Analysis of the DNA region mediating increased thermotolerance at 58°C in Cronobacter sp. and other...

transcript

Original article was published in Antonie van Leeuwenhoek 2011, 100 (2), 279-289.

Analysis of the DNA region mediating increased thermotolerance at 58°C in

Cronobacter sp. and other enterobacterial strains

Jana Gajdosova1, Kristina Benedikovicova1, Natalia Kamodyova1, Lubomira Tothova1, Eva

Kaclikova2, Stanislav Stuchlik1, Jan Turna1 and Hana Drahovska1*

1Dep. of Molecular Biology, Fac.Natural Sciences, Comenius University, Bratislava, Slovakia 2Dep. of Microbiology and Molecular Biology, Food Research Institute, Bratislava, Slovakia

Correspondence to: Hana Drahovská, Department of Molecular Biology, Faculty of Natural

Sciences, Comenius University, Mlynska dolina 1, 841 15 Bratislava, Slovakia;

e-mail: drahovska@fns.uniba.sk

Telephone number: 421 2 6096 639

Fax number: 421 2 6096 508

Abstract

Cronobacter spp. are opportunistic pathogens associated with serious infections in neonates.

The increased stress tolerance, including thermoresistance, of some Cronobacter strains can

promote their survival in production facilities and thus raise the possibility of contamination of

dried infant milk formula, which has been identified as a potential source of infection. In this

study, we characterized a DNA region which is present in some Cronobacter strains and which

contributes to their prolonged survival at 58 °C. The 18 kbp long region containing 22 open

reading frames was sequenced in Cronobacter sakazakii ATCC 29544. The major feature of the

region contained a cluster of conserved genes, most of them having significant homologies with

bacterial proteins involved in some type of stress response, including heat, oxidation and acid

stress. The same thermoresistance DNA region was detected in strains belonging to the genera

Cronobacter, Enterobacter, Citrobacter and Escherichia and its presence positively correlated

with increased thermotolerance.

Keywords: Cronobacter, Enterobacter sakazakii, heat resistance, food

Introduction

Cronobacter spp. are opportunistic pathogens that can cause serious infections in neonates,

including meningitis, necrotising enterocolitis and sepsis with fatality rates as high as 80% (van

Acker et al 2001; Gurtler et al. 2005; Caubilla-Barron et al. 2007; Healy et al., 2010). Recently,

infections in adults have been reported, in particular among the elderly and

immunocompromised patients (FAO/WHO report 2008). The genus Cronobacter was

established by a polyphasic taxonomic approach as a reclassification of Enterobacter sakazakii

and other strains. Currently, five species and three subspecies are described in the genus

Cronobacter (Iversen et al. 2008).

Although these bacteria are widely distributed in the environment and in various foods

(Iversen and Forsythe 2004, Friedman 2007, Turcovsky et al. 2010), dried infant milk formula

has been implicated as the vehicle of transmission in many clinical manifestations (Nazarowec-

White and Farber, 1997; van Acker et al., 2001; Gurtler et al. 2005; Caubilla-Barron et al. 2007).

Accurate knowledge of the growth condition range of Cronobacter strains is necessary to

minimize the risk of contamination during the production and preparation of rehydrated infant

formula. Increased thermoresistance together with tolerance to high-osmotic and dry conditions

are very important properties in this point of view.

Thermoresistance of Cronobacter spp. was evaluated by several studies. Nazarowec-White

and Farber (1997) obtained D-values at 58 °C to be 4.2 min and they concluded that Cronobacter

were among the most thermotolerant microorganisms of the family Enterobacteriaceae. In

contrast to these results, Breeuwer et al. (2003) determined the D58-value for Cronobacter as

ranging from 0.3 to 0.6 min, which is much lower and comparable with that of other

Enterobacteriaceae. On the other hand, these authors showed that Cronobacter spp. are

particularly tolerant to osmotic stress and desiccation, which is most likely linked to

accumulation of trehalose in the cells. Iversen et al. (2004) obtained D-values for Cronobacter

between those previously published, with a D-value at 58 °C of 2.4 min. Similarly, Dancer et al.

(2009) determined D60 values for strains ranging from 1.05 to 2.21 min and observed a positive

correlation between thermo- and desiccation tolerance. It is difficult to compare D-values

obtained for identical strains by different researchers, as many factors (e.g. type of cultivation

media, bacterial growth phase, previous heat shock treatment) can influence thermotolerance

(Chang et. al. 2009; Arroyo et al. 2009). However, differences in D-values between strains

measured in the same experimental conditions are very reproducible. Edelson-Mammel and

Buchanan (2004) observed 20-fold differences in the ability of Cronobacter strains to survive

heating in rehydrated infant formula at 58 °C, with D-values ranging from 0.5 to 9.9 min and the

strains appearing to fall into two distinct heat resistance phenotypes, thermosensitive and

thermotolerant strains. Proteins unique for thermotolerant Cronobacter strains were identified by

liquid chromatography and mass spectrometry (Williams et al. 2005). One protein found only in

thermotolerant strains was sequenced and identified as homologous to a hypothetical protein

(Mfla_1165) from the thermotolerant bacterium Methylobacillus flagellatus KT. According to

the sequence of the respective gene, a PCR detection system was designed, which showed

specificity for thermotolerant strains. The same protein was observed to be induced by osmotic

stress and in desiccated cultures (Riedel and Lehner 2007).

The aim of our work was to assess the genetic variability of Cronobacter strains differing

in thermal tolerance and to study the genetic organisation of the DNA region surrounding the

thermotolerance marker homologous to Mfla_1165.

Materials and Methods

Bacterial strains used in the study. Enterobacterial strains were isolated from foods and

clinical samples at our laboratory or were obtained from the American Type Culture Collection

(ATCC), from the Belgian Co-ordinated Collections of Microorganisms (BCCM/LMG), Czech

Collection of Microorganisms (CCM) and from the Institute for Food Safety and Hygiene,

Vetsuisse University of Zurich, Switzerland (IFSH). