Tremaorientalis (anggrung), Ficus virens (iprik), F. racemosa(elo), F. hispida, Artocarpus heterophyllus (jack fruit),Microcos tomentosa, Dysoxylum gaudichaudianum(kedoya) and Arenga pinnata (aren). Eucalypt plantationswere planted with about 10 tree species.ha-1 such ascajuputih (Eucalyptus alba), Albizia falcataria andErythrina subumbarn. Whereas the small tree speciesrichness of this LUS reached 213 species.ha-1. There werenot any tree species in Bamboo forest, the species richnessof small trees achieved 288 species.ha-1. Otherwise pineplantations had no small tree species.

Tree density between the LUS showed no significantdifference (P = 0.069) (Figure 2C). However, small treedensity was significantly different among the four LUS (P= 0.001). Anthropogenic forests had highest densities(2050 ± 612.4 SD) trees.ha-1, consequently canopy cover ofthis land use was highest. Bamboo forests were dominatedby Dendrocalamus asper (bambu petung), Gigantochloaatter (bambu jawa) and G. apus (bambu apus). Bamboosspecies in land use systems belongs to native species. Thisland use had no trees, but the density of small trees werehigh (1550 ± 655.7 SD). Whereas small tree density ofEucalypt plantation (925 ± 590.9 SD) was lower than smalltree density of bamboo. Pine plantations had high treedensity 392.5 trees.ha-1 (± 215.7 SD), but this land use hadno small trees. Consequently, pine plantations had lowercanopy cover which allowed rain drop hitting the soilsurface, thus damaging the structure of soil and decreasingmacroporosity soil.

The land use changes that decrease a vegetation densitycould increase the soil degradation. Consequently, thedegradation of soils results in increased run off and reducedinfiltration. Clearing natural forest causes tremendous


A B C

Figure 2.A. Vertical stratification of vegetation each land use systems in recharge area of Seruk Springs. Different letters above the barswithin each strata indicate significance difference between four LUS (p < 0.05). B. Species richness of vegetation each LUS in rechargearea of Seruk Spring. C. Mean density of vegetation each LUS in recharge area of Seruk Spring.

increase of runoff and erosion. Cumulative surface runofffrom the natural forest plot was only 27 mm, about onethird from that of newly cleared forest (75 mm). But thehighest surface runoff was obtained from 3 years coffeeplots (124 mm). Beyond that age, runoff decreases with theincrease of the age of coffee. Soil loss due to erosionpeaked in the 1-year old coffee gardens. The presence ofsoil physical properties becomes inseparable part of themechanism of water movement, especially the flow ofwater into the soil (Widianto et al. 2004).

Trema orientalis (anggrung) was identified as adominant tree species in the anthropogenic forests becauseof its highest IVI (41.03). Small tree species in this areawere dominated by reforestation plants namely Swieteniamahagoni, E. subumbarn and Litsea firma, which had IVI25.22, 16,59 and 11.42, respectively. Alangium javanicumwas one of the native species had high IVI (13.15).Similarly, small trees in eucalypt plantations and bambooforests were mostly reforestation plants such as Perseaamericana, S. mahagoni, Mangifera indica, Diospyros kakiand Senna spectabilis.

To improve the physical properties of soil andhydrological function of forests not only the role of treespecies, but also the role of understorey species.Understorey analyses resulted in pine plantations had thehighest of species number, i.e. 19 species. While, bambooforests only had 6 species. Based on the high IVI value,Eupatorium riparium and grass species Oplosminusburmanii dominated the forests. E. riparium alsodominated the bamboo forests, with IVI values reachedmore than 100. Whereas, pines and eucalypt plantationswere dominated by grass species (Pennisetum purpureum),wedusan (Ageratum conyzoides) and E. riparium. Besidesprotecting the soil surface, understorey species also inputvarious type of litter as a source of soil organic matter.Hairiah et al. (2004a,b) mentions three things that canexplain the low runoff in the forest is (i) the amount ofinterception by the canopy-covered vegetation andmeetings, (ii) thick litter layer that can accommodate largeamounts of water as surface storage and (iii) the number of

macro pores in soil surface that encourages high infiltrationrate.Vegetation diversity

Anthropogenic forests had highest Diversity Index (H’)for tree and small tree species i.e 3.31 and 4.15,respectively (Table 3).

Table 3. Index Diversity and litter thickness of various Land UseSystem in recharge area of Seruk Spring

Index diversity (H') Litter thicknessLand usesystems trees small trees (cm)

Forests 3.31 4.15 3.03± 1.26Eucalypts 1.29 3.34 1.53± 0.09Bamboo 0 3.83 7.61± 0.72Pine 0 0 0.65± 0.17

The high diversity caused by its high species richnessand density in this land use. While eucalypts and Bamboohad high small trees diversity too (H’ Eucalypt = 3.34 andH’ Bamboo = 3.83). That high H’ of small trees was causedby many reforestation vegetations in both land uses. Thestability of ecosystems could assess from the high H’, sothat these land uses had ecosystems more stable and higherresilience to disturbance or succession (UNCED 1992).

Thickness of litterQuality vegetation was also be assessed from the

thickness of litter each LUS, where the bamboo forests hadthe highest thickness of litter (7.61 ± 0,72 SD) cm. Pineplantations had the lowest thickness of litter (0.65 ± 0.17SD) cm (P = 0.006) (Table 3).

The number and quality of litter inputs determined thethickness and thin layer of litter in the surface soil (Hairiahet al. 2004a,b). Total litter inputs in wet tropical forest inWest Sumatra approximately 4.11 Mg ha-1 yr-1 (Hermansahet al. 2002), with a very high diversity of flora. The highplant diversity caused varied quality litter inputs, resultedin layers litter of the forest was thicker than the agriculturalsystem (Hairiah et al. 2004a,b). The thicker litter of forestwould increase soil biota activities resulted in increasing

YULISTYARINI & SOFIAH – Quality of vegetation in recharge area of Seruk Springs 233

soil macroposrosity. Results of research in West Lampungshowed there was a decline macroporosity in forests whichconverted to monoculture coffee three years, namely from83.1% to 63.7% (Suprayogo et al. 2004).

Bamboo leaves have a high silicate content, so thebamboo decomposition is slow. Slow decompositionprocess will cause the litter to stay longer in the soil surface(Hairiah et al. 2004a,b). Litter plays an important role insupporting the balance of ecosystem functions, includinghydrological functions. The litter plays in land coverfunction through reduction surface runoff rate on slope landand enhancement soil porosity and permeability. Inaddition, the litter can supply soil organic matter from itsdecomposition (Sofiah and Lestari 2009). Suhara (2003)indicated that canopy closure was increasingly meetingencourage the improvement of biological activity on thesurface because of the availability of soil organic matterand environmental improvement (micro-climate andhumidity). Soil biological activity was also positivelyimpact towards improving soil structure and porosity andincrease in infiltration rate. Consequently, bamboo forestscould be expected to have high infiltration rate. In the dryseason, litter can reduce evaporation by soil, so the soilremains moist and protected from dryness. The role of litteron carbon stocks through the C-sequestration process ofdecomposition and mineralization (Basuki et al. 2004).

Carbon stockLand use change not only accelerates land degradation

but also accelerates carbon emission and loss of biologicalresources (Kremen et al. 2000). The results showed that theC-stock was not significantly different among the four LUS(P = 0.088).

Table 4. Biomass and carbon stock estimate of various Land UseSystem in recharge area of Seruk Spring

Land usesystems

Biomassa(Mg ha-1)

C stock(Mg ha-1)

Largearea(ha)

C stock/large area(Mg ha-1)

Forests 443.02 203.79 0.44 88.87Eucalypts 132.09 60.76 1.97 119.54Bamboo 64.16 29.51 1.80 53.18Pines 105.10 48.34 10.27 496.29Total 744.37 342.41 14.47 757.88

Even though anthropogenic forests resulted C-stockhighest about 167.17 (± 66.20 SD) Mg ha-1. Eucalyptsplantations, bamboo forests and pine plantations storedcarbon in almost the same amount about 60.76 (± 6.36 SD),48.34 (± 27.89 SD) and 71.50 (± 13.07 SD) Mg ha-1,respectively (Table 4). Forests have highest C stockbecause some native tree species were more than 20 yearsold and had a wider diameter, thus the plants had ability tosequestrate the high carbon. Perennial plants are greater asC- sink than the annual crops (Hairiah and Rahayu 2007).Based on the C stock of each LUS which multiplied by thearea of each LUS obtained the total C stock in Seruk springrecharge area about 757.88 Mg per 14.47 ha.

DiscussionEvery land use system has various environmental

services, depending on the density and diversity ofvegetation, soil type and its management. In the springrecharge area, the vegetation is not only a role in thediversity of land use, but also as one of the components ofthe ecosystem that supports aspects of the ecologicalbalance. From above the result of valuing the vegetationquality, forests, eucalypt plantations and bamboo forestshad high vegetation quality. The high diversity ofvegetation and thickness of litter on both land use systemscould be maintaining hydrological function of rechargearea and protecting debit of water spring. Results ofresearch on Sumberjaya, West Lampung mention thatforests have a higher infiltration of 5.09 mm min-1

compared with coffee and coffee agroforestry monoculture(1.01 mm min-1) (Hairiah et al. 2004a,b). For exceptions,although eucalypts plantation had high vegetation quality,but the expansion of this plant should be considered. Thisis because these plants are exotic plants.

Besides having high vegetation quality, bamboo speciesalso are known as bookmark plant springs. This plantsoften grow around springs. Bamboo forests had a highconstant infiltration, because bamboo has many fine roots,which are concentrated on spreading 0-30 cm soil depth(Saputra 2008) As consequence, water flows horizontallyresult in subsurface flows which discharge as spring(2008). The abundance of fine roots at Makino bamboo isnot only a source of organic material that helps thedevelopment of soil structure, but also form channels forwater movement (Lu et al. 2007).

However, based on the decreasing the large forests andbamboo forests compared with eucalypts, pines andHorticulture land use systems, it is necessary to think aboutpolicy to manage this area in relation to its function as arecharge area. This is mainly because the eucalypt, pineand horticulture had a higher economic value than forestsand bamboo forest. Besides, the ecological functionsshould still take precedence in the management of this area.In fact, pine plantations that dominated this region (51.72%) be known to have high evapotranspiration. So theexpansion of this land use systems was feared to decreaseground water supply. Similarly, the expansion of Eucalyptplantations must be considered, because Eucalypt specieshave relatively deep-rooted, evergreen, and high rates oftotal annual evapotranspiration. Rasul (2009) presented thatthe existence of endemic species is an indicator of thequality of an ecosystem because endemic species have arole in increasing the complexity of food webs as one ofthe requirements to create a balance between ecosystems.Besides that, reforested programs have the advantage ofhigh environmental services and carbon sequestration.

Cooperation between local people and Perhutani as themanager of recharge area of Seruk springs to conserve theecosystems and debit of this spring. Agroforestry and farmforestry become other alternatives land use systems. Agro-forestry and farm forestry provide many environmentalservices such as soil conservation, carbon sequestration,biodiversity conservation and regulation of volumes ofwater in river and streams (Montagnini and Nair 2004).


CONCLUSION

Forests, Eucalypt plantations and bamboo forests hadalmost the same quality of vegetation. While quality ofvegetation in pines plantations was lowest. The highdensity, diversity of vegetation and thickness of litter onthree land use systems could be maintaining hydrologicalfunction of recharge area and spring debit continuously.Besides that the high C-stock of forests, Cajuputihplantations and bamboo forests to be expected increasingthe environmental services of the land use systems.

ACKNOWLEDGEMENTS

This research is funded by ‘Incentive Program Activityfor Researcher and Engineer, Indonesian Institute of Science2009’ on project entitled ‘Evaluation on the relationshipbetween quality of vegetation, biogeophysical soil anddebit of some topography springs in Malang Raya, EastJava’. We acknowledge the contributions of explorationteam members (Kiswojo, Matrani, Suhadinoto and IrfanSulistyo) and a local people (Sardi) during fieldwork.

REFERENCES

Arrijani (2008) Vegetation structure and composition of the montane zoneof Mount Gede Pangrango National Park. Biodiversitas 9 (2): 34-141.[Indonesia]

Basuki TM, Adi RN, Sukresno (2004) Technical information of organiccarbon stock in under clusster of Pinus merkusii, Agathis loranthifoliaand soil expose. Prosiding BP2TPDAS-IBB Surakarta, Kebumen,August 3th 2004.

Environmental Impact Management Agency (2007) Preparatory studies:planning springs conservation in upper Brantas Watershed. FinalReport. East Java Provincial Government. Surabaya. [Indonesia]

Hairiah K, Rahayu S (2007) Practical guidance of “Carbon-SinkMeasurement” in various land use. World Agroforestry Centre.Bogor.

Hairiah K, Widianto, Suprayogo D, Widodo RH, Purnomosidhi P, RahayuS, van Noordwijk (2004a). The thickness of litter as an indicator ofhealthy watershed areas. World Agroforestry Centre. Bogor.[Indonesia]

Hairiah K, Suprayogo D, Widianto, Berlian, Suhara E, Mardiastuning A,Widodo RH, Prayogo C, Rahayu S (2004b) Forests conversion intoagricultural land: litter thickness, earthworm populations and soilmacroporosity. Agrivita 26 (1), 68–80. [Indonesia]

Hermansah, Masunaga T, Wakatsuki T and Aflizar (2002) Micro spatialdistribution pattern of litterfall and nutrient flux in relation to soil

chemical properties in a super wet tropical rain forest plot, WestSumatra, Indonesia. Tropics, Japan Soc Trop Ecol 12 (2): 132-146.

Indriyanto. 2005. Forest Ecology. PT Bumi Aksara, Jakarta. [Indonesia]Kremen C, Niles JO, Dalton MG, Daily GC, Ehrlich PR, Fay JP, Grewal

D, Guillery RP (2000) Economic incentives for rain forestconservation across scales. Science 288: 1828-2000.

Lu SY, Liu CP, Hwang LS, Wang CH (2007) Hydrologycalcharacteristics of a Makino Bamboo woodland in Central Taiwan.Taiwan J For Sci 22 (1): 81-93.

Montagnini F, Nair PKR (2004) Carbon sequestration: anunderexploitated environmental benefit of agroforestry systems.Agrofor Syst 61: 281-295.

Prijono S, Wahyudi HA (2009) A role of agroforestry in maintaining ofsoil macroporosity (Studies on the effect of thickness of litter toincrease worm biomass of P. corethrurus and soil macroporosity).Primordia 5 (3): 2003-2012. [Indonesia]

Rasul G (2009) Valuing ecosystem services for promoting sustainableagricultural land use systems in hills and mountains. Sustain Sci PractPol J 5 (2): 15-27.

Santosa S, Suwarti T (1992) Geology maps Malang sheet, Java.Geological Research and Development. Bandung.

Saputra D (2008) Role of agroforestry in maintaining soil infiltration rate:the effect of macro pores and soil aggregate stability of infiltrationrate. [Thesis]. Brawijaya University. Malang.

Sofiah S, Lestari DA (2009) Services in-situ forest area in PurwodadiBotanical Garden: carbon stock in plant biomass, understorey, litterand soil organic matter. Proceeding of Biology Congress XIV andNational Seminar XX, Indonesian Biology Association. IslamicUniversity of Malang. July 24-24th, 2010.

Suhara E (2003) Earthworm population relationships with soil porosity onagroforestry system coffee-based. [Thesis]. Brawijaya University.Malang.

Suprayogo D, Widianto, Purnomosidhi P, Widodo RH, Rusiana F, AiniZZ, Khasanah N, Kusuma Z (2004). Degradation of soil physicalproperties as due to forest convert into coffee mono-culture system:study of change soil macroporosity. Agrivita 26 (1): 60-68.[Indonesia]

Todd DK, Mays LW (2005) Groundwater Hydrology. John Willey & Son,Singapore.

United Nations Conference on Environment and Development (UNCED)(1992) UN Convention on Biological Diversity (CBD). Rio deJaneiro.

van Noordwijk M, Agus F, Suprayogo D, Hairiah K, Pasya G, Verbist B,Farida (2004) Role of agroforestry in maintenance of hydrological inwater catchment areas. In: Agus F, Farida, van Noordwijk M. (eds)Hydrological impacts of forest, agro-forestry land upland cropping asa basis for rewarding environmental service providers in Indonesia).Proceeding of a Workshop in Padang/Singkarak, West Sumatra,Indonesia, February 25-28th, 2004.

Widianto, Noveras H, Suprayogo D, Widodo RH, Purnomosidhi P, vanNoordwijk M (2004) Conversion of forests into agricultural land: isthe forest hydrological functions can be replaced by monoculturecoffee system? Agrivita 26 (1): 47-52. [Indonesia]

Yulistyarini T, Solikin, Fiqa AP, Irawanto R (2009) Evaluation on therelationship between quality of vegetation, biogeophysical soil anddebit of some topography springs in Malang Raya, East Java [FinalReport]. Incentive Program Activity for Researcher and Engineer,Indonesian Institute of Science. Jakarta. [Indonesia]

BIODIVERSITAS ISSN: 1412-033X (printed edition)Volume 12, Number 3, July 2011 ISSN: 2085-4722 (electronic)Pages: 235-240 DOI: 10.13057/biodiv/d120409

Termites community as environmental bioindicators in highlands: acase study in eastern slopes of Mount Slamet, Central Java

TEGUH PRIBADI1,♥, RIKA RAFFIUDIN2, IDHAM SAKTI HARAHAP3

1Program of Forestry, Faculty of Agriculture, PGRI University of Palangka Raya. Jl. Hiu Putih-Tjilik Riwut km. 7, Palangka Raya73112, CentralKalimantan, Indonesia. Tel./Fax. +62-536-3220778.email:[email protected]

2Departement of Biology, Faculty of Mathematics and Natural Sciences, Bogor Agricultural University, Bogor 16980, West Java, Indonesia.3Departement of Plant Protection, Faculty of Agriculture,Bogor Agricultural University, Bogor 16980, West Java, Indonesia.

Manuscript received: 23 November 2010. Revision accepted: 1 July 2011.

ABSTRACT

Pribadi T, Raffiudin R, Harahap IS (2011) Termites community as environmental bioindicators in highlands: a case study in easternslopes of Mount Slamet, Central Java. Biodiversitas 12: 235-240. Termites ecological behavior is much affected by land use change anddisturbance level. Their variation in diversity can be used as bioindicator of environmental quality. However, termite communityresponse to land use changes and habitat disturbance in highland ecosystems remains poorly understood. This study was conducted toinvestigate the response of termite community to land use intensification and to explore their role as environmental bioindicator inMount Slamet. A standard survey protocol was used to collect termites in five land use types of various disturbance levels, i.e. protectedforest, recreation forest, production forest, agroforestry, and urban area. It was found two termite families i.e. Rhinotermitidae andTermitidae with seven species, i.e. Schedorhinotermes javanicus, Procapritermes sp, Pericapritermes semarangi, Macrotermes gilvus,Microtermes insperatus, Nasutitermes javanicus, and N. matangensis. Termite species’ richness and evenness, Shannon-Wiener index,relative abundance, and biomass of termite were declined along with the land use types and disturbance level from protected forest tourban area. Habitat disturbance was the main declining factor of termite diversity. Termite composition changed along with the land usedisturbance level. Soil feeding termites were sensitive to the disturbance – they were not found in urban area. Hence, their presence orabsence can be used as environmental bioindicator to detect habitat disturbance.

Key words: termite community, bioindicator, land use, environmental disturbance, Mount Slamet.

INTRODUCTION

Land use is a major cause of human ecological changein an ecosystem (NRC 2000). Changes in land use andintensity play major role on the destruction of habitat andbiodiversity decline (Dale 1997; NRC 2000). Destructionof habitat and decline in biodiversity affect the ecosystemhealth and functions. Therefore, early detection mechanismthat rapidly identifies changes in ecosystem conditionsmust be made. Early detection can be performed using agroup of organisms in an ecosystem or habitat thatdescribes the response to these changes.

An organism that can give respond (Weissman et al.2006), indication (McGeoch 1998), early warning (Jonesand Eggleton 2000; Dale and Bayeler 2001), orrepresentation (Hilty and Merenlender 2000; Vanclay2004), reflection (Noss 1990; Vanclay 2004), andinformation (McGeoch 1998) and also evaluation (Burgerand Gochfeld 2001; Carignan and Villard 2002) of thecondition and/ or changes that occur in an ecosystem calledbioindicator. Bioindicator is an important component inecosystem management and biodiversity conservation(Andersen 1999). The rationale of the existence of abioindicator is the close relationship between the presenceof these indicator organisms with biotic and abioticparameters of an ecosystem (McGeoch et al. 2002). In

general, organisms that are promoted to be used as abioindicator in terrestrial ecosystems are insects (Andersen1999; McGeoch 2007).

One group of insects that could potentially be used as abioindicator to assess the condition of ecosystems istermite. Termites have a key role in tropical ecosystemsfunction (Bignell and Eggleton 2000). Termites are one ofthe main decomposer in tropical terrestrial ecosystems(Bignell and Eggleton 2000), and ecosystem engineersthrough their activities which help improve soil structureand nutrient cycling (Jones et al. 1994: Lavelle et al. 1997).In addition, termite species richness showed a highcorrelation to the diversity of other taxon groups in thesame habitat (Vanclay 2004), and the complexity ofvascular plants (Gillison et al. 2003). Termites also showedhigh sensitivity to environmental conditions, both bioticand abiotic that exposed them, as well as on ecosystemprocesses (Jones and Eggleton 2000).

Termite species richness declined due to land use(Eggleton et al. 2002; Jones and Prasad 2002; Jones et al.2003; Attignon et al. 2005), habitat disturbance (Eggletonet al. 1995, 2002) and habitat fragmentation (Davies 2002).Relative abundance of termites has decreased due to landuse (Jones et al. 2003), and fragmentation of habitat(Davies 2002). The structure of termite speciescomposition was changed due to land use and habitat

BIODIVERSITAS 12 (3): 235-240, July 2011236

disturbance. The group was a group of soil-eating termiteswhich is the most sensitive group to habitat disturbance(Eggleton et al. 1995, 2002; Davies 2002; Jones and Prasad2002; Jones et al. 2003). However, information on termiteresponse to habitat disturbance or land use in the highlands(> 1000 ASL) was still lacking. In general, research ontermite community response to land use was mostlyconducted in the lowlands.

This study investigated the response of termites to land-use in Mount Slamet, the second largest mountain in Java.Eastern slopes of Mount Slamet (ESMS), is one of theareas with high variation of land use. In this area, there areprotected forests, ecotourism, limited production forestmanaged by the Perum Perhutani, dry farmland, andsettlements. This study aims to investigate the response oftermite communities in ESMS of land use and review itsrole as a bioindicator of environmental quality.


Location of the study. The research was conducted inthe region eastern slopes of Mount Slamet (ESMS), fromJune to September 2008. Five locals were chosen forobservation diversity of termites based on the level ofhabitat disturbance due to land use activities as defined byBickel and Watanasit (2005) and Koneri (2007). Theassessment was based on the level of habitat disturbance,namely: (i) the number of trees with large diameter (ø ≥ 20cm), (ii) the existence of lower plants, (iii) the amount ofcanopy stratification, (iv) the direct exposure of sunlight to theground, and (v) the level of accessibility to the region.Characteristics of each type of land use are presented inTable 1.

Termite sampling technique. The method used toobserve the termites in the study was a method developed

by Jones and Eggleton (2000). Data obtained from thisprocedure was the taxonomic composition and functionalgroups of termites (eating or feeding groups) (Eggleton etal. 2002; Jones et al. 2005). Two termite transect wasplaced at each site, transects were placed in a purposivereason (placed on habitats that were invisible uniform) andcut the contour lines. Termites transect size of 100 m x 2m, consisting of 20 sections (sections) with a size of 5 m x2 m. Each section was examined and termites were caughton their microsite. The explored microsites were ground(inside and surface), litter, logs, and trees. Time needed toexplore the existence of termites in each section was 30minutes per person for two collectors (Jones and Eggleton2000).

The observation points in every part of the termitetransect consists of twelve areas on the surface of the landwith an area of ± 50 cm2. Each area was excavated at adepth of approximately 5 cm and the termites werecollected. Dead wood with a diameter ≥ 1 cm found inevery part of transect were dismantled and the termites in itwere collected. Banir and pepagan layer were opened andtermites found at the height of up to ± 2 m were collected.Nest and mound (mound) in the open ground and termitesthat are found there were also collected (Jones andEggleton 2000).

The collected termites were inserted in a tubecontaining 70% alcohol and labeled. The next step wasspecimens sorting and identifying. Initial identification wasdone until the level of morphospecies genus. Identificationof termite specimens refer to the identification key ofAhmad (1958), Tho (1992) and Sornnuwat et al. (2004).Relative Abundance (KR) was calculated based on thenumber of termites from the same species caught in eachsection along transect, so the KR values ranged from 0-20for each transect. Relative abundance was compared withother locations. Termite biomass was measured by wetweight of 20 termites.

Table 1. Descriptions of each type of habitat of study sites.

Protected forestsHL (I)

WanawisataWW (II)

Forest productionHP (III)

AgroforestryAF (IV)

SettlementsPM (V)

Location Gunung Keris,07015’22.9” S,109016’71,6” E. 1152m asl

Pesanggrahan,07014’70.6” S,109017’50.5” E. 1012m asl

Brubahan,07014’50.3.9” S,109017’71.7” E. 1124 masl

Kali Pring,07015’18.1” S,109017’0.59” E. 1087m asl

Brubahan,07014’84.6” S,109017’86,6” E. 1001m asl

Plants 3050/ha,LBD 115.95 m2/ha.Dominated by puspastands

1200/ha,LBD 76.06 m2/ha.Dominated by standsof dammar

850/ha,LBD 92.20 m2/ha.Dominated by stands ofpinus

1050/ha, LBD 21.98 m2/ha.Dominated by standsof dammar

900/ha,LBD 9.17 m2/ha.

Canopy 3 layers, tight 2 layers, tight 2 layers, open 2 layers, more open 1-2 layers, very openBelowgroundplants

Land tightly covered,belowground plantshigh,168.5/m2

Land tightly covered,but belowgroundplants small,90.5/m2

Land tightly covered,but belowground plantssmall,133.0/m2

Land openly covered,belowground plantssmall,270.5/m2

Land mostly opened,belowground plantssmall,155.3/m2

Accessibility Veryrare; hunting andlooking for grass

Rarely; look forgrass, an alternativeroute

Often; tapping pine,there is a field, near thesettlement (± 200 m)

Often; seasonalagricultural land

Very often; agricultureand settlement

Availability(early opening ofthe habitat)

Unknown 1980 1980 1995 Unknown

Note: roman numerals on the types of land use information indicates the level of habitat dependence.

PRIBADI et al. –Termites community as bioindicator in highlands 237

Table 2. Relative abundance of species of termites in five different types of land use in ESMS.

Land use typeSpeciesHL WW HP AF PM

∑ Note

Pericapritermes semarangi Holmgren 16 3 6 6 0 31 TE, Te1, T

Schedorhinotermes javanicus Kemner 9 4 8 1 1 23 RH, Rh1, K*

Nasutitermes javanicus Holmgren 10 4 1 2 4 21 TE, Te3, K

Macrotermes gilvus Hagen 0 0 0 0 5 5 TE Te2, K

Microtermes insperatus Kemner 0 1 2 0 0 3 TE, Te2, K

Procapritermes sp. 2 0 1 0 0 3 TE, Te1, T*

Nasutitermes matangensis Haviland 2 0 0 0 0 2 TE, Te3, K

Total 39 12 18 9 10 88

Note of land use type codes refer to Table 1. RH (Rhinotermitidae), Rh1 (Rhinotermitinae), TE (Termitidae), Te1 (Termitinae), Te2(Macrotermitinae), Te3 (Nasutitermitinae). K (wood-eaters), T (feeds the soil). * Termite functional groups based on the classificationof Donovan et al. (2000a). Signs (0) means not found termite species.

Analysis of data. Termite species richness (S) wascalculated based on the number of species found pertransect. Shannon-Wiener Index (H), Smith and Wilsonevenness index (E) calculated with the help of the softwareEcological Methodology (Krebs 1999). The relationshipbetween land use (PL) and the level of habitat disturbance(TG) of the termite community (S, KR, H, E, and BM)were analyzed by ordination of Redundancy Analysis(RDA). Environmental parameters on the RDA which weremost influential to the termite community structure wereanalyzed using Forward Selection method and were testedusing Monte Carlo Permutation with 199 randompermutations. The second analysis was conducted usingCanoco Version 4.5 software (Ter Braak and Smilauer2002). Log (x + 1) transformation was used to meet theparametric assumptions.


The structure and composition of termite communitiesOf the five sampling sites, there were totally seven

species from two families of termites (Table 2).Rhinotermitidae Family was represented by the subfamilyRhinotermitinae, while Termitidae family was by threesubfamilies, namely Termitinae, Nasutitermitinae andMacrotermitinae. Nasutitermes javanicus andSchedorhinotermes javanicus were found in all types ofland use. While the termite species found only in onelocation was M. gilvus (settlements) and Pericapritermessp. (Protected forest). The highest relative abundance oftermites was in forest protection with 39 findings andlowest was in the settlements (10 findings). Termitesbiomass of on the type of land use of HL, WW, HP, AFand AM in a row was 1.33 ± 1.09, 0.31 ± 0.15, 0.81 ± 0.36,12.49 ± 0.20 and 0.34 ± 0.35 gr.m-2 (Figure 1). At PMlocation, there were no eating soil termites and they weremostly found in HL and HP (Figure 2).

Figure 1. Biomass of termites in each of the different types ofland use in ESMS. The value shown is the average value (x) withstandard errors.

Figure 2. Comparisons between groups of wood-eating termites(K) with land eater (T) in each of the different types of land use inESMS.


Termite species richness found in this study was muchless compared to some researches on the diversity oftermites in Sunda shelf biogeography for the plateauecosystem conducted by Jones (2000) and Gathorne-Hardyet al. (2001). This was assumed to be caused by thereduction of natural forest existence and the effect ofaltitude. Gathorne-Hardy et al. (2001) suggested that thehigher the location of the termite species, the richnessdecreased. Decline in termite species richness was due toreduced environmental temperature so that it slowedmetabolism of termites. Extreme environmental conditionscaused less species to survive. This was evidenced by theunavailability of Kalotermitidae Family in ecosystems at analtitude over 1000 m asl (Gathorne-Hardy et al. 2001) aswell as in this research. In addition, the pool species theorycould explain this phenomenon (Donovan et al. 2000b).Tho (1992) mentioned that the species of termites in Java(54 species) was less than in Borneo (90 species) andSumatra (89 species). This was supported by research ofGathorne-Hardy et al. (2001) which stated that the size ofan island contributed to the composition of termite species.

Subfamily of Rhinotermitidae, Macrotermitidae,Termitidae, subfamily Nasutitermitidae were commonlyfound in the Sunda Shelf (Tho 1992; Jones 2000;Gathorne-Hardy et al. 2001). Groups of soil-eating termitesin the plateau were generally much less than in thelowlands. Groups of soil-eating termites on the plateauwere Genus Pericapritermes and Procapritermes (Jones2000; Gathorne-Hardy et al. 2001). Both genera wereusually found in forested areas and it was different with M.gilvus which was associated with open or disturbed habitats(Gillison et al. 2003).

Negative effect of altitude on the presence of specieshad an association with soil-eating termites foragingstrategy of each group of termites (Gathorne-Hardy et al.2001). Soil-eating termites obtained energy from a mixtureof mineral soil and humus and it brought to a result of lessenergy for a lower metabolic activity than the one obtainedby wood-eating termites (Jones 2000). The increase ofheight correlated with the low temperature and it becamethe limiting factor in the metabolism of termites. Eatingland termites had lower reserve of energy than the wood-eating termites so that soil-eating termites were moresensitive to the altitude change (Jones 2000; Gathorne-Hardy et al. 2001).

This study showed that different types of land use hadcaused a decrease in termite species richness, relativeabundance of termites and termite biomass gradually fromprotected forest to the settlement area. Shannon-Wienerindex did not correlate with the type of land use (Figure 3).Some studies also reported a decrease in species richnessand relative abundance of termites (e.g. Eggleton andBignel 1995; Eggleton et al. 1995; 1996; 1999; 2002; Jonesand Prasad 2002; Gillison et al. 2003; Jones et al. 2003)and biomass termites (Eggleton et al. 1996; 1999) inresponse to changes in land use. However, in this study theresponse of land use on community structure (biodiversity)of termites did not show any significant effect (λ = 0.00, p= 0.965, F = 0.07) (Table 3). This was also suit with thestudy of Gathorne-Hardy et al. (2002) who concluded that

the decline in biodiversity termites are not influenced bythe type of land use. But monoculture cropping systems(high habitat disturbance) significantly caused a decrease intermite species richness. Monoculture cropping systemcaused a decrease in the diversity of termites because itlowered microhabitat diversity to support the life oftermites (Jones et al. 2003).

Figure 3. RDA ordination between levels of habitat disturbance(TG), types of land use (PL) with species evenness (E), biomass(BM), relative abundance (KR) and species diversity (H) andspecies richness (S) termites in five types of usage different landin ESMS. Description: The long arrows indicate the strength ofcorrelation between parameters. Parameters with the samedirection arrows mean positive correlation, whereas in theopposite direction of arrows means negative correlation and thedirection perpendicular arrows between the parameter mean notcorrelated. The smaller the angle formed between two parametersmeans that the higher correlation (Ter Braak and Smilauer 2002).

Table 3. Summary results of the RDA ordination ofenvironmental parameters influence the structure of termitecommunities in five different types of land use in ESMS.

Axis1 2 3 4

Characteristic roots (eigen value) 0.268 0.080 0.303 0.192Correlation termite communitystructure-environmental

0.825 0.656 0.000 0.000

Total inertia = 1.000Percentage variation (%) 77.0 100.0Environmental parameters λ P FThe level of habitat disturbance (TG) 0.38 0.038* 4.84Types of land use (PL) 0.00 0.965 tn 0.07

The level of habitat disturbance and its influence hadsignificant negative correlation to the structure of termitecommunities (λ = 0.38, p = 0.038, F = 4.84) (Table 3). Thiswas agreeing with research of Gathorne-Hardy et al.(2002). Disturbance of habitat is the main cause of declineof termites diversity in the Sunda Shelf . The mechanismscausing a decrease in diversity due to termite habitatdisturbance were: (i) depreciation of canopy closure which

PRIBADI et al. –Termites community as bioindicator in highlands 239

could lead to direct sunlight on the soil surface. Thesechanges resulted in a decrease in humidity and an increasein environmental temperature so they formed a moreextreme microclimate. The variation between dailytemperature and high humidity affected the activity oftermites; (ii) habitat disturbance affecting the decrease inthe number and quality of the microhabitat. Reducedmicro-habitats of termites might reduce the food supply oftermites and their ability to nest; (iii) bulk density increasecausing the soil to be denser and lowering the activity oftermites, particularly subterranean termites. If more andmore disturbed habitats, which have been affected firstwere the group of soil-eating termites (Eggleton et al. 1995,1996, 1999; Jones and Prasad 2002; Jones et al. 2003).Groups of soil-eating termites required more stability ofmoist soil conditions and soil temperatures than wood-eating termites. The ideal habitat condition for groups ofsoil-eating termites was a tropical rain forest with densecanopy closure (Eggleton et al. 2002).

Termites community as a bioindicatorThe group of soil-eating termites was the most sensitive

one to habitat disturbance. Disturbed habitats reduced theproportion of soil-eating termites to wood-eating termites.In habitats with a high level of disturbance, the soil-eatingtermites did not exist at all. Some same studies also reportedthat the group of soil-eating termites was the group mostlyaffected by level of habitat disturbance such as termitesgroup of genus Procapritermes, Pericapritermes andTermes (Eggleton and Bignel 1995; Eggleton et al. 1995,1996, 1999, 2002; Gathorne-Hardy and Jones 2000;Gahtorne-Hardy et al. 2002; Jones and Prasad 2002; Davieset al. 2003; Gillison et al. 2003; Jones et al. 2003). Thus,the response of soil-eating termites group on the level ofhabitat disturbance could be used as a bioindicator ofenvironmental quality.

This was in accordance with the opinion of McGeoch(1998) which has stated that the bioindicator was anorganism (or group of organisms) showing the sensitivityor tolerance to environmental conditions that make itpossible to be used as an assessment tool of environmentalconditions. Indicator species was a species that hadamplitude on one or several influences of narrowenvironmental factors.

The proposal to use termites as a bioindicator has beenproposed by Speight et al. (1999), Jones and Eggleton(2000), and Vanclay (2004). Basic information of termiteshas also been obtained as a comparison with other levels ofdisturbance. Hilty and Merenlender (2000) stated thatorganisms that serve as a bioindicator should show changesin response to pressure changes that occur. However, if theresponse was too strong it would provide inappropriateinformation. Groups of soil-eating species of termites had aresponse to a gradual level of pressure change. It ischaracterized by decreasing relative abundance and numberof species of soil-eating termites that decreased graduallyin response to changes in the level of habitat disturbance.

The determination of termites as a bioindicator was alsosupported by the standard method of observation (i.e.transect method) that could be used widely (Jones et al.

2006), and easily, and the results could be analyzedstatistically (Hilty and Merenlender 2000; Hodkinson andJackson 2005). Termites were easily measured, abundant,and had clear taxonomy.

CONCLUSION

Termite community was potential to be used as abioindicator of habitat disturbance. The improvement ofhabitat disturbance was responded by the termitecommunity with a decrease of termite communityparameters (species richness, relative abundance, termitecomposition, termite biomass, termite species distributionand termite species diversity). However, the tendency wasnot detected significantly. The tendency that could beobserved from this study was the absence of land-eatingtermite species in residential areas (most disturbed habitat).The absence of land-eating termite species in a habitatcould be used as bioindicator for disturbed habitats(environmental quality).

ACKNOWLEDGEMENTS

This research was funded by the scholarship program,Researcher, Creator, Writer, Artist, Athlete, and People(P3SWOT), Bureau of Planning and InternationalCooperation, Ministry of National Education in 2007.

REFERENCES

Ahmad M (1958) Key the Indomalaya termite. Biologia 4: 33-198.Andersen AN (1999) My bioindicator or your? making the selection. J

Insect Cons 3: 61-64.Attignon SE, Lachat T, Sinsin B, Nagel P, Peveling R (2005) termite

assemblages in West-African semi-deciduous forest and teakplantation. Agric Ecosyst Environ 110: 318-326.

Bickel TO, Watanasit S (2005) Diversity of leaf litter ant communities inTon Nga Chang Wildlife sanctuary and rubber plantation NearbySongkhla, Southern Thailand. Songklanakarin J Sci Technol 27: 943-955.

Bignell DE, Eggleton P (2000) Termites in ecosystems. In: Abe T,Higashi M, Bignell DE (eds) Termites: evolution, sociality,symbioses, ecology. Kluwer, Dordrecht.

Ter Braak CJF, Smilauer P (2002) CANOCO Reference manual andCanoDraw for Windows user's guide software for canonicalcommunity ordination (version 4.5). Microcomputer Power, Ithaca.

Burger J, Gochfeld M (2001) On developing bioindicators for human andecological health. Monit Environ Assess 66: 23-46.

Carignan V, Villard MA (2002) Selecting indicators of species to monitorecological integrity: a review. Monit Environ Assess 76: 45-61.

Dale VH, Bayeler SC (2001) Challenges in the development and use ofecological indicators. Ecol Indicat 1: 30-10.

Dale VH (1997) The relationship between land-use change and climatechange. Ecol Appl 7: 753-769.

Davies RG (2002) Feeding group responses of Neotropical termiteassemblage to rain forest fragmentation. Oecologia 133: 233-242.

Davies RG, Eggleton P, Jones DT, Gathorne-Hardy FJ, Hernandez LM(2003) Evolution of termite functional diversity: analysis andsynthesis of local ecological and regional influence richness on localspecies. J Biogeogr 30: 847-877.

Donovan SE, Jones DT, Sands WA, Eggleton P (2000a) Morphologicalphylogenetics of termites (Isoptera). Biol J Linn Soc 70: 467-513.


Donovan SE, Eggleton P, Bignell DE (2000b) Gut content analysis andnew feeding group classification of termites. Ecol Entomol 26: 356-366.

Eggleton P, Bignell DE, Sands WA, Waite B, Wood TG, Lawton JH(1995) The Richness of species of termites (Isoptera) under differinglevels of forest disturbance in the Mbalmayo Forest Reserve,Southern Cameroon. Tropic J Ecol 11: 85-98.

Eggleton P, Bignell DT (1995) Monitoring the response of tropical Insectsto changes in the environment: troubles with termites. In: HarringtonR, Stroks NE (eds) Insects in changing environments. Academic Pr,London.

Eggleton P, Bignell DE, Sands WA, Mawdsley NS, Lawton JH, WoodTG, Bignell NC (1996) The Diversity, Abundance and biomass oftermites under differing levels of disturbance in the Mbalmayo ForestReserve, Southern Cameroon. Phil Trans Royal Soc Lon B 351: 51-68.

Eggleton P, Homathevi R, Jones DT, MacDonald JA, Jeeva D, BignellDE, Davies RG, Maryati M (1999) Termite assemblages, forestdisturbance and greenhouse gas fluxes in Sabah, East Malaysia. PhilTrans Royal Soc Lon B 354: 1971-1802.

Eggleton P, Bignell DE, Hauser S, Dibog L, Norgrove L, Madong B(2002) termite diversity is a cross an anthropogenic disturbancegradient in humid forest zone of West Africa. Agric Ecosyst Environ90: 189-202.

Gathorne-Hardy FJ, Jones DT (2000) The recolonization of the Krakatauislands by termites (Isoptera), and Their Origins biogeographical. BiolJ Linn Soc 71: 251-267.

Gathorne-Hardy FJ, Syaukani, Eggleton P (2001) The effects of altitudeand rainfall on the composition of termites (Isoptera) of the LeuserEcosystems (Sumatra, Indonesia). Tropic J Ecol 17: 379-393.

Gathorne-Hardy FJ, Jones DT, Syaukani (2002) A regional perspective onthe effects of human disturbance on the termites of Sundaland. BiodivConserve 11: 1991-2006.

Gillison AN, Jones DT, Susilo FX, Bignell DE (2003) Vegetationindicates diversity of soil macroinvertebrates: a case study withtermites along a land-use intensification gradient in lowland Sumatra.Org Divers Evol 3: 11-126.

Hilty J, Merenlender A (2000) Faunal indicator taxa selection formonitoring ecosystem health. Conserv Biol 92: 185-197.

Hodkinson ID, Jackson JK (2005) Terrestrial and aquatic invertebrates asbioindicatos for environmental monitoring, with particular referenceto Mountain. Ecosyst Manag Environ 35: 649-666

Jones CG, Lawton JH, Shachak M (1994) Organisms as ecosystemengineers. Oikos 69: 373-386.

Jones DT (2000) termite assemblages in two distinct montane forest typesat 1000 m elevation in the Maliau Basin, Sabah. Tropic J Ecol 16:271-286.

Jones DT, Davies RG, Eggleton P (2006) Sampling termites in foresthabitats: a replay to Roisin and Laponce. Austral Ecol 31: 429-431.

Jones DT, Eggleton P (2000) Sampling termite assemblages in tropicalforest: testing a rapid biodiversity assessment protocol. J Appl Ecol37: 191-203.

Jones DT, Prasetyo AH (2002) A survey of termites (Insecta: Isoptera) ofTabalong distric, South Kalimantan, Indonesia. Raffles Bull Zoo 50:117-128.

Jones DT, Susilo FX, Bignell DE, Hardiwinoto S, Gillison AN, EggletonP (2003) termite assemblage collapse along a land-use intensificationgradient in lowland central Sumatra, Indonesia. J Appl Eco 40: 380-391.

Jones DT, Verkerk RHJ, Eggleton P (2005) Methods for samplingtermites. Leather SR (eds) Insect sampling in forest ecosystems.Blackwell, Malden.

Koneri R. 2007. Bio-ecology and Conservation of Lucanid Beetles(Coleoptera: Lucanidae) in the Forest of Mount Salak, West Java[Dissertation]. SPS IPB, Bogor. [Indonesian]

Krebs JC (1999) Ecological methodology. Harper and Row. New York.Lavelle P, Bignell D, Lepage M, Wolters V, Roger P, Ineson P, Heal OW,

Dhillion S (1997) Soil function in changing world: the role ofinvertebrate ecosystem engineers. Eur J Soil Biol 33: 159-193.

McGeoch MA, van Rensburg BJ, Botes A (2002) The verification andapplication of bioindicators: a case study of dung beetles in savannaecosystem. J Appl Ecol 39: 661-672.

McGeoch MA (1998) The selection, testing, and application of terrestrialInsects as bioindicator. Biol Rev 73: 181-201.

McGeoch MA (2007) Insects and bioindication: theory and progress. In:Stewart AJA, New TR, Lewis OT (eds). Insect conservation biology.CABI, Amsterdam.

Noss RF (1990) Indicators for monitoring biodiversity: a hierarchicalapproach. Conserv Biol 4: 355-364.

NRC (National Research Council) (2000) Ecological indicators for thenation. National Academic Pr, Washington.

Speight MR, Hunter MD, Watt AD (1999) Ecology of Insects conceptsand applications. Blackwell, Oxford.

Sornnuwat Y, Vongkaluang C, Takematsu Y (2004) A systematic key totermites of Thailand. Kasetsart J Nat Sci 38:349-368.

Tho YP (1992) Termites of Peninsular Malaysia. Malay Forest Rec 36.FRIM (Forest Research Institute of Malaysia), Kepong.

Vanclay JK (2004) Indicator groups and faunal Richness. Fbmis 1: 105-113.

Weissman L, Fraiber M, Shine L, Garty J, Hochman A (2006) Responsesof antioxidants in the lichen Ramalina lacera May serve as a warningNearly bioindication systems for detection of water pollution stress.Fems Microbiol Ecol 58: 41-53.


Community-based sustainable rattan conservation: a case study inLore Lindu National Park, Central Sulawesi

HAMZARI♥

Department of Forestry, Faculty of Forestry, Tadulako University. Bumi Tadulako Tondo, JI. Soekarno Hatta km. 9, Palu 94118, Central Sulawesi,Indonesia. Tel.: +62-451-422611–422355, Ext. 311, 313. Fax. +62-451-422844. ♥email: [email protected]

Manuscript received: 12 December 2010. Revision accepted: 28 April 2011.

ABSTRACT

Hamzari (2011) Community-based sustainable rattan conservation; a case study in Lore Lindu National Park, Central Sulawesi.Biodiversitas 12: 241-245. The following research study focused on community-based rattan conservation and was conducted in acommunity located in the buffer zone of Lore Lindu National Park. The aims of the study were to generate a model for community-based rattan conservation and estimate the economic value of rattan management for the community. The results were expected toprovide justification for the development of rattan management systems and strategies. The research was conducted using a combinationof community education and evaluation of educational outputs. As a result, the research may be characterized as descriptiveexperimentation with a participative approach of andragogy. Data was collected through the employment of questionnaires, interviews,PRAs, and FGD techniques. Data were analyzed using quantitative and qualitative analysis. Based on result of analysis, inferential thatcommunity asses the effort of rattan conservation as a positive effort and its development requires additional support. The communityhas a desire to conduct efforts of rattan conservation continuously. The forms of rattan conservation that can be developed are rattancultivation and selective rattan harvesting. The research developed conservation models in collaboration with rattan farming groups andinvolving community forestry approaches.

Key words: rattan, conservation, community based, sustainability.

INTRODUCTION

Rattan is a potential non-timber forest product that hasthe potential to be developed as a commodity, both to meetnational and international demands (Dominic and Camille2001; Supriadi et al. 2002). Central Sulawesi uniquelylocated in such a manner that its ample natural forests areable support a various rattan varieties (Alrasyid 1980). Thequality and prevalence of rattan has greatly decreased as aresult of exploitation. The variables responsible fordecreasing rattan populations include the lack ofconservation efforts on the part of the government, privatesector, and rattan farmers themselves. The lack ofconservation efforts can be attributed to a lack ofknowledge and skill held by rattan organizers, especiallyrattan farmers whom continue to employ simplistictechniques (Nasendi 1995).

Rattan conservation is a strategy that must besystematically developed in order to provide the bestpossible practices for rattan conservation on an ongoingbasis. This will allow for rattan productivity to be moresustainable. Earnings generated by the community throughthe utilization of rattan have the potential to contribute tonot only the local economy, but the national economy aswell. Stakeholders involved in rattan industry claim to havespecial knowledge and skill about rattan conservationtechniques, especially concerning rattan cultivationmethods.

The exploitation of rattan and rise of rattanconservation awareness has promoted an initiative toemploy trade certification for cultivated forests. It itexpected that by 2010 all commercial forest products,including rattan, must be the result of cultivation. As aresult, it is expected that by 2010 all forest products will bederived from commercialized sources and not the result ofnatural forest extraction.

In order to conduct research on conservation andmanagement strategies for rattan in the rainforest marginsof Lore Lindu National Park (LLNP), we have to knowfirst know the value of rattan to the community. Accordingto Bennett and Barichello (2006), aside from the physicalcomponents, the economic and social values of rattan mustalso be accounted for as an important variable in thecalculation of total economics value. The result of theinvestigation is expectable to assure stakeholders involvingfor giving support to the conservation effort. This is animportant aspect faced in sustainable forest management.

The dynamics and stability of rainforest margins is acentral issue in the bio-conservation and sustainability ofplant germplasm (Renuka 2004). The rate of degradationexperienced in forest and biodiversity is a serious challengefacing in the current conservation efforts. Degradation isalso becoming a big problem in the management ofnational parks, including Lore Lindu National Park. As aresult of these issues and other, a comprehensive study on theconservation of rattan was considered of critical importance.


In general, this research aimed to produce a model ofcommunity-based rattan conservation and management,and evaluate the total economic value of rattan managementfor the community. So that, if a variety of potential rattantypes increases economically, it can increase earnings andprosperity for community. Specifically, this research aimedto: (i) calculate the earnings of rattan farmers over the last10 years; (ii) compare and contrast the attitudes and desiresof rattan farmer to the expansion of efforts in the area ofrattan conservation; (iii) determine strategies forconservation that can be undertaken by communities for theexpansion of rattan conservation; (iv) determine strategiesfor rattan conservation that can be rapidly undertaken byrattan farmer.


The research was conducted utilizing a combination ofcommunity education and analysis of educational result.The research can be categorized as descriptiveexperimentation. The research was undertaken utilizing anandragogy approach. Data was collected usingquestionnaires, structured interviews, Participatory RuralAppraisal (PRE) and focus group discussions (FGD) (Tellu2006). The data collection techniques were adjusted toaccommodate the following: First phase: Rattan farmertraining utilizing an andragogy approach. Second phase:Utilizing the PRE, RRA and FGD techniques to collectinformation on the potential types of conservationstrategies that may be used by rattan farmers. Third phase:implementing rattan conservation strategies in the field,largely accomplished by the FGD method. Fourth phase:Evaluation and follow-up. This phase was jointlyundertaken by researchers, rattan farmers and stakeholders,to ensure comprehensive and community-based rattanconservation strategies.

Respondents included those individuals living aroundthe TNLL, primarily those undertaking rattan farming andin direct contact with the TNLL. In each of the eight villagelocated in the buffer zone, 15 to 20 individuals wereselected to participate. Besides, it also is taken somestakeholders involving direct in management and rattancommerce. Estimating the economics value of rattanmanagement was accomplished with structural interviewsand filling inquiries. The observation of researchimplementation was done step by step according to thedevelopment stages of the activity of research in the field.


Based on the results of questionnaire analysis, PRA andFGD, results can be grouped into four groups: rattan farmeridentity; activity of taking rattan; expense and earningscomponents of rattan farmer; and rattan conservation.

Rattan farmer identityRattan farmers whom are involved in the harvesting and

collection of rattan tend to be categorized as being a

productive age, that is, young and strong enough to be ableto yield goods and services for living. Rattan collection is aviable manner to provide added economic gain for a familyas a means of secondary or tertiary income, and generatesmuch enthusiasm/interest from people living near forests.

Men dominate rattan collection, however, women cansometimes be found in the practice as well. As a rule ofthumb, for every man found in the practice of rattan, thereare two women involved in some context. Women tend toexist in the capacity of support, cooking for rattancollection crews. So the women do not make activity aswithin reason the men takes rattan. Harvesting andcollecting rattan is a form of work that does not demandeducation or special skills, thereby allowing it to beundertaken by a variety of individuals from varyingbackgrounds and training (or lack thereof) (Rachman andSupriadi 2001). Most rattan farmers have a basic level ofeducation; generally this involves only elementary school(including this category is which have never gone to schoolor not finish basic school (Sekolah Dasar) and junior highschool (Sekolah Menengah Pertama).

According to Januminro (2002), the engagement ofindividuals in rattan harvesting as a side job has existed inthe region for a long time. Frequently, these individuals arefull time workers of the farming trade, althoughoccasionally individuals can also originate from carpentry,commerce and public servant (pegawai negeri sipil). Theharvesting and collection of rattan is predominantlyundertaken when there is little or no activity on the farm.For example, if the farmer has free time or is in betweencultivate periods; the individual will carry out rattancollection and harvesting. A similar trend is exhibited byrattan merchants; when there is excess rattan harvested andbrought to market, the price of rattan will decrease. Formost individuals, rattan farming is not the main source ofincome. While it does provide supplemental income, manyconfess that the money generated from the harvesting andcollection of rattan is very small.

Activity of taking rattanAlthough rattan collection is in most cases a side

activity, it is frequently practiced by individuals for a longperiod of time. Generally, individuals have been collectingrattan for between 6-15 years, although some have beencollecting for less than five years and some more than 16years. Based on information collected from informants, theamount of rattan taken from the forest is not influenced bythe duration of the involvement the farmer in the activity(Table 1).

Table 1. Average rattan collection patterns of farmers

Number of daysinvolved in

collection per year

Number of yearsfarmer has been

involved in rattancollection (yr)

Total amount ofrattan collected

(kg)

1 > 10-8 80 <

2-3 8-6 80

14 < 6 61-80

HAMZARI – Rattan conservation in Lore Lindu National Park 243

The number of days required by every rattan farmer tocollect and harvest rattan varies. The amount of rattan thatcan be removed is strongly influenced by the distancebetween the location of the rattan and the location of thefarmer’s residence, the geographic makeup of the area(topography) and the population of favorite rattan present.The number of days required by rattan farmers to harvestand collect rattan year to year is dependent on the timerequired to travel between the forests and residences.

The ability of rattan farmers to bring a number ofrattans each time to forest decreases. In the time category 8to 10 years, rattan farmers are able to collect 80 or morekgs of rattan. This trend decreases with time; in the timecategory less than eight years, rattan farmers are only ableto collect between 61-80 kgs. These results exhibit thedecreasing trend in the amount of rattan that is able to beharvested and collected from year to year. The variableslargely responsible for this trend include the distancebetween the farmer’s home and the location of rattan, thelevel geographic difficulty (topography), and thepopulation of favorite rattan species.

According to Duran (2001), rattan farmers possessspecific selection methods for rattan. They apply criteriaspecified by merchant. These criteria generally include thevision of morphology of the rattan and its type. Additionalcriterion applied include the rattan species, level of barmaturity, bar length, bar diameter, other bar color and othercriterion, usual of vision of bar like path depth or bar shine.However, these criteria hardly influence the price of rattanat the rattan farmer level.

Common rattan species taken by rattan farmer in theKulawi District include species of rotan batang (Calamuszollingeri Becc.), rotan lambang (Calamus ornatus var.celebicus Blume ex Schult.f.), rotan tohiti (Calamus inopsBecc.) and rotan noko (Daemonorops robusta Warb.). Theselection of rattan species is based on those found in thebuffer zone of Lore Lindu National Park. When comparedto other species of rattan, those found in LLNP receive ahigh price at market. The harvesting and collection ofrattan from the forest is generally done by groups of rattanfarmers, although some individuals collect on their own.Groups of rattan farmers divide their sales revenue amongall group members, while individual formation accompanyone another into the forest, but undertake and manage theirown harvesting separately (Sinaga 1986).

Factors, time, and costCosts borne by rattan farmers include those associated

with equipment, the cost of living and others. The level ofcost bourn by each rattan farmer varies and usuallyincreases time to time. Variations in cost may be caused bythe duration of time spent residing in the field collectingrattan, and increases to everyday living cost; meanwhile,the price of rattan does not increase significantly. Duringthe last eight to ten years the price of rattan has beenestimated at Rp. 10.000 to Rp. 20.000. At the time ofresearch, the price of rattan was estimated at between Rp.50.000 to Rp. 100.000.

The selling price of rattan varies, although it is hardlydependent on rattan criterion from in forest (MoC 2001).

When all rattan criterion are met, the seller shall receive themaximum price for their product; however, is somecriterion are not met, the price of the rattan will decreaseaccording to the number of criterion left unfulfilled. Thehighest selling prices are received for C. zollingeri, C.ornatus and C. inops. Rattan selling prices from yearexperiences improvement, but doesn't give improvement ofincome significant because the operating expenses alsoincrease.

According to INBAR (1999), the level of incomegenerated by each rattan farmer varies. That is highlydependent on the amount collected and the rattan speciesitself. The value of rattan collected six to ten years ago washigh when compared to the average income at the time;however, the current value of rattan is lower whencompared with the current average income. Thisexemplifies the general trend of decreasing earnings seenannually. This trend is caused especially by the quantity ofrattan harvested and collected. The selling price of rattanhas not increased to the same degree as the increasing costsassociated with harvesting and collecting rattan.

Conservation aspect of rattanAccording to MoF (2006), the harvesting and collection

of rattan requires a permit from government through theRegency Forestry Department. Permits may be issued to (i)individuals with optimum 100 tons, and (ii) co-operationswith optimum 500 tons.

Legal permits given directly to co-operations andindividuals only applied by 33 rattan farmer, while theother is form of legal permit that wrong opening of targetbecause it was given to big merchant generally resides inPalu city. The permit owner looks for extension of hand incountryside to use their permit, with a note of resultobtained from forest must be sold to the permit owner. As aresult the price of at farmer level often made a fool bypermit owner so that rattan farmer gets a minimum realadvantage. Rattan permits should be government regulated,which would enable direct representation and protection ofthe farmer’s rights and allow for easier access to individualpermits.

Based on provisions accompanying the issuance ofpermits for rattan, whether they are for co-operation or forindividual, all permit holders are obliged to undertake someof conservation activity, especially replanting of rattan(MoF 2002). In reality, rattan farmers do not always followthis rule, especially if a rattan farmer is only using thepermit from merchant. This demonstrates a lack ofattention from merchant and rattan farmer about theimportance of rattan conservation.

Technical knowledge and skill of rattan, especiallyrattan farmer about rattan conservation is low. Rattanfarmers generally have never heard about rattanconservation; only a small schema of rattan farmers hasever heard about rattan conservation concepts. Althoughthere is ample space, conservation practices traditionallyhave not been undertaken. Referring to the condition,required training about rattan conservation technique forrattan farmer (Siebert 1991).


Information about terms or concepts associated withrattan conservation was obtained from various informants.Rattan farmers whom have heard terms or conservationconcepts of rattan are obtained especially fromnongovernmental organization (NGO), Ministry ofForestry, rangers of LLNP and researchers/high education.A lack of information received by rattan farmer proves thatthere is still a weak socialization process of rattanconservation concepts, especially in anticipating theapplication of commerce certification result of forestcultivation, including result of forest in form non timberforest products such as rattan. This is also one of the rootcauses for the decline in population and production offavorite rattan species.

The population and production of rattan decline everyyear. Some of the root causes responsible for this trendinclude: a lack of conservation effort by rattan farmer andgovernment, and the slow rate at which rattan grows(Unhas 1996). The reason for a lack of conservation effortsmay be attributed to the lack of socialization andknowledge about rattan conservation. Generally rattanfarmer cannot undertake conservation effort for rattanbecause they simple do not know how to do it.Additionally, there is a lack of willingness and time toundertake conservation activities. There is a great need fora revitalization of efforts to generate awareness of theimportance of rattan conservation and activities.

There are many actions that can be taken to maintainrattan productivity. In the long term, conservationprocesses can involve many local individuals. While in theshort term, rattan farmers shall apply collection principlesof rattan selective harvesting and wise use. To execute theeffort, is the involvement of government and allstakeholders associated with rattan commerce is critical.

According to Barkmann et al. (2004), rattan conser-vation that can be undertaken by rattan farmer themselves,include the nursery bed process and cultivation, seedlingsplit and cultivation (seedling scarce). This can be done ifrattan farmer is supplied with adequate knowledge andskills about the rattan cultivated process. By embarking onthe conservation process, rattan farmers will receivevarious benefits in return.

The results of the final observations and discussionsduring the PRA and FGD processes form the basis of theconservation activities that can be done by the rattan farmer(seedling split and seedling cultivation). These wereselected for several reasons, namely: (i) easier to be done,(ii) time required to complete the activity is relative brief,(iii) the level of viability is high, (iv) easier to collectspecimens from the forest than from matured fruit, and (v)the care process is relatively easier.

Based on the reasons mentioned before, it can beexplained that if form of the conservation developed byrattan farmer is through seedling split and the cultivation,need to pay attention: (i) Seed which spitted must beknown the type surely and prerequisite of good seedconditions, (ii) In doing split should not destroy the mainscrop, (iii) Seedling care done to be continual andperiodical.

The conservation process itself can be insufficient,especially if it will be done in bigger number. Inconsequence, thought needs to be put into thediversification of conservation processes besides split andseed cultivation. Processes that are more accurate may beaccomplished through the use of nursery beds andcultivation of seed Astuti et al. (2001). Therefore, rattanfarmers shall step by step do nursery bed process from seed(rattan seed) and next step is planting safely and keepingwell based on conservation method of rattan.

Besides the processes recommended above, rattanfarmers also need to carry out strategic steps in the form ofattitude and wise behavior concerning the harvesting andcollection of rattan. One of the most important actions to befollowed by rattan farmers is to not take rattan that isflowering or is bearing fruit. The attitude like this willguarantee sustainability of produce of rattan, especiallyrattan type having barred unique.

There are various obtainable benefits by rattan farmer,especially about defensible rattan productivity on anongoing basis. If defensible rattan productivity on anongoing basis, hence earnings rattan farmer can beimproved and in the end can increase prosperity rattanfarmer. To support the need to maintain rattan productivity,the role of government is required. The Government isexpected to regulate actively in so many thing, especially inthe case of execution of rattan conservation on an ongoingbasis, of rattan commercial system and prohibition of rawrattan export. This arrangement is very importance becausethe government has the power and resources to adequatelydevelop efforts relating to conservation and rattancommercial arrangements.

Stands at conservation effort which can be done byrattan farmer, the government shall thought of correctstrategic steps of which can support rattan conservationeffort to base-community. One strategic step that must beundertaken is to give amenity to obtain area concession ofrattan conservation and incentive to rattan farmers toconservation rattan.

Based on the results of problems synthesized during thePRA and FGD activities, it was identified that someproblems that require solutions: (i) problem of land supplyand preparation, (ii) land permission, (iii) rattan gardensecurity, (iv) cost of maintenance, (v) education, (vi)traditional forest and community forest, and (vii) therelationship of with Lore Lindu National Park

CONCLUSION AND RECOMMENDATION

Based on the analysis of result and discussions of thisresearch, several conclusions have been made: (i) The totaleconomic value of rattan management to finite at rattanfarmer level is Rp. 100.000 to Rp.150.000. This numberconsists of a nature value of Rp. 50.000 to Rp. 100.000,and an added value (income) for rattan farmer of Rp.25.000 to Rp. 50.000; (ii) The level of earnings by rattanfarmers from year to year is increasing quantitatively, butfrom the angle of value it doesn't increase; (iii) Thecommunity, especially rattan farmers, assess conservation

HAMZARI – Rattan conservation in Lore Lindu National Park 245

efforts for rattan as a positive effort and need to be sup-ported to undertake conservation activities. In consequence,they have a mind to carry out conservation efforts for rattanfor improving rattan productivity on an ongoing basis; (iv)There are a number of forms of rattan conservation whichcan be developed by the community; particularly rattanfarmers may carry out nursery and cultivation, carry outseedling split (thinning) and cultivation, and take rattanselectively and wise; (v) Conservation model which can bedeveloped by community, especially rattan farmer isconstructing a collaboration in the form of group of rattanfarmer and conduct conservation through traditional forestand social forest approaches; (vi) The conservation modelwhich has been employed by rattan farmer as result fromthis establishment process and research is processing splitand cultivation of seed.

Based on the conclusions formulated above, it isrecommended that although rattan farmers have chosen theconservation techniques of split and cultivation of seeddeveloped during research, with consideration of amenityof the execution, but for the sake of larger ones, itrecommended that rattan farmer can develop step by stepand sustainability of conservation process through thenursery technique and cultivation of seed. In conclusion,the involvement of all stakeholders involved in thecommerce of rattan, especially the government, is criticalso that rattan conservation can be done systematically andsustainable.

REFERENCES

Alrasyid H (1980) Rattan planting guidelines. Forest Research Institute.Bogor. [Indonesia]

Astuti S, Sandara R, Bachrun Z (2001) Quality test and cultivation ofsome species of rattan in order to improve community in come in thevicinity of Kerinci Seblat National Park Bengkulu. Taman NasionalKerinci Seblat. Bengkulu. [Indonesia]

Bennett C, Barichello R (2006) Value-added and resource managementpolicies for Indonesian rattan. Forest Products and Forestry Social-Economics Research and Development Centre, Forestry Research andDevelopment Agency. Bogor, Indonesia.

MoC [Ministry of Commerce] (2001) Potential rattan supplay in CentralSulawesi. Regional Office of the Department of Commerce CentralSulawesi. Palu. [Indonesia]

MoF [Ministry of Forestry] (2002) Guidelines for development of rattancultivation. Directorate General of Forest Utilization, Department ofForestry R.I. [Indonesia]

MoF [Ministry of Forestry] (2006) Prospect of rattan cultivation inSulawesi: A case study of South Sulawesi and Central Sulawesiprovinces. Agency for Forestry Research and Development,Department of Forestry and the Faculty of Agriculture and Forestry,Hasanuddin University. Makassar. [Indonesia]

Dominic M, Camille B (2001) The valuation of biological diversity forNational Biodiversity Action Plans and Strategies. A guide fortrainers. United Nations Environment Programs (UNEP). New York.

Duran P (2001) Collaborative development-oriented research onconservation of rattan biodiversity in Malaysia. NWFPs; Social,Economic and Cultural Dimensions: 323-326.

INBAR [International Network for Bamboo and Rattan] (1999) Socio-economic issues and constraints in the bamboo and rattan sectors:INBAR's assessment. INBAR Working Paper No. 23. Multiplexus.New Delhi, India.

Januminro (2002) Indonesian rattan. Kanisius. Yogyakarta. [Indonesia]Barkmann J, Glenk K, Marggraf R (2004) Biological diversity at the

rainforest margin as an economic good. 17th Annual Meeting of theSociety for Tropical Ecology “Biodiversity and Dynamics in TropicalEcosystems”, 18.-20. Februar 2004, University of Bayreuth,Bayreuth.

Nasendi BD (1995) Development of rattan cultivation: constraints,challenges and expectation. Agency for Forestry Research andDevelopment, Department of Forestry RI. Jakarta. [Indonesia]

Rachman O, Supriadi A (2001) Processing of rattan after harvesting.Prosea Indonesia. Bogor. [Indonesia]

Renuka C (2004) Genetic diversity and conservation of rattans. Bambooand Rattan Genetic Resources and Use. IPGRI – INBAR Pub.Serdang, Malaysia.

Siebert SF (1991) Forest management. Rattan for forest conservation anddevelopment: ecological studies of Calamus exilis in Kerinci-Seblatnational park, Indonesia. La foret, patrimoine de l'avenir, Paris(France), 17-26 September 1991.

Sinaga VM (1986) Pattern of development of rattan cultivation.Proceeding of National Workshop on Rattan. Jakarta, 15-16December 1986. [Indonesia]

Supriadi A, Martono D, Puspitodjati T, Rachman O (2002) Technical andeconomical analysis of rattan processing. Bul Penel Hasil Hutan 20(2): 127-141. [Indonesia]

Tellu AT (2006) Inventory of potential and pattern distribution of therattan species in Lore Lindu Protected Forest. Research Institute ofTadulako University. Palu [Indonesia]

Unhas [Hasanuddin University] (1996) Prospects cultivation of rattan inSulawesi: a case study of South Sulawesi and Central Sulawesiprovinces. In: Nasendi BD, Masud AF (eds) Assessment of local andnational issues of forests and forestry in Indonesia: a review ofprospects and strategies towards forest management and sustainableforestry development. Research and Development Agency ofForestry, Ministry of Forestry, R.I., Jakarta.

THIS PAGE INTENTIONALLY LEFT BLANK

A-1

Authors Index

Adjie B 7 Alikodra HS 99 Amarantini C 1 Ammar MSA 92 Arisoesilaningsih E 45 Asmara W 1 Budiharta S 22, 225 Cramer V 86 Djuuna IAF 198 Erniwati 76 Fardila D 212 Faturrahman 192 Fegan M 12 Hadiwiyono 12 Hamzari 241 Harahap IS 235 Hartini S 204 Helmiati S 34 Hernawati H 187 Hernowo JB 99 Hobbs R 86 Indriyani S 45 Ingole SN 146 Jamaluddin 107 Junior MZ 192 Kurniawan A 7 Kushadiwijaya H 1 Kusmana C 99 Lestari DA 28 Mansyah E 59 Mardiastuti A 99 Masora M 198 Meryandini A 192 Mumu MI 171 Mutaqien Z 218 Peristiwady T 136 Poerwanto R 59 Praptosuwiryo TN 204 Prasetyo D 164 Pribadi DO 204 Pribadi T 235 Puradyatmika P 198 Purnobasuki H 45

Puspitaningtyas DM 204 Putranto HD 131 Putri LSE 212 Raffiudin R 235 Riyanto A 38 Roesma DI 141 Rusiyantono Y 171 Rusmana I 192 Saharjo BH 182 Santosa E 59 Santoso P 141 Santoso S 187 Santoso W 28 Sembiring L 1 Setyawan AD 112 Setyobudi E 34 Shahabuddin 177 Sinaga S 59 Singh AK 107 Siregar IZ 64 Sobir 59 Soeparno 34 Sofiah S 229 Subandiyah S 12 Sugardjito J 164 Susanti R 70 Sutomo 86, 212 Syamsuwida D 64 Tanari M 171 Tapa-Darma IGK 64 Ubaidillah R 76 Wardiyati T 45 Wibawa IPAH 7 Widada J 12 Widawati S 17 Wijayanto N 52, 64 Wiyono S 187 Yulia ND 22, 225 Yulianti 64 Yulistyarini T 225, 229 Yulita KS 125 Zuhri M 218

A-2

Subject Index

16S rRNA gene sequences 1, 2, 6 actinomycetes 198, 199, 200, 201, 202, 203 Aeromonas 192, 194, 197 agarase 192, 193, 194, 195, 196, 197 agar-liquefying 192, 197 agroforestry system 52, 55, 57, 58, 67, 69, 177, 178,

181, 234 Alas Purwo 99, 101, 105, 106 Amorphophallus paeoniifolius 7, 8, 9, 10, 11 amphibians 38, 39, 40, 41, 44 Amravati 146, 147, 155 Anisakis sp 34, 35, 36, 37 Anthiinae 136, 140 anthropogenic forest 292, 231, 233 Aphis gossypii 187, 188, 189, 190, 191 arbuscular mycorrhizal fungi (AMF)

107, 108, 109, 110

Baluran 99, 100, 102, 106 banana skipper 76, 77, 85, banana 12, 15, 16, 39, 62, 76, 77, 82,

85, 130, 189 bioindicator 235, 236, 239, 71, 116, 119 biological control 76, 77, 85, 187, 191 biosystematics 85, 112, 113, 120, 122 blood disease bacterium 12, 15, 16 carbon stock 182, 183, 184, 185, 186, 233,

234 catchment area 52, 234, chili 187, 188, 189, 190, 191 chronosequence 86, 89, 90, 91, 213 Cibodas Botanic Garden 218 Cibotium 204, 205, 206, 207, 208, 209,

210, 211 climate 28, 42, 44, 45, 46, 47, 48, 49,

50, 51, 52, 53, 55, 64, 88, 91, 98, 100, 112, 115, 116, 118, 120, 172, 180, 182, 186, 197, 201, 213, 224, 225, 233, 239

coastal ecosystem 17 community based 57, 241, 242 community forest 64, 65, 67, 166, 241, 244 community 1, 38, 40, 42, 44, 51, 52, 53, 54,

55, 57, 58, 64, 65, 66, 67, 68, 86, 88, 90, 91, 92, 97, 98, 107, 110, 116, 119, 121, 123, 165, 166, 167, 168, 171, 177, 179, 180, 181, 208, 210, 213, 214, 215, 216, 217, 220, 221, 224, 235, 236, 237, 238, 239, 241, 242, 244, 245

composition of vegetation 292, 231 conservation 22, 28, 32, 38, 55, 57, 64, 70,

92, 99, 112, 113, 119, 120, 136, 137, 141, 169, 171, 172, 177, 180, 183, 201, 204, 233, 235, 241, 242, 243, 244, 245

coral reefs 92, 93, 94, 97, 98, 140 corm 45, 46, 47, 48, 49, 50, 51 cpDNA 7, 9, 10, 114, 161

daily gain 171, 172, 175 degraded forests 164, 165, 166, 167, 169 distribution 2, 3, 5, 6, 10, 11, 15, 21, 24, 25,

33, 34, 36, 37, 38, 40, 42, 44, 51, 58, 59, 62, 63, 64, 67, 69, 76, 77, 79, 80, 81, 82, 85, 99, 100, 105, 106, 109, 110, 112, 114, 115, 116, 119, 123, 125, 127, 138, 146, 148, 149, 150, 151, 152, 153, 154, 155, 156, 170, 176, 178, 198, 199, 200, 201, 202, 203, 204, 205, 207, 208, 209, 210, 211, 214, 217, 220, 221, 224, 227, 228, 234, 239, 245

disturbance 38, 86, 87, 88, 89, 107, 165, 166, 167, 177, 180, 198, 212, 213, 220, 222, 223, 225, 227, 235, 236, 237, 238, 239

diversity 1, 3, 4, 6, 7, 8, 9, 10, 12, 13, 15, 16, 17, 21, 22, 23, 24, 25, 27, 31, 33, 38, 39, 40, 42, 44, 52, 53, 56, 57, 58, 59, 61, 62, 63, 64, 67, 68, 69, 70, 71, 72, 75, 86, 87, 88, 91, 92, 93, 94, 95, 96, 97, 98, 107, 109, 110, 111, 112, 113, 114, 115, 117, 118, 119, 120, 121, 125, 127, 130, 141, 144, 145, 146, 156, 162, 177, 178, 179, 180, 181, 187, 189, 191, 198, 203, 206, 217, 218, 219, 223, 224, 225, 227, 228, 229, 231, 232, 233, 234, 235, 236, 238, 239, 240, 245

duku 125, 126, 127, 128, 129, 130 dung beetles 177, 178, 179, 180, 181, 240 ecology 12, 92, 113, 115, 119, 148, 149,

150, 151, 152, 153, 154, 155, 156, 204, 205

ecosystem function 55, 177, 178, 179, 180, 181, 185, 198, 233

Egypt 92, 93, 94, 97, 98 emission 182, 183, 185, 186, 197, 233 environment 12, 13, 15, 18, 23, 24, 25, 30,

31, 32, 38, 39, 45, 46, 50, 52, 55, 56, 57, 70, 71, 86, 88, 89, 94, 109, 110, 115, 116, 117, 118, 119, 120, 141, 144, 161, 172, 173, 175, 177, 179, 180, 182, 183, 185, 186, 191, 192, 199, 202, 215, 218, 223, 227, 228, 229, 233, 234, 235, 236, 237, 238, 239

enzyme immunoassay (EIA) 131, 132, 133, 135 epiphytic orchid 22, 23, 24, 25, 27 Erionota thrax 76, 77, 78, 79, 80, 81, 82, 85 ethnobotany 112, 113, 118, 120, 121, 122 explorative 28, 29, facilitation 212, 215, 216

A-3

feces 131, 132, 133, 134, 135 feed conversion 171, 172, 175, 176 female tiger 131, 132, 133, 134 fish 34, 35, 36, 37, 92, 93, 94, 97,

136, 137, 138, 139, 140, 141, 142, 144, 183, 189, 191, 229

Flickingeria angulata 22, 23, 24, 25, 26 fungi 107, 108, 109, 117, 187, 188,

189, 190, 191, 198, 199, 200, 201, 202

Garcinia 59, 61, 62, 63 genetic diversity 6, 10, 12, 13, 15, 16, 59, 61, 63,

64, 67, 69, 70, 71, 72, 75, 120, 125, 127, 130, 191, 218, 245

genetic variation 7, 8, 10, 62, 63, 64, 67, 69, 125, 127, 130, 161, 162

GHG 182, 185 Gracilaria 192, 194, 197 gradient of altitudes 225, 227, 228 Gulf of Aqaba 92, 93, 97, 98 Gunung Ciremai 38, 38, 39, 41, 44 habitat utilization 38, 40, 42, 164 hatching 171, 172, 173, 174, 175, 176 host tree 22, 27, 28, 29, 30, 31, 32, 33,

165, 225, 227, 228, host trees 22, 23, 24, 25, 26, 28, 29, 30,

31, 32, 33, 165, 225, 227, 228 HPLC 117, 121, 131, 132, 133, 135 Hymenoptera 76, 77, 78 identification key 76, 142, 236 Indonesia 1, 7, 8, 9, 11, 12, 14, 15, 17, 24,

28, 34, 36, 37, 38 infection 1, 16, 34, 35, 36, 37, 118 inoculation 107, 110, 188, 12, 21 integrated 52, 56, 57, 76, 85, 92, 98, 162,

180, 217 interaction 13, 15, 50, 55, 92, 108, 172,

178, 179, 180, 212, 213, 215, 216

interspecific association 212, 213, 214, 215, 216, inventory 27, 28, 29, 33, 53, 120, 145,

204, 205, 211, 218, 219, 222, 224, 229, 245

ISSR 59, 60, 61, 62, 63, 130 javan green peafowl 99, 105, 106 Kulon Progo District 34, 35, 36, 37 Lamedai Nature Reserve 28, 29, 30, 31, 32, 33 land use change 53, 177, 182, 186, 229, 231,

233, 235, 139 land use 53, 55, 56, 57, 164, 165, 177,

178, 179, 180, 182, 185, 198, 201, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238

Lansium domesticum 69, 125, 126, 127, 128, 129, 130

leaf endophytic fungi 187, 188, 189 lime stone 107, 108, 109 maleo 171, 172, 173, 174, 175, 176 medicinal plants 112, 118, 120, 146 Melghat 146, 147, 148, 150, 151, 154,

155, 162 Melia azedarach 54, 64, 69 meristic 38, 141, 142 mine spoils 107, 108, 109, 110, 111 mitochondrial DNA 70, 71, 72, 75 model 37, 45, 46, 47, 48, 49, 51, 58,

63, 72, 98, 115, 116, 123, 145,

172, 176, 186, 218, 224, 241, 242, 245

molecular phylogenetic analysis 1 morphometric 70, 138, 141, 142, 172, 173 Mount Lawu 225, 226, 227, 228 Mount Merapi 86, 87, 88, 89, 91, 212, 212,

213, 215, 216 Mount Slamet 235, 236 natural regeneration 107, 108, 109, 110 ND3 gene 70, 71, 72, 73, 75 new record 9, 80, 81, 82, 85, 114, 136, 140,

207 Nusantara 112, 113, 114, 115, 116, 117,

118, 119, 120, 123, 197 Odontanthias unimaculatus 136, 137, 138, 139, 140 oil palm 58, 164, 182, 183, 184, 185,

186 orangutan density 164, 167, 169 orchid diversity 22, 24, 25, 225, 227, 228 orchid 22, 23, 24, 25, 26, 27, 28, 29,

30, 31, 32, 33, 130, 225, 226, 227, 228

Osteochilus hasselti 141, 142, 143, 144, 145 oxalate 17, 20, 45, 46, 47, 48, 49, 50,

51 parasitoids 76, 77, 78, 79, 80, 81, 82, 85 peat 119, 164, 166, 167, 168, 169,

170, 182, 183, 185, 186, 217 permanent plots 86, 218, 219, 222, 223 PFGE 12, 13, 14, 15 phosphate solubilization 17, 19, 21 pioneer 7, 55, 88, 110, 208, 212, 214,

215, 216, 220 plant establishment 86, 89, 91, 212 Ploceidae 70, 71, 72, 73, 74 Pongo pygmaeus wurmbii 164, 169 population 13, 15, 17, 18, 19, 20, 21, 22,

31, 35, 37, 38, 39, 52, 57, 59, 62, 64, 65, 67, 68, 69, 70, 71, 72, 76, 85, 93, 97, 98, 99, 103, 104, 105, 106, 107, 108, 110, 113, 117, 120, 127, 130, 131, 141, 142, 143, 144, 145, 161, 164, 165, 167, 169, 170, 171, 177, 178, 179, 180, 187, 188, 189, 190, 191, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 209, 210, 211, 224, 234, 241, 243, 244, 245,

porang 45, 46, 47, 48, 50, 51 primary succession 86, 88, 89, 91, 212, 214, 215,

216, 217 Pseudomonas fluorescens 17, 20, 21 RAPD 15, 60, 62, 63, 64, 65, 68, 69,

117, 122, 125, 127, 128, 129, 130, 191

rattan 178, 241, 242, 243, 244, 245 Red Sea 92, 93, 97, 98 remnant forest 218, 219, 220, 221, 222, 223 reproductive status 131, 132, 135 reptiles 38, 39, 40, 41, 44 Salmonella typhi 1, 2, 3, 4, 5, 6 Selaginella 86, 112, 113, 114, 115, 116,

117, 118, 119, 120, 1121, 122, 123, 124, 208, 209

sequential 38, 42, 44, 47, 52, 55, 57 Serranidae 136, 140

A-4

Serratia marcencens 17 smartPLS 45, 46, 47, 51 soil bacteria 198, 199 soil 12, 16, 17, 18, 19, 20, 28, 45,

46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 64, 69, 71, 88, 89, 91, 100, 107, 108, 109, 110, 111, 112, 115, 116, 118, 119, 120, 156, 171, 177, 178, 179, 181, 182, 183, 184, 185, 186, 188, 182, 198, 199, 200, 201, 202, 203, 204, 206, 207, 208, 209, 211, 215, 217, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239

southern coast 34, 35, 36, 37 southern part 27, 38, 225, 227, 228 strains 1, 2, 3, 4, 5, 6, 13, 15, 16, 17,

130, 192, 193 Sulawesi 7, 9, 12, 14, 15, 28, 29, 30, 31,

32, 33, 59, 81, 112, 114, 116,

136, 137, 138, 139, 140, 141, 171, 172, 177, 178, 180, 241,

Sumatra 52, 53, 59, 60, 62, 76, 77, 80, 81, 82, 112, 114, 118, 125, 126, 127, 129, 131, 133, 141, 142, 204, 177, 182, 204, 205, 206, 207, 208, 209, 210, 211, 212, 238

sustainability 28, 55, 56, 57, 110, 112, 113, 119, 120, 241, 144, 145

tailing deposition 198, 199, 201 taxonomy 39, 136, 239 termite community 235, 236, 237, 238, 239 tree fern 115, 204 tree species 25, 31, 57, 108, 165, 166, 167,

218, 219, 220, 222, 223, 225, 226, 228, 292, 231, 233

typhoid fever 1, 6 Verbenaceae 31, 146, 147, 156, 158, 161,

162 Wilis Mountain 22, 23, 25

A-5

List of Peer Reviewers

Aamir Ali University of Sargodha, Sargodha, Pakistan Joko Ridho Witono Center for Plant Conservation, Bogor Botanical Garden, Indonesian Institute of Science, Bogor,

