Date post: | 11-Jan-2017 |
Category: |
Documents |
Upload: | nguyenkiet |
View: | 213 times |
Download: | 0 times |
Molecular and Clinical Diagnosis of Group A Streptococcal Pharyngitis in Children 1
Susanna Felsenstein1,*,#, Diala Faddoul1,#, Richard Sposto2, Kristine Batoon3, Claudia M. 2
Polanco3, Jennifer Dien Bard4 3
4
1Division of Infectious Diseases, Department of Pediatrics, Children’s Hospital Los 5
Angeles, Keck School of Medicine of University of Southern California, Los Angeles, 6
CA, 2Department of Preventive Medicine, Keck School of Medicine of University of 7
Southern California, Los Angeles, CA, 3Department of Pathology and Laboratory 8
Medicine, Children’s Hospital Los Angeles, Los Angeles, CA, 4Department of Pathology 9
and Laboratory Medicine, Keck School of Medicine, University of Southern California 10
and Children’s Hospital Los Angeles, Los Angeles, CA, USA. 11
12
# Co-first authors 13
14
*Corresponding Author: 15
Susanna Felsenstein, MD, MSc 16
Division of Infectious Diseases 17
Children’s Hospital Los Angeles 18
4650 Sunset Blvd, Mailstop #51 19
Los Angeles, CA 90027 20
Telephone: 323-361-2509 21
Fax: 323-361-1183 22
Email: [email protected] 23
JCM Accepts, published online ahead of print on 20 August 2014J. Clin. Microbiol. doi:10.1128/JCM.01489-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
24
Short title: Diagnosis of streptococcal pharyngitis in children 25
Key words: Group A Streptococcus, Molecular, Pediatric, Centor score, McIsaac score 26
Word count: Abstract: 249 words 27
Text: 3726 words 28
29
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
ABSTRACT 30 31 Background: Group A Streptococcal (GAS) pharyngitis is a very common condition 32
causing significant morbidity in children. Accurate diagnosis followed by appropriate 33
antibiotic therapy is recommended to prevent post-infectious sequelae. Diagnosis of GAS 34
pharyngitis by rapid antigen direct test (RADT) or culture in the absence of 35
discriminating clinical findings remains challenging. Validation of new sensitive and 36
rapid diagnostic tests is therefore a priority. 37
Methods: The performance of a Loop-Mediated Isothermal Amplification (LAMP) assay 38
(illumigene) for the diagnosis of GAS pharyngitis was compared to RADT and standard 39
culture in 361 pediatric throat swab samples. Discrepant results were resolved using an 40
alternate molecular assay. Test results were correlated with clinical presentation in 41
patients positive by either method. 42
Results: The closest estimate of true prevalence of GAS pharyngitis was 19.7% (71/361). 43
illumigene alone detected 70/71 GAS positive samples; RADT and culture detected 35/71 44
and 55/71, respectively. RADT followed by culture confirmation of RADT negative 45
specimens detected 58/71. illumigene increased identification amongst children eligible 46
for testing by ACP/AAFP criteria from 31 to 39 positives, five of which were false 47
positives. Analysis of clinical data on positive patients indicated a significantly higher 48
proportion of patients with McIsaac scores of ≥ 4 tested positive by illumigene, than both 49
RADT and culture. 50
Conclusion: Overall, illumigene was much more sensitive and similarly specific for GAS 51
detection compared to culture alone, RADT alone, or the ACP/AAFP RADT/culture 52
algorithm. Combining high sensitivity with rapidly available results, illumigene GAS 53
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
assay is an appropriate alternative to culture for the laboratory diagnosis of GAS 54
pharyngitis, in patients where testing is clinically indicated. 55
56
INTRODUCTION 57
Group A Streptococcus (GAS) is a commonly encountered pathogen causing a broad 58
spectrum of diseases. Clinical features of GAS pharyngitis are indistinguishable from 59
pharyngitis caused by other pathogens. Palatal petechiae and scarlatiniform rash, 60
although highly specific, are rare (1). Early diagnosis and treatment is recommended to 61
prevent suppurative and nonsuppurative post-infectious sequelae, such as peritonsillar 62
abscess, lymphadenitis, acute rheumatic fever (ARF), and post-streptococcal 63
glomerulonephritis (2, 3). Current guidelines by the Infectious Diseases Society of 64
America (IDSA) (3), the American Academy of Pediatrics (AAP) (4), and the American 65
Heart Association (AHA) (5) recommend confirmation of GAS pharyngitis in children by 66
rapid antigen detection test (RADT) with follow up culture in RADT negative cases (3, 67
5). The current IDSA guidance specifies that in children with negative RADT, a throat 68
culture should be performed, and treatment is indicated when either test is positive. 69
Clinical scoring systems, namely the Centor and McIsaac scores, integrate signs and 70
symptoms to diagnose GAS pharyngitis (6, 7). Additionally, the McIsaac score considers 71
children aged 3 to 14 years to be at higher risk (8, 9). Whilst latest AAP guidelines 72
recommends additional clinical findings to assist clinicians in determining when testing 73
for GAS pharyngitis is indicated in children, use of clinical scores remains a 74
recommendation by the American College of Physicians (7). 75
76
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
Microbiologic gold standard for the diagnosis of GAS pharyngitis is the culture of 77
pharyngeal swab specimens to screen for beta-hemolytic colonies. Although the 78
sensitivity of culture has been reported to be 90-95% 11, 17, multiple variables can affect 79
its yield, including specimen integrity, culture methods, and prior antibiotic use (10-12). 80
In addition, culture can take up to 48 hours, delaying appropriate antimicrobial treatment 81
(13). Rapid diagnosis of GAS pharyngitis is provided by RADT. Although highly 82
specific, its sensitivity is as low as 31 – 50% (11), prompting the need for back up 83
cultures (3, 5). Molecular methods may offer alternatives to improve speed and accuracy 84
in the diagnosis of GAS pharyngitis and have been shown to have superior sensitivity and 85
specificity (14-16). 86
87
Herein, we present the performance of the illumigene® Group A Streptococcus assay, a 88
molecular assay for the diagnosis of GAS pharyngitis compared to a RADT and standard 89
culture method and correlated with clinical presentation in a pediatric cohort. (A portion 90
of the study data was presented in poster format at the 113th American Society for 91
Microbiology (ASM) General Meeting, 2013). 92
93
MATERIALS AND METHODS 94
Study Design. Two throat swab specimens were collected from December 2012 through 95
March 2013 from 361 pediatric patients presenting to the emergency department (ED) at 96
Children’s Hospital Los Angeles (CHLA). Throat specimens using CultureSwabTM 97
collection and transport system (Becton Dickinson, Sparks, MD) were obtained as per 98
physician’s discretion by a registered pediatric nurse. As per institutional policy, throat 99
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
swabs are ordered in children presenting with McIsaac scores of 2 or more. For the 100
purpose of this study, all throat swabs performed in the ED during the study period were 101
included, thereby including also patients who did not fulfill the criterion of a McIsaac 102
score of 2 or more, and presented with fever of unknown origin, upper respiratory tract 103
symptoms, subjective complaint of throat pain or discomfort on swallowing. This 104
strategy permitted comparison of test performance over several grades of disease severity 105
and during presumed carrier status. Clinical scores and presentation of patients included 106
is detailed in the results section. One swab was used for the OSOM Ultra Strep A RADT 107
(Sekisui Diagnostics, Lexington, MA), the second swab for routine culture and the 108
illumigene GAS assay. All diagnostic tests were performed on each sample and test 109
performance compared between tests. Discrepant tests were additionally tested by PCR, 110
as described below. The study was approved by the Institutional Review Board at CHLA. 111
112
Conventional diagnostic workup. For RADT, the OSOM® Ultra Strep A was performed 113
according to the manufacturer’s protocol. Culture was set up on the second swab by 114
inoculating to 5% sheep blood agar plate (BAP) and incubating at 35 - 37°C in ambient 115
air for 24 - 48 h. BAPs were examined at 24 and 48 h for beta-hemolytic colonies. GAS 116
was confirmed by presence of gram positive cocci in chains on Gram stain, nonreactive 117
catalase, and presence of GAS antigen by latex agglutination test (PathoDx strep 118
grouping kit, Thermo Fisher Scientific, Waltham, MA). Culture plates growing GAS 119
colonies were quantified as few (growth in first quadrant), moderate (growth in second 120
quadrant), and many (growth in third or fourth). 121
122
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
illumigene® Group A Streptococcus assay. After inoculation of the BAP, the swab was 123
used to perform the illumigene GAS assay, according to the manufacturer’s protocol. 124
Briefly, swab tips were broken into the sample preparation tubes, vortexed for 10 125
seconds, followed by the transferring of 10 drops of specimen to a heat treatment tube. 126
The tube was incubated at 95°C for 10 min and 50 μL of lysate transferred to the test and 127
control chambers. The test device was inserted into the illumipro-10 incubator/reader for 128
loop-mediated amplification (LAMP), targeting the highly conserved 206-bp sequence of 129
the Streptococcus pyogenes pyrogenic exotoxin (speB) gene. Within 40 minutes, 130
amplified product is detected by presence of turbidity, due to precipitated magnesium 131
pyrophosphate. 132
133
Performance and discrepancy analysis. The remnant heat treatment tubes were stored 134
at -80°C to perform a laboratory-developed real-time polymerase chain reaction (RT-135
PCR) assay on discrepant samples. The method employed TaqMan primers and probes 136
directed against a different region of the speB gene than the illumigene GAS assay 137
(Forward Primer: 5’-TGTCAGTGTCAACTAACCGTGT-3’; Reverse primer: 5’-138
CGGCAAATACTGGGTTAGCAAG-3’; Probe: 5’-139
FAM/AGTAAGGAGGTGTGTCCAATGTACCGT/36-TAMSp-3’). RT-PCR was 140
performed on the Rotor-Gene RT-PCR cycler (Qiagen, Germantown, MD) at 95°C, 10 141
minutes, followed by 60 cycles of 95°C, 15 seconds and 57°C, 60 seconds, and final 142
extension at 72°C for 5 minutes. Cultures were also re-assessed in cases of discrepancy 143
and identification of GAS were confirmed by repeat latex agglutination test and 144
Pyrrolidonyl Arylamidase (PYR) test (Hardy Diagnostics, Santa Maria, CA). 145
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
146
Medical chart reviews. 147
Clinical and laboratory data were collected retrospectively by an investigator blinded to 148
test outcomes for all patients who tested positive for GAS by at least one diagnostic test. 149
Variables collected included age, date of diagnosis, and identification of clinical criteria: 150
1) fever (defined as a documented temperature of ≥ 38C°, 2) absence of cough and 151
rhinorrhea, 3) presence of tonsillar exudate, and 4) presence of swollen and/or tender 152
anterior cervical lymph nodes. Centor and McIsaac scores were calculated (9, 17). 153
Patients less than 3 years of age were excluded from analysis of the clinical scores, as 154
neither score has been validated for this age group. 155
156
Statistical analysis 157
Comparisons between two groups were performed using the T-Test if normally 158
distributed and Mann-Whitney Test if not. The sample size of 361 was dictated by the 159
number of patients satisfying the eligibility criteria during the period studied. 160
Nevertheless, the study was sufficiently large to yield precise estimates of the overall 161
concordance rate, with standard error at most 0.026. Quantitative variables were 162
expressed by mean and standard deviation (SD) if normally distributed, and by median 163
and interquartile range (IQR) if not. Tests of association between categorical variables 164
were based on Chi-square and Fisher-Exact Tests (www.quantitativeskills.com/sisa). For 165
differences between paired proportions comparing the individual diagnostic tests the 166
McNemar test was used. Sensitivity, specificity and predictive values were calculated 167
using culture or the best estimate of true GAS status as diagnostic gold standards as 168
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
indicated. Statistical computations were performed using SPSS 12.0 (SPSS Inc. Chicago, 169
Illinois). 170
171
RESULTS 172
Evaluation of group A Streptococcus detection methods 173
When comparing RADT to culture, 300/361 (83.1%) patients tested negative and 32/361 174
(8.9%) positive by both methods. An additional 26/361 patients (7.2%) were positive by 175
culture, 3 patients by RADT alone. This resulted in a sensitivity of 55.2% (95% 176
confidence interval (CI), 42.5% - 67.3%) and a specificity of 99.1% (95% CI. 96.9 – 177
99.8%) for RADT (Table 1). 178
179
Alternatively, when comparing routine culture to the illumigene GAS assay, both 180
methods detected 54 (15.0%) positive cases. Illumigene GAS assay detected an additional 181
26 (7.2%) positive cases but missed 4 GAS cases detected by culture, 3 of which were 182
also negative by RADT (Table 1). The sensitivity and specificity were 93.1% (95% CI, 183
83.1% – 97.8%) and 91.4% (95% CI, 87.7% - 94.1%), respectively, and overall 184
prevalence rate based on the illumigene result was 22.2% (80/361). Concordance of the 185
tests employed on the 361 samples is summarized in Table 2. 186
187
GAS colonies were quantified in 55/58 (94.8%) culture positive specimens. A positive 188
RADT was significantly associated with higher colony count (P < 0.001). 14 (25%) 189
culture positive cases with “moderate” or “many” colonies had a negative RADT result 190
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
(P < 0.001). A positive illumigene assay was not associated with higher colony count (P 191
= 0.47) and the one false negative case had “moderate” colony count. 192
193
Discrepant analysis. 194
Amongst 30 discrepant results between illumigene GAS assay and culture, the illumigene 195
GAS assay detected 26 additional GAS positive specimens compared to culture (Table 196
3). Three of 26 specimens were also RADT positive and considered true positives. Upon 197
review of the BAPs on the 4 illumigene GAS assay negative, culture positive specimens, 198
3 revealed beta-hemolytic colonies that were mistakenly identified as GAS by routine 199
methods and the 4th BAP confirmed to grow GAS colonies. Thus, a PCR assay was 200
performed on 24 discrepant specimens; 23 illumigene GAS assay positive, culture 201
negative and one illumigene GAS assay negative, culture positive. Fourteen of 24 (58%) 202
were confirmed to be GAS positive, and 10 were confirmed to be GAS negative by PCR. 203
204
Following discrepant analysis, the adjusted sensitivity and specificity for the illumigene 205
GAS assay were 98.6% (95% CI, 91.7-99.9) and 96.5% (95% CI, 93.6 – 98.2), 206
respectively. The positive predictive value was 87.5% (95% CI, 78.3 – 93.3) and the 207
negative predictive value was 99.6% (95% CI, 97.8 - 99.9). After resolution of 208
discrepancies, the final GAS pharyngitis prevalence rates in the entire cohort using 209
RADT, culture and illumigene GAS were 9.7% (35/361), 15.2% (55/361) and 19.7% 210
(71/361), respectively. Thus, the best estimate of true prevalence in our patient 211
population was 19.7% (Table 2). 212
213
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
Correlation with clinical presentation 214
1) Epidemiology/ Age distribution. 215
Age was normally distributed, with a mean age of 7.4 years (SD 4.2 years), ranging from 216
2 months to 18 years. Sixty-six of 361 children were 3 years or younger. When 217
comparing those positive on culture to those positive on RADT (P = 0.92), or illumigene 218
GAS assay (P = 0.60), mean age did not differ between groups. 219
220
2) Characterization of clinical score in patients with positive GAS result 221
Clinical data was available for 75/81 (94%) patients testing positive by at least one 222
diagnostic test. 6/75 children were 3 years or younger and analyzed separately: 2/6 tested 223
positive by all three methods, 3/6 by culture and illumigene GAS assay only. One patient 224
tested positive by illumigene GAS assay alone, which was confirmed by PCR. Therefore, 225
all children younger than three years had true positive test results for GAS, resulting in a 226
rate of 9% (6/66) in this age group. 4/6 presented with fever, lymphadenopathy and 227
exudates; all six patients had absence of cough. 228
229
The average age of the remaining 69 patients included in clinical score analysis was 8.4 230
years (SD 3.5 years) ranging from 4 to 18 years. 5/69 were 15 years or older. 231
Positive results on either test method were associated with a higher clinical score (Tables 232
5, 6). 49/69 (71%) were febrile, 27/69 (39%) had tonsillar exudates, 22/69 (32%) cervical 233
lymphadenopathy and 48/69 (70%) absence of cough or other viral symptoms. None of 234
these clinical characteristics were associated with GAS positive status by any method 235
(data not shown). 236
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
237
Of the 20 patients included in chart analysis who tested illumigene GAS assay positive, 238
but culture and/or RADT negative, only one was under 3 years old. 7/20 had McIsaac 239
score of 4 or 5, 9/20 a score of 2-3 and 4 a score of 1. Confirmatory PCR was negative in 240
2/7 scoring 4 or over, in 5/9 scoring 2-3 and in 2/4 scoring 1. Symptom severity by 241
McIsaac score did not differ significantly between those positive by illumigene GAS 242
assay only and those positive by more than one modality (p=0.11). 243
244
Treatment and diagnostic implications in patients for whom clinical information 245
was retrieved. 246
When applying the ACP/AAFP strategy (18) to patients older than 3 years, empiric 247
therapy without testing would have been indicated in 21/69 patients based on the McIsaac 248
score. Of these 21 samples, all were positive by illumigene GAS assay including two 249
samples identified as false positives by PCR (Table 4). Only 9/21 were RADT and 250
culture positive and an additional 5 were culture positive only. Assuming that GAS was 251
causative of the symptoms, the illumigene GAS assay increased the yield in this subgroup 252
from 14/21 to 19/21 true positive cases on the expense of identifying 2 false positives. 253
Culture positive cases yielded colony quantitation of “many” in 10 and “moderate” in 4 254
cases. 255
256
In the 8 children whose McIsaac score was 1, indicating a low likelihood of GAS 257
pharyngitis, none had fever, lymphadenopathy, or tonsillar exudate. 6/8 had rhinorrhea 258
and cough. 3/8 were RADT and culture positive and one additional patient was culture 259
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
positive only. All 8/8 were illumigene GAS assay positive, 4/8 confirmed by PCR. The 3 260
patients positive on all three methods grew “moderate” or “many” colonies on BAP, the 261
one RADT negative and culture positive patient grew only “few” colonies. The 262
remaining 40 patients had McIsaac scores of 2 and 3. 18/40 were RADT positive, another 263
13 were identified by follow up culture of RADT negatives. Illumigene GAS assay was 264
positive in 39/40. Of these, PCR testing identified five as false positives and one as false 265
negative. The false negative specimen was RADT and culture positive with moderate 266
colony count. 267
268
Application of the Centor score showed similar findings (Table 5): In the 38 patients with 269
a score of 2 or 3, 20 were RADT positive, an additional 8 culture positive, resulting in 28 270
children who would have received empiric therapy. illumigene GAS assay identified 271
37/38 as positive. Amongst patients with Centor scores of 0 and 1, illumigene GAS assay 272
identified 21/21; RADT 7/21 and culture 14/21 as positive, likely representing carrier 273
status. 274
275
Additionally, we evaluated clinical data for culture and RADT negative specimens that 276
were defined as true negative and true positive based on PCR confirmatory alone, and 277
who had both negative culture and RADT results. Amongst the 10 true negative samples 278
patients defined as true negative on the basis of PCR and iIllumigene GAS assay, two 279
children had a McIsaac score of 4 or 5, five a score of 2 or 3 and three a McIsaac score of 280
1. Conversely, in the 13 true positive group, six patients had a score of 4 or 5, four a 281
score of 2 or 3 and two a score of 1. In the remaining patient, clinical data could not be 282
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
retrieved. Thus, the samples defined as true positives were more likely to have a high 283
McIsaac score than the true negative samples. 284
285
DISCUSSION 286
The diagnosis of GAS pharyngitis continues to be a challenge, and clinical findings are 287
notoriously nondiscriminative and unreliable. It is the most prevalent cause of bacterial 288
pharyngitis, accounting for 5–15% of pharyngitis cases in adults and 20–30% in children 289
(1, 19). In the United States, approximately 7.3 million outpatient visits are attributed to 290
children with acute pharyngitis, and the overall societal cost of GAS pharyngitis ranges 291
from $224 to $539 million annually (23). Therefore, more accurate identification of GAS 292
pharyngitis is of interest, particularly in children, where both carrier rate and incidence of 293
GAS pharyngitis are higher (1, 3, 24, 25) and pathogens associated with clinically 294
indistinguishable symptom complexes are common (26, 27). 295
296
Current diagnostic methods are unable to distinguish whether the presence of GAS 297
reflects carriage or cause of pharyngitis (28, 29). However, up to 20-37% of pediatric 298
pharyngitis cases have been found to be culture positive for GAS (1, 3, 25). In our cohort, 299
a physician led decision to perform a throat swab was made and hence the patients would 300
be presumed to have been symptomatic. However, review of the clinical notes revealed 301
that a significant proportion of patients had low clinical scores, presenting with 302
symptoms in keeping with viral illness. Testing may not have been warranted as the risk 303
of GAS pharyngitis in these cases is about 4% (4). Our study is the first to evaluate the 304
feasibility of using a molecular assay for the diagnosis of GAS pharyngitis by correlating 305
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
results with clinical presentation. 306
307
Detection and identification of GAS from pharyngeal swabs is the current gold standard 308
for the microbiological diagnosis of GAS pharyngitis with reported sensitivities between 309
90-95% (10, 11). Optimal sampling of the posterior pharynx is imperative but difficult in 310
young children, and culture sensitivity can be as low as 20% with suboptimal sampling 311
technique (10). Discrepancies seen between culture and illumigene GAS assay results in 312
this study are unlikely due to sampling variability, as the same pediatric nurse collected 313
both swabs from each patient simultaneously. The 3 samples that were initially reported 314
as beta-hemolytic colonies on BAP were confirmed to be latex agglutination negative and 315
PYR negative upon re-testing. These 3 isolates were correctly identified as GAS negative 316
by both RADT and illumigene GAS assay. 3 other samples were culture negative and 317
both RADT and illumigene GAS assay positive. In 2 cases, there was documentation of 318
prior antibiotic exposure with amoxicillin, in the third case, no information on antibiotic 319
exposure prior to testing could be retrieved. These 3 cases were considered true positives 320
as RADT has been reported to be highly specific and according to current guidelines, 321
confirmation is not required (3, 30). However, the fact that these samples were not 322
confirmed by the alternate PCR assay can be considered a limitation. 323
324
RADT has a significantly shorter turnaround time compared to culture and is therefore an 325
attractive diagnostic option, especially in the outpatient sector. Whilst highly specific, 326
RADT showed concordance with positive culture in only 55.2% of cases. Other studies 327
similarly demonstrate low sensitivity of RADTs compared to culture (31-33). The 328
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
illumigene GAS assay detected 13 additional true positive cases compared to RADT 329
and/or culture with a sensitivity and specificity of 98.6% and 96.5%, respectively. 10 330
false positive illumigene GAS assay results were confirmed by PCR and may be 331
attributed to poor specimen condition, since remnant samples after culture setup and 332
illumigene testing and following a freeze-thaw cycle were used for PCR confirmation. 333
Therefore, the specificity of the illumigene GAS assay may be even higher than reported 334
here. 335
336
Recent studies investigating the performance characteristics of the illumigene GAS assay 337
for the diagnosis of GAS throat infections yielded similar results. A recent study 338
comparing the performance of illumigene GAS assay to standard culture on remnant 339
throat swab samples from a cohort not restricted to pediatric patients yielded 100% 340
sensitivity and 94% specificity, with a false positive rate of 5% (14). However, clinical 341
presentation and indication for testing was not analyzed. Similarly, another group 342
reported a sensitivity of 100% and specificity of 95.9% for the illumigene GAS assay 343
when compared to culture (34). Both studies incorporated laboratory-developed RT-PCR 344
assays that were shown to be highly sensitive and specific (14, 34). 345
346
Depending on age and season, between 5 and 20% of asymptomatic children test positive 347
for GAS (22, 35). Therefore, an argument against the higher number of positives 348
detected by molecular tests, are asymptomatic carriers. To determine whether the new 349
positive cases exhibited signs and symptoms of GAS pharyngitis, clinical scores of all 350
positive patients were determined. It was apparent that whilst some guidance in the ED 351
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
exists for clinicians to determine if screening for GAS pharyngitis is valuable in 352
determining further management, these are not always adhered to, resulting in a number 353
of patients being included in the study whose positive test result likely represents carrier 354
status. Despite the fact that there was no correlation between RADT, culture or molecular 355
results and clinical scores, a finding that was consistent with other studies (6, 25), 16/20 356
newly positive patients by illumigene GAS assay had a McIsaac score of 2 or greater, and 357
7 patients with a score of 4 presented with clinical signs and symptoms of GAS 358
pharyngitis. Of note, only patients in whom the clinical decision was made to perform a 359
throat swab was included in this study, thus, we can not fully assess the impact of 360
asymptomatic carriers status by molecular methods. We can confirm that all patients who 361
were culture negative for GAS were also negative for Group C and Group G streptococci 362
and Arcanobacterium spp. but conversely, the presence of alternative bacterial or viral 363
agents causative of the symptoms in patients with higher score but negative 364
microbiological diagnostic work up can not be excluded. 365
366
Our study illustrates that regardless of the diagnostic method utilized, appropriate clinical 367
assessment must be employed to avoid detection of GAS carriers. Following the 368
ACP/AAFP approach, 8/69 had a McIsaac score of only 1, of the remaining 61 patients 369
eligible for testing, 45/61 (74%) patients would have received treatment based on positive 370
RADT and/or culture results. If diagnostic testing by illumigene GAS assay alone had 371
been used to guide treatment, 60/61 (99%) of patients with McIsaac score of 2 and above 372
would have been identified as positive. Of these, 7/61 were false positive by PCR 373
confirmation. Therefore, whilst illumigene GAS assay is a highly sensitive assay, it is 374
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
important to highlight that the use of any GAS diagnostic test requires adherence to 375
clinical guidelines detailing indications for testing. Non-adherence to these guidelines 376
would continue to contribute to the concerning increase of antibiotic use driven by 377
positive test results rather than a combination of clinical acumen and diagnostic tests. 378
379
The illumigene GAS assay is a rapid, molecular assay with high sensitivity and 380
specificity and is demonstrated to be far superior to RADT and culture for the detection 381
of GAS from pharyngeal specimens. In addition, medical chart analysis of the illumigene 382
GAS assay positive, RADT and/or culture negative patients revealed possible true 383
positive cases of GAS pharyngitis rather than asymptomatic colonization in a number of 384
patients. Therefore, the illumigene GAS assay proves to be a useful diagnostic tool for 385
GAS pharyngitis when testing is appropriately limited to patients presenting with 386
suggestive clinical symptoms in the absence of cough and coryza. 387
388
ACKNOWLEDGEMENT 389
We thank Meridian Biosciences, Inc. for supplying the illumigeneTM Group A 390
Streptococcus Assay kits and the illumipro-10TM Incubator Reader for the study. 391
392
REFERENCES 393
1. Ebell, M. H., M. A. Smith, H. C. Barry, K. Ives, and M. Carey. 2000. The rational 394
clinical examination. Does this patient have strep throat? JAMA : the journal of 395
the American Medical Association 284:2912-2918. 396
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
2. Wannamaker, L. W., C. H. Rammelkamp, Jr., F. W. Denny, W. R. Brink, H. B. 397
Houser, E. O. Hahn, and J. H. Dingle. 1951. Prophylaxis of acute rheumatic fever 398
by treatment of the preceding streptococcal infection with various amounts of 399
depot penicillin. The American journal of medicine 10:673-695. 400
3. Shulman, S. T., A. L. Bisno, H. W. Clegg, M. A. Gerber, E. L. Kaplan, G. Lee, J. 401
M. Martin, and C. Van Beneden. 2012. Clinical practice guideline for the 402
diagnosis and management of group A streptococcal pharyngitis: 2012 update by 403
the Infectious Diseases Society of America. Clinical infectious diseases : an 404
official publication of the Infectious Diseases Society of America 55:e86-102. 405
4. Pickering, L. K., C. J. Baker, S. S. Long, and D. W. Kimberlin. Red Book: 2012 406
Report of the Committee on Infectious Diseases. 29th ed. Elk Grove Village, IL: 407
American Academy of Pediatrics; 2012. 408
5. Gerber, M. A., R. S. Baltimore, C. B. Eaton, M. Gewitz, A. H. Rowley, S. T. 409
Shulman, and K. A. Taubert. 2009. Prevention of rheumatic fever and diagnosis 410
and treatment of acute Streptococcal pharyngitis: a scientific statement from the 411
American Heart Association Rheumatic Fever, Endocarditis, and Kawasaki 412
Disease Committee of the Council on Cardiovascular Disease in the Young, the 413
Interdisciplinary Council on Functional Genomics and Translational Biology, and 414
the Interdisciplinary Council on Quality of Care and Outcomes Research: 415
endorsed by the American Academy of Pediatrics. Circulation 119:1541-1551. 416
6. Le Marechal, F., A. Martinot, A. Duhamel, I. Pruvost, and F. Dubos. 2013. 417
Streptococcal pharyngitis in children: a meta-analysis of clinical decision rules 418
and their clinical variables. BMJ open 3. 419
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
7. Regoli, M., E. Chiappini, F. Bonsignori, L. Galli, and M. de Martino. 2011. 420
Update on the management of acute pharyngitis in children. Italian journal of 421
pediatrics 37:10. 422
8. McIsaac, W. J., D. White, D. Tannenbaum, and D. E. Low. 1998. A clinical score 423
to reduce unnecessary antibiotic use in patients with sore throat. CMAJ : 424
Canadian Medical Association journal = journal de l'Association medicale 425
canadienne 158:75-83. 426
9. Centor, R. M., J. M. Witherspoon, H. P. Dalton, C. E. Brody, and K. Link. 1981. 427
The diagnosis of strep throat in adults in the emergency room. Medical decision 428
making : an international journal of the Society for Medical Decision Making 429
1:239-246. 430
10. Fox, J. W., M. J. Marcon, and B. K. Bonsu. 2006. Diagnosis of streptococcal 431
pharyngitis by detection of Streptococcus pyogenes in posterior pharyngeal versus 432
oral cavity specimens. Journal of clinical microbiology 44:2593-2594. 433
11. Wegner, D. L., D. L. Witte, and R. D. Schrantz. 1992. Insensitivity of rapid 434
antigen detection methods and single blood agar plate culture for diagnosing 435
streptococcal pharyngitis. JAMA : the journal of the American Medical 436
Association 267:695-697. 437
12. Gerber, M. A., L. J. Spadaccini, L. L. Wright, and L. Deutsch. 1984. Latex 438
agglutination tests for rapid identification of group A streptococci directly from 439
throat swabs. The Journal of pediatrics 105:702-705. 440
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
13. Snow, V., C. Mottur-Pilson, R. J. Cooper, and J. R. Hoffman. 2001. Principles of 441
appropriate antibiotic use for acute pharyngitis in adults. Annals of internal 442
medicine 134:506-508. 443
14. Anderson, N. W., B. W. Buchan, D. Mayne, J. E. Mortensen, T. L. Mackey, and 444
N. A. Ledeboer. 2013. Multicenter clinical evaluation of the illumigene group A 445
Streptococcus DNA amplification assay for detection of group A Streptococcus 446
from pharyngeal swabs. Journal of clinical microbiology 51:1474-1477. 447
15. Pokorski, S. J., E. A. Vetter, P. C. Wollan, and F. R. Cockerill, 3rd. 1994. 448
Comparison of Gen-Probe Group A streptococcus Direct Test with culture for 449
diagnosing streptococcal pharyngitis. Journal of clinical microbiology 32:1440-450
1443. 451
16. Uhl, J. R., S. C. Adamson, E. A. Vetter, C. D. Schleck, W. S. Harmsen, L. K. 452
Iverson, P. J. Santrach, N. K. Henry, and F. R. Cockerill. 2003. Comparison of 453
LightCycler PCR, rapid antigen immunoassay, and culture for detection of group 454
A streptococci from throat swabs. Journal of clinical microbiology 41:242-249. 455
17. McIsaac, W. J., J. D. Kellner, P. Aufricht, A. Vanjaka, and D. E. Low. 2004. 456
Empirical validation of guidelines for the management of pharyngitis in children 457
and adults. JAMA : the journal of the American Medical Association 291:1587-458
1595. 459
18. Choby, B. A. 2009. Diagnosis and treatment of streptococcal pharyngitis. 460
American family physician 79:383-390. 461
19. Bisno, A. L. 1996. Acute pharyngitis: etiology and diagnosis. Pediatrics 97:949-462
954. 463
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
20. Carapetis, J. R., A. C. Steer, E. K. Mulholland, and M. Weber. 2005. The global 464
burden of group A streptococcal diseases. The Lancet infectious diseases 5:685-465
694. 466
21. Kaplan, E. L., F. H. Top, Jr., B. A. Dudding, and L. W. Wannamaker. 1971. 467
Diagnosis of streptococcal pharyngitis: differentiation of active infection from the 468
carrier state in the symptomatic child. The Journal of infectious diseases 123:490-469
501. 470
22. Shulman, S. T. 1994. Streptococcal pharyngitis: diagnostic considerations. The 471
Pediatric infectious disease journal 13:567-571. 472
23. Pfoh, E., M. R. Wessels, D. Goldmann, and G. M. Lee. 2008. Burden and 473
economic cost of group A streptococcal pharyngitis. Pediatrics 121:229-234. 474
24. Shaikh, N., E. Leonard, and J. M. Martin. 2010. Prevalence of streptococcal 475
pharyngitis and streptococcal carriage in children: a meta-analysis. Pediatrics 476
126:e557-564. 477
25. Shaikh, N., N. Swaminathan, and E. G. Hooper. 2012. Accuracy and precision of 478
the signs and symptoms of streptococcal pharyngitis in children: a systematic 479
review. The Journal of pediatrics 160:487-493 e483. 480
26. Bisno, A. L. 2001. Acute pharyngitis. The New England journal of medicine 481
344:205-211. 482
27. Wessels, M. R. 2011. Clinical practice. Streptococcal pharyngitis. The New 483
England journal of medicine 364:648-655. 484
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
28. Dunne, E. M., J. L. Marshall, C. A. Baker, J. Manning, G. Gonis, M. H. Danchin, 485