West Java, Indonesia Agung Budiharjo Sebelas Maret University, Surakarta, Central Java, Indonesia Ahmad Dwi Setyawan Sebelas Maret University, Surakarta, Central Java, Indonesia Alan J. Lymbery Murdoch University, Murdoch, Australia Alison Styring The Evergreen State College, Olympia, Washington, USA Alka Grover Central Potato Research Institute, India Andre Pascal Koch Zoologisches Forschungsmuseum A. Koenig, denauerallee 160, 53113 Bonn, Germany Anil Kumar Gupta Indian Institute of Technology, Kharagpur, West Bengal, India Anita S. Tjakradidjaja Bogor Agricultural University, Bogor, Indonesia Ari Pitoyo Sebelas Maret University, Surakarta, Central Java, Indonesia Artini Pangastuti Sebelas Maret University, Surakarta, Central Java, Indonesia Bambang Hero Saharjo Bogor Agricultural University, Bogor, West Java, Indonesia Barahima Abbas State University of Papua, Manokwari, West Papua, Indonesia Bayu Ajie Bali Botanic Garden, Indonesian Institute of Science, Tabanan, Bali, Indonesia Bhoj Kumar Acharya Sikkim Government College, Tadong, Sikkim, India Carolina Martínez Ruiz Universidad de Valladolid, Madrid, Spain Charis Amarantini Duta Wacana Christian University, Yogyakarta, Indonesia Charlie D. Heatubun State University of Papua, Manokwari, Indonesia Chuan, Chao Dai College of Life Science, Nanjing Normal University, Nanjing, PR China Diah Sulistiarini Research Center for Biology, Indonesia Institute of Science, Cibinong, Bogor, West Java, Indonesia Dörte Goertz University of Natural Resources and Applied Life Sciences (BOKU), Vienna, Ostereich Dwi Murti Puspitaningtyas Center for Plant Conservation, Bogor Botanic Garden, Bogor, West Java, Indonesia. Edi Rudi Syiah Kuala University, Banda Aceh, Aceh Darussalam, Indonesia Ender Makineci Istanbul University, Istanbul, Turkey Evy Arida Research Center for Biology, Indonesian Institute of Science, Cibinong, Bogor, West Java,

Indonesia Faisal Anwar Ali Khan Texas Tech University, Lubbock, TX, USA Fasheng Zou South China Institute of Endangered Animals, Guangzhou PR China Fetrina Oktavia Indonesian Rubber Research Institute, Palembang, Indonesia Freddy Pattiselanno State University of Papua, Manokwari, West Papua, Indonesia Frederick H. Sheldon LSU Museum of Natural Science, LA, USA Gesine Bradacs University of Zurich, Zurich, Switzerland Gilliah Dean University of British Columbia, Vancouver, Canada Gonzalo J. Marquez Univercidad Nacional de La Plata (UNLP), La Plata, Argentina Gratiana E. Wijayanti University of General Soedirman, Purwokerto, Central Java, Indonesia Gregory R. Goldsmith University of California Berkeley, Berkeley, California, USA Guanjun Chen Shandong University, Jinan, P.R. China Gunanidhi Sahoo North Orissa University, Baripada, Orissa, India Gustavo Santoyo Universidad Michoacana de San Nicolas de Hidalgo, Morelia, Michoacan, Mexico Hassan Sher University of Swat, Pakistan Heri Dwi Putranto University of Bengkulu, Bengkulu, Indonesia Hety Herawati Center for International Forestry Research, Bogor, Indonesia Himmah Rustiami Research Center for Biology, Indonesia Institute of Science, Cibinong, Bogor, West Java, Indonesia I. Usha Rao University of Delhi, Delhi, India Intan Ahmad Bandung Institute of Technology, Bandung, West Java, Indonesia.

A-6

Irina V. Zenkova Institute of the North Ecological Problems, Kola Science Centre, Russian Academy of Sciences, Murmansk Region, Russia

Galina Evdokimova Institute of the North Ecological Problems, Kola Science Centre, Russian Academy of Sciences, Murmansk Region, Russia

Iwan Suyatna Mulawarman University, Samarinda, East Kalimantan, Indonesia John Robert Stephen Tabuti Makerere University, Kampala, Uganda Joshua Eli Cinner James Cook University, Townsville, QLD, Australia Juan Carlos Loaiza Usuga University National of Colombia, Bogota, Colombia Kamal Prasat Acharya University of Bergen, Norway Katja Rex Leibniz Institute for Zoo and Wildlife Research, Berlin, Germany Khalid Ali Khalid Ahmed Egyptian National Research Centre, Dokki, Cairo, Egypt Konstans Wells University of Ulm, Ulm, Germany Kusumadewi Sri Yulita Research Center for Biology, Indonesia Institute of Science, Cibinong, Bogor, West Java, Indonesia Leellen Solter University of Illinois, Urbana, IL, USA Livia Wanntorp Department of Phanerogamic Botany, Swedish Museum of Natural History, Stockholm, Sweden Luciana Ferraro Istituto per l'Ambiente Marino Costiero-CNR, Napoli, Italy M. Ja’far Luthfi Islamic State University of Sunan Kalijaga, Yogyakarta, Indonesia M. Suresh Gandhi University of Madras, Chennai , India Made Hesti Lestari Tata ICRAF Southeast Asia Regional Office, Bogor, West Java, Indonesia Mahendra Kumar Rai SGB Amravati University, Amravati, India Marilyn S. Combalicer Nueva Vizcaya State University, Bayombong, The Philippines. Mark S. Goettel Lethbridge Research Centre, Agriculture and Agri-Food Canada, Alberta, Canada Matthew G. Betts Oregon State University, Corvallis, OR, USA Mochamad Arief Soendjoto Lambung Mangkurat University, Banjarbaru, South Kalimantan, Indonesia Monali Goswami FM University, Baleswar, Orissa, India Narender Singh Kurukshetra University, Haryana, India. Novri Nelly Andalas University, Padang, West Sumatra, , Indonesia Ondrej Mudrak Academy of Sciences of the Czech Republic, Trebon, Czech Republic Peter M. Smooker RMIT University, Bundoora, Victoria, Australia Phyllis A.W. Martin USDA/ARS Invasive Insect Biocontrol and Behavior Laboratory, Beltsville, MD, USA Pious Thomas Indian Institute of Horticultural Research, Bangalore, India Prafulla Soni Indian Forest Research Institute, Dehradun, India. Prasit Wangpakapattanawong Chiang Mai University, Chiang Mai, Thailand Pudji Widodo General Soedirman University, Purwokerto, Indonesia Rafael L. de Assis Norwegian University of Life Sciences, Ås, Norway Rainer W. Bussmann Missouri Botanical Garden, St. Louis, MO , USA, Renata Szarek Japan Agency for Marine-Earth Science and Technology (JAMSTEC), Tokyo, Japan René Dommain University of Greifswald, Greifswald, Germany Ristiyanti M. Marwoto Research Center for Biology, Indonesia Institute of Science, Cibinong, Bogor, West Java, Indonesia Roberto Rizzo University of Trieste, Trieste, Italy Rony Irawanto Purwodadi Botanical Garden, Indonesian Institute of Science, Pasuruan, East Java, Indonesia Ruiting Lan University of New South Wales, Sydney, NSW, Australia Ruparao T. Gahukar Arag Biotech Pvt. Ltd., Nagpur, India. Samantha M. Berdej Wilfrid Laurier University, Waterloo, Ontario, Canada Sancia E.T. van der Meij Netherlands Centre for Biodiversity Naturalis, Leiden, The Netherlands Sandra M. Carmello, Guerreiro State University of Campinas, Campinas, SP, Brazil Sanha Kim Seoul National University, Seoul, Korea Sanjog T. Thul Central Institute of Medicinal and Aromatic Plants (CIMAP-CSIR), Lucknow, India Sankar Harish Tamil Nadu Agricultural University, Tamil Nadu, India Santiago Martin, Bravo Pablo de Olavide University, Sevilla, Spain Shahabuddin Tadulako University, Tondo, Palu, Central Sulawesi, Indonesia Socrates Trujillo US Food and Drug Administration, College Park, MD, USA Sugeng Budiharta Purwodadi Botanic Garden, Indonesian Institute of Science, Pasuruan, Indonesia

A-7

Sugiyarto Sebelas Maret University, Surakarta, Central Java, Indonesia Supachitra Chadchawan Chulalongkorn University, Bangkok, Thailand Sutarno Sebelas Maret University, Surakarta, Central Java, Indonesia Sutomo Bali Botanic Garden, Indonesian Institute of Science, Tabanan, Bali, Indonesia Suwarno University of Syiah Kuala, Banda Aceh, Aceh, Indonesia T. Alief Aththorick North Sumatra University, Medan, North Sumatra, Indonesia Taher Ghadirian Plan for the Land Society, Tehran, Iran Tati Suryati Syamsudin Bandung Institute of Technology, Bandung, Indonesia Thamasak Yeemin Ramkhamhaeng University, Bangkok, Thailand Vaclav Mahelka Academy of Sciences of the Czech Republic, Trebon, Czech Republic Xiuyun Zhao Huazhong Agricultural University, Wuhan, Hubei, PR China Yelda Ozden, Tokatli Gebze Institute of Technology, Kocaeli, Turkey Yohanes Y. Rahawarin State University of Papua, Manokwari, West Papua, Indonesia Yulianti Research Institute for Forest Tree Seed Technology, Forest Research and Development Agency,

Ministry of Forestry, Bogor, West Java, Indonesia Z.A. Muchlisin Syiah Kuala University, Banda Aceh, Indonesia Zbynek Polesny Czech University of Life Sciences, Prague, Czech Republic Zulfahmi State Islamic University of Sultan Syarif Kasim Riau, Pekanbaru, Riau

A-8

Table of Contents

Vol. 12, No. 1, Pp. 1-58, January 2011

GENETIC DIVERSTY

Identification and characterization of Salmonella typhi isolates from Southwest Sumba District, East Nusa Tenggara based on 16S rRNA gene sequences CHARIS AMARANTINI, LANGKAH SEMBIRING, HARIPURNOMO KUSHADIWIJAYA, WIDYA ASMARA

1-6

Species diversity of Amorphophallus (Araceae) in Bali and Lombok with attention to genetic study in A. paeoniifolius (Dennst.) Nicolson AGUNG KURNIAWAN, I PUTU AGUS HENDRA WIBAWA, BAYU ADJIE

7-11

Pulsed Field Gel Electrophoresis (PFGE): a DNA finger printing technique to study the genetic diversity of blood disease bacterium of banana HADIWIYONO, JAKA WIDADA, SITI SUBANDIYAH, MARK FEGAN

12-16

ECOSYSTEM DIVERSTY

Diversity and phosphate solubilization by bacteria isolated from Laki Island coastal ecosystem SRI WIDAWATI

17-21

Epiphytic orchids and host trees diversity at Gunung Manyutan Forest Reserve, Wilis Mountain, Ponorogo, East Java NINA DWI YULIA, SUGENG BUDIHARTA

22-27

Inventory and habitat study of orchids species in Lamedai Nature Reserve, Kolaka, Southeast Sulawesi DEWI AYU LESTARI, WIDJI SANTOSO

28-33

Infection of Anisakis sp. larvae in some marine fishes from the southern coast of Kulon Progo, Yogyakarta EKO SETYOBUDI, SOEPARNO, SENNY HELMIATI

34-37

Herpetofaunal community structure and habitat associations in Gunung Ciremai National Park, West Java, Indonesia AWAL RIYANTO

38-44

A model of relationship between climate and soil factors related to oxalate content in porang (Amorphophallus muelleri Blume) corm SERAFINAH INDRIYANI, ENDANG ARISOESILANINGSIH, TATIK WARDIYATI, HERY PURNOBASUKI

45-51

ETHNOBIOLOGY (CULTURAL DIVERSITY)

Species identification and selection to develop agroforestry at Lake Toba Catchment Area (LTCA) NURHENI WIJAYANTO

52-58

Vol. 12, No. 2, Pp. 59-124, April 2011

GENETIC DIVERSTY

Genetic variability in apomictic mangosteen (Garcinia mangostana) and its close relatives (Garcinia spp.) based on ISSR markers SOBIR, ROEDHY POERWANTO, EDY SANTOSA, SOALOON SINAGA, ELINA MANSYAH

59-63

Genetic variation of Melia azedarach in community forests of West Java assessed by RAPD YULIANTI, ISKANDAR ZULKARNAEN SIREGAR, NURHENI WIJAYANTO, IGK TAPA DARMA, DIDA SYAMSUWIDA

64-69

Polymorphic sequence in the ND3 region of Java endemic Ploceidae birds mitochondrial DNA R. SUSANTI

70-75

SPECIES DIVERSTY

Hymenopteran parasitoids associated with the banana, skipper Erionota thrax L. (Insecta: Lepidoptera, Hesperiidae) in Java, Indonesia ERNIWATI, ROSICHON UBAIDILLAH

76-85

A-9

ECOSYSTEM DIVERSTY

Plant community establishment on the volcanic deposits following the 2006 nuées ardentes (pyroclastic flows) of Mount Merapi: diversity and floristic variation SUTOMO, RICHARD HOBBS, VIKI CRAMER

86-91

Coral diversity indices along the Gulf of Aqaba and Ras Mohammed, Red Sea, Egypt MOHAMMED SHOKRY AHMED AMMAR

92-98

Population analysis of the javan green peafowl (Pavo muticus muticus Linnaeus 1758) in Baluran and Alas Purwo National Parks, East Java JARWADI BUDI HERNOWO, HADI SUKARDI ALIKODRA, ANI MARDIASTUTI, CECEP KUSMANA

99-106

Status and diversity of arbuscular mycorrhizal fungi and its role in natural regeneration on limestone mined spoils ANUJ KUMAR SINGH, JAMALUDDIN

107-111

REVIEW

Review: Recent status of Selaginella (Selaginellaceae) research in Nusantara AHMAD DWI SETYAWAN

112-124

Vol. 12, No. 3, Pp. 125-186, July 2011

GENETIC DIVERSTY

Genetic variations of Lansium domesticum Corr. accessions from Java, Sumatra and Ceram based on Random Amplified Polymorphic DNA fingerprints KUSUMADEWI SRI YULITA