P. R. Smeesters, C. Satzke, and A. C. Steer. 2013. Detection of group a 486
streptococcal pharyngitis by quantitative PCR. BMC infectious diseases 13:312. 487
29. Gerber, M. A., R. W. Ryan, R. C. Tilton, and J. E. Watson. 1984. Role of 488
Chlamydia trachomatis in acute pharyngitis in young adults. Journal of clinical 489
microbiology 20:993-994. 490
30. Leung, A. K., R. Newman, A. Kumar, and H. D. Davies. 2006. Rapid antigen 491
detection testing in diagnosing group A beta-hemolytic streptococcal pharyngitis. 492
Expert Review of Molecular Diagnostic 6:761-766.x 493
31. Armengol, C. E., T. A. Schlager, and J. O. Hendley. 2004. Sensitivity of a rapid 494
antigen detection test for group A streptococci in a private pediatric office setting: 495
answering the Red Book's request for validation. Pediatrics 113:924-926. 496
32. Chapin, K. C., P. Blake, and C. D. Wilson. 2002. Performance characteristics and 497
utilization of rapid antigen test, DNA probe, and culture for detection of group a 498
streptococci in an acute care clinic. Journal of clinical microbiology 40:4207-499
4210. 500
33. Gerber, M. A. 1989. Comparison of throat cultures and rapid strep tests for 501
diagnosis of streptococcal pharyngitis. The Pediatric infectious disease journal 502
8:820-824. 503
34. Henson, A. M., D. Carter, K. Todd, S. T. Shulman, X. Zheng. 2013. Detection of 504
streptococcus pyogenes by use of illumigene group A streptococcus assay. 505
Journal of Clinical Microbiology 51:4207-4209. 506
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
35. Martin, D. 2004. XV Lancefield Symposium on Streptococci and Streptococcal 507
Diseases. The Indian journal of medical research 119 Suppl:ix-xi. 508
509
Table 1. Performance of RADT and illumigene group A Streptococcus compared to 510
routine culture 511
Method TP FP TN FN
Sensitivity
(95%CI)
Specificity
(95%CI)
PPV
(95%CI)
NPV
(95%CI)
RADT 32 31 300 26255.2%
(42.5-67.3)
99.1%
(96.9-99.8)
91.4%
(76.9-97.8)
92.0%
(87.2-95.2)
illumigene 54 263 277 44 93.1%
(83.1-97.8)
91.4%
(87.7-94.1)
67.5%
(56.6-76.8)
98.5%
(95.1-99.9)
512
1 all 3 resolved by illumigene and PCR as true positive (TP); 2 3/26 resolved by culture as 513
true negative (TN), 23/26 confirmed by illumigene as false negative (FN); 3 10/26 514
confirmed by PCR as false positive (FP), 13/26 resolved by PCR as TP, 3/26 resolved by 515
RADT as TP; 41/4 confirmed by PCR as FN, 3/4 resolved by culture review as TN. 516
517
Table 2. Concordance for RADT, culture and illumigene group A Streptococcus 518
RADT
negative
RADT
positive
Positive
agreement
Negative
agreement
Overall
agreement
P-value*
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
(95%CI) (95%CI) (95%CI)
Culture
negative 300 3
55.2 %
(42.5-67.3)
99.1%
(96.9-99.8)
91.9%
(88.7-94.4) <0.001
Culture
positive 26 32
illumigene
negative
illumigene
positive
Culture
negative 277 26
93.1%
(83.1-97.8)
91.4%
(87.7-94.1)
91.7%
(88.4-94.2) <0.001
Culture
positive 4 54
illumigene
negative
illumigene
positive
RADT
negative 280 46
97.1%
(84.2-99.9)
85.9%
(81.7-89.3)
86.9%
(83.1-90.1) <0.001
RADT
positive 1 34
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
519
*McNemar test 520
521
Table 3. Discrepant analysis of illumigene GAS Assay 522
Culture RADT illumigene
GAS Assay PCR
ACP
criteria
Reference GAS
status n (%)
Positive Positive Positive Positive True positives 31 (8.6)
Positive Positive Negative Positive Positive True positive 1 (0.3)
Positive Negative Positive Positive True positives 23 (6.4)
Positive Negative Negative Positive True negatives1 3 (0.8)
Negative Positive Positive Positive True positives2 3 (0.8)
Negative Positive Negative Positive True negatives 0 (0.0)
Negative Negative Positive Positive Negative True positives 13 (3.6)
Negative Negative Positive Negative Negative True negatives 10 (2.8)
Negative Negative Negative Negative True negatives 277 (76.7)
1 Review of BAP revealed beta-hemolytic streptococci colonies other than GAS
2 Based on RADT positive results
523
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
Table 4: GAS positive by diagnostic method and McIsaac score 524
Diagnostic
Method
McIsaac Score (n=69) N
(total) P-value*
1 (n=8) 2 (n=13) 3 (n=27) ≥ 4 (n=21)
Culture positive,
n (%) 4 (50) 10 (77) 18 (67) 14 (75) 46 0.68
RADT positive, n
(%) 3 (38) 4 (31) 14 (52) 9 (43) 30 0.64
illumigene, all
positive, n (%) 8 (100) 13 (100) 26 (96) 21 (100) 68 0.80
Confirmed true
positive, n (%) 6 (75) 11 (85) 23 (89) 19 (91) 59 0.63
Confirmed false
positive, n (%) 2 (25) 2 (15) 3 (11) 2 (10) 9 0.62
525
*Fisher Exact test for 2xr tables 526
527
528
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
Table 5: GAS positive by diagnostic method and Centor score 529
Diagnostic
Method
Centor Score (n=69) N
(total) P-value*
0 (n=6) 1 (n=15) 2 (n=25) ≥ 3 (n=23)
Culture positive,
n (%)
2 (33) 12 (80) 16 (64) 16 (70) 46 0.24
RADT positive, n
(%)
2 (33) 5 (33) 12 (48) 11 (48) 30 0.75
Illumigene, all
positive, n (%) 6 (100) 15 (100) 25 (100) 22 (96) 68 0.47
Confirmed true
positive, n (%)
5 (83) 13 (87) 22 (88) 20 (87) 60
0.98
Confirmed false
positive, n (%)
1 (17) 2 (13) 3 (12) 2 (9) 8 0.80
530
* Fisher Exact Test for 2xr tables 531
on March 17, 2018 by guest
http://jcm.asm
.org/D
ownloaded from