125-130

A non, invasive identification of hormone metabolites, gonadal event and reproductive status of captive female tigers HERI DWI PUTRANTO

131-135

SPECIES DIVERSTY

First record of Odontanthias unimaculatus (Tanaka 1917) (Perciformes: Serranidae) from Indonesia TEGUH PERISTIWADY

136-140

Morphological divergences among three sympatric populations of Silver Sharkminnow (Cyprinidae: Osteochilus hasseltii C.V.) in West Sumatra DEWI IMELDA ROESMA, PUTRA SANTOSO

141-145

Diversity and useful products in some Verbenaceous member of Melghat and Amravati regions, Maharashtra, India SHUBHANGI NAGORAO INGOLE

146-163

ECOSYSTEM DIVERSTY

Nest density as determinants for habitat utilizations of Bornean orangutan (Pongo pygmaeus wurmbii) in degraded forests of Gunung Palung National Park, West Kalimantan DIDIK PRASETYO, JITO SUGARDJITO

164-170

Conservation of maleo bird (Macrocephalon maleo) through egg hatching modification and ex situ management YOHAN RUSIYANTONO, MOBIUS TANARI, MUHAMAD ILYAS MUMU

171-176

Effect of land use change on ecosystem function of dung beetles: experimental evidence from Wallacea Region in Sulawesi, Indonesia SHAHABUDDIN

177-181

Carbon baseline as limiting factor in managing environmental sound activities in peatland for reducing greenhouse gas emission BAMBANG HERO SAHARJO

182-186

Vol. 12, No. 4, Pp. 187-245, October 2011

GENETIC DIVERSTY

Leaf endophytic fungi of chili (Capsicum annuum) and their role in the protection against Aphis gossypii (Homoptera: Aphididae) HENY HERNAWATI, SURYO WIYONO, SUGENG SANTOSO

187-191

A-10

Isolation and identification of an agar, liquefying marine bacterium and some properties of its extracellular agarases FATURRAHMAN, ANJA MERYANDINI, MUHAMMAD ZAIRIN JUNIOR, IMAN RUSMANA

192-197

ECOSYSTEM DIVERSTY

Soil microorganisms numbers in the tailing deposition ModADA areas of Freeport Indonesia, Timika, Papua IRNANDA AIKO FIFI DJUUNA, MARIA MASORA, PRATITA PURADYATMIKA

198-203

Inventorying of the tree fern Genus Cibotium of Sumatra: Ecology, population size and distribution in North Sumatra TITIEN NGATINEM PRAPTOSUWIRYO, DIDIT OKTA PRIBADI, DWI MURTI PUSPITANINGTYAS, SRI HARTINI

204-211

Species composition and interspecific association of plants in primary succession of Mount Merapi, Indonesia SUTOMO, DINI FARDILA, LILY SURAYYA EKA PUTRI

212-217

Establishing a long, term permanent plot in remnant forest of Cibodas Botanic Garden, West Java ZAENAL MUTAQIEN, MUSYAROFAH ZUHRI

218-224

Analysis of epiphytic orchid diversity and its host tree at three gradient of altitudes in Mount Lawu, Java NINA DWI YULIA, SUGENG BUDIHARTA, TITUT YULISTYARINI

225-228

Valuing quality of vegetation in recharge area of Seruk Spring, Pesanggrahan Valley, Batu City, East Java TITUT YULISTYARINI, SITI SOFIAH

229-234

Termites community as environmental bioindicators in highlands: a case study in eastern slopes of Mount Slamet, Central Java TEGUH PRIBADI, RIKA RAFFIUDIN, IDHAM SAKTI HARAHAP

235-240

ETHNOBIOLOGY

Community, based sustainable rattan conservation: a case study in Lore Lindu National Park, Central Sulawesi HAMZARI

241-245

GUIDANCE FOR AUTHORS

BIODIVERSITAS, the Journal of Biological Diversity publishes scientific articles, i.e. original research and review in all biodiversity aspects of plants, animals and microbes at the level of gene, species, and ecosystem. Scientific feedback (short communication) is only received for manuscript, which criticize published article before. Manuscripts will be reviewed by managing editor and invited peer review according to their disciplines. The only articles written in English (U.S. English) are accepted for publication. This journal periodically publishes in January, April, July, and October. In order to support reduction of global warming as a consequence of transportation vehicles emission and forest degradation for paper manufacturing, management of the journal prefer receiving manuscripts via e-mail rather than in hard copy. Manuscript and its communications can be addressed to the managing editor; better to forward to one of the communicating editor for accelerating evaluation. A letter of statement expressing that the author (s) is responsible for the original content of manuscript, the result of author(s)’s research and never been published must be attached.

Manuscript is typed at one side of white paper of A4 (210x297 mm2) size, in a single column, double space, 12-point Times New Roman font, with 2 cm distance step aside in all side. Smaller letter size and space can be applied in presenting table. Word processing program or additional software can be used, however, it must be PC compatible and Microsoft Word based. Names of sub-species until phylum should be written in italic, except for italic sentence. Scientific name (genera, species, author), and cultivar or strain should be mentioned completely at the first time mentioning it, especially for taxonomic manuscripts. Name of genera can be shortened after first mentioning, except generating confusion. Name of author can be eliminated after first mentioning. For example, Rhizopus oryzae L. UICC 524, hereinafter can be written as R. oryzae UICC 524. Using trivial name should be avoided, otherwise generating confusion. Mentioning of scientific name completely can be repeated at Materials and Methods. Biochemical and chemical nomenclature should follow the order of IUPAC-IUB, while its translation to Indonesian-English refers to Glossarium Istilah Asing-Indonesia (2006). For DNA sequence, it is better used Courier New font.

Symbols of standard chemical and abbreviation of chemistry name can be applied for common and clear used, for example, completely written butilic hydroxytoluene to be BHT hereinafter. Metric measurement use IS denomination, usage other system should follow the value of equivalent with the denomination of IS first mentioning. Abbreviation set of, like g, mg, mL, etc. do not follow by dot. Minus index (m-2, L-1, h-1) suggested to be used, except in things like “per-plant” or “per-plot”. Equation of mathematics does not always can be written down in one column with text, for that case can be written separately. Number one to ten are expressed with words, except if it relates to measurement, while values above them written in number, except in early sentence. Fraction should be expressed in decimal. In text, it should be used “%” rather than “gratuity”. Avoid expressing idea with complicated sentence and verbiage, and used efficient and effective sentence. Manuscript of original research should be written in no more than 25 pages (including tables and picture), each page contain 700-800 word, or proportional with article in this publication number. Invited review articles will be accommodated.

Title of article should be written in compact, clear, and informative sentence preferably not more than 20 words. Name of author(s) should be completely written. Running title is about five words. Name and institution address should be also completely written with street name and number (location), zip code, telephone number, facsimile number, and e-mail address. Manuscript written by a group, author for correspondence along with address is required. First page of the manuscript is used for writing above information.

Abstract should not be more than 200 words, written in English. Keywords is about five words, covering scientific and local name (if any), research theme, and special methods which used. Introduction is about 400-600 words, covering background and aims of the research. Materials and Methods should emphasize on the procedures and data analysis. Results and Discussion should be written as a series of connecting sentences, however, for manuscript with long discussion should be divided into sub titles. Thorough discussion represents the causal effect mainly explains for why and how the results of the research were taken place, and do not only re-express the mentioned results in the form of sentences. Concluding sentence should preferably be given at the end of the discussion. Acknowledgments are expressed in a brief.

Figures and Tables of maximum of three pages should be clearly presented. Title of a picture is written down below the picture, while title of a table is written in the above the table. Colored picture and photo can be accepted if information in manuscript can lose without those images. Photos

and pictures are preferably presented in a digital file. JPEG format should be sent in the final (accepted) article. Author could consign any picture or photo for front cover, although it does not print in the manuscript. There is no appendix, all data or data analysis are incorporated into Results and Discussions. For broad data, it can be displayed in website as Supplement.

Citation in manuscript is written in “name and year” system; and is arranged from oldest to newest and from A to Z. The sentence sourced from many authors, should be structured based on the year of recently. In citing an article written by two authors, both of them should be mentioned, however, for three and more authors only the family (last) name of the first author is mentioned followed by et al., for example: Saharjo and Nurhayati (2006) or (Boonkerd 2003a, b, c; Sugiyarto 2004; El-Bana and Nijs 2005; Balagadde et al. 2008; Webb et al. 2008). Extent citation as shown with word “cit” should be avoided, and suggested to refer an original reference.

APA style in double space is used in the journal reference as follow: Journal: Carranza S, Arnold EN (2006) Systematics, biogeography and evolution of

Hemidactylus geckos (Reptilia: Gekkonidae) elucidated using mitochondrial DNA sequences. Mol Phylogenet Evol 38: 531-545.

Saharjo BH, Nurhayati AD (2006) Domination and composition structure change at hemic peat natural regeneration following burning; a case study in Pelalawan, Riau Province. Biodiversitas 7: 154-158.

Book: Rai MK, Carpinella C (2006) Naturally occurring bioactive compounds.

Elsevier, Amsterdam. Chapter in book: Webb CO, Cannon CH, Davies SJ (2008) Ecological organization,

biogeography, and the phylogenetic structure of rainforest tree communities. In: Carson W, Schnitzer S (eds) Tropical forest community ecology. Wiley-Blackwell, New York.

Abstract: Assaeed AM (2007) Seed production and dispersal of Rhazya stricta. 50th

annual symposium of the International Association for Vegetation Science, Swansea, UK, 23-27 July 2007.

Proceeding: Alikodra HS (2000) Biodiversity for development of local autonomous

government. In: Setyawan AD, Sutarno (eds) Toward mount Lawu national park; proceeding of national seminary and workshop on biodiversity conservation to protect and save germplasm in Java island. Sebelas Maret University, Surakarta, 17-20 July 2000. [Indonesian]

Thesis, Dissertation: Sugiyarto (2004) Soil macro-invertebrates diversity and inter-cropping plants

productivity in agroforestry system based on sengon. [Dissertation]. Brawijaya University, Malang. [Indonesian]

Information from internet: Balagadde FK, Song H, Ozaki J, Collins CH, Barnet M, Arnold FH, Quake

SR, You L (2008) A synthetic Escherichia coli predator-prey ecosystem. Mol Syst Biol 4: 187. www.molecularsystemsbiology.com Publication manuscript “in press” can be cited and mentioned in

reference (bibliography); “personal communications” can be cited, but cannot be mentioned in reference. Research which not be published or “submitted” cannot be cited.

Some annotation. Manuscript typed without sign link (-) (except repeated word in Indonesian). Usage of letter “l” (el) to “1” (one) or “O” (oh) to “0” (null) should be avoided. Symbols of α, β, χ, etc. included through facility of insert, non altering letter type. No space between words and punctuation mark.

Progress of manuscript. Notification of manuscript whether it is accepted or refused will be notified in about three months since the manuscript received. Manuscript is refused if the content does not in line with the journal mission, low quality, inappropriate format, complicated language style, dishonesty of research authenticity, or no answer of correspondence in a certain period. Author or first authors at a group manuscript will get one original copy of journal containing manuscript submitted not more than a month after publication. Offprint or reprint is only available with special request.

NOTE: Author(s) agree to transfer copy right of published paper to BIODIVERSITAS, Journal of Biological Diversity. Authors shall no longer be allowed to publish manuscript completely without publisher permission. Authors or others allowed multiplying article in this journal as long as not for commercial purposes. For the new invention, authors suggested to manage its patent before publishing in this journal.

NOTIFICATION: All communications are strongly recommended to be undertaken through email.

GENETIC DIVERSTY

Leaf endophytic fungi of chili (Capsicum annuum) and their role in the protection against Aphis gossypii (Homoptera: Aphididae) HENY HERNAWATI, SURYO WIYONO, SUGENG SANTOSO

187-191

Isolation and identification of an agar-liquefying marine bacterium and some properties of its extracellular agarases FATURRAHMAN, ANJA MERYANDINI, MUHAMMAD ZAIRIN JUNIOR, IMAN RUSMANA

192-197

ECOSYSTEM DIVERSTY

Soil microorganisms numbers in the tailing deposition ModADA areas of Freeport Indonesia, Timika, Papua IRNANDA AIKO FIFI DJUUNA, MARIA MASORA, PRATITA PURADYATMIKA

198-203

Inventorying of the tree fern Genus Cibotium of Sumatra: Ecology, population size and distribution in North Sumatra TITIEN NGATINEM PRAPTOSUWIRYO, DIDIT OKTA PRIBADI, DWI MURTI PUSPITANINGTYAS, SRI HARTINI

204-211

Species composition and interspecific association of plants in primary succession of Mount Merapi, Indonesia SUTOMO, DINI FARDILA, LILY SURAYYA EKA PUTRI

212-217

Establishing a long-term permanent plot in remnant forest of Cibodas Botanic Garden, West Java ZAENAL MUTAQIEN, MUSYAROFAH ZUHRI

218-224

Analysis of epiphytic orchid diversity and its host tree at three gradient of altitudes in Mount Lawu, Java NINA DWI YULIA, SUGENG BUDIHARTA, TITUT YULISTYARINI

225-228

Valuing quality of vegetation in recharge area of Seruk Spring, Pesanggrahan Valley, Batu City, East Java TITUT YULISTYARINI, SITI SOFIAH

229-234

Termites community as environmental bioindicators in highlands: a case study in eastern slopes of Mount Slamet, Central Java TEGUH PRIBADI, RIKA RAFFIUDIN, IDHAM SAKTI HARAHAP

235-240

ETHNOBIOLOGY

Community-based sustainable rattan conservation: a case study in Lore Lindu National Park, Central Sulawesi HAMZARI

241-245

Front cover: Cibotium barometz

(PHOTO: TITIEN NGATINEM PRAPTOSUWIRYO)

Published four times in one year PRINTED IN INDONESIA

ISSN: 1412-033X (printed edition) ISSN: 2085-4722 (electronic)

ISSN: 2085-4722 (electronic) ISSN: 1412-033X (printed)

Date post:	21-Jun-2020
Category:	Documents
Upload:	others
View:	3 times
Download:	0 times

ISSN: 1412-033X (printed edition) ISSN: 2085-4722...

Documents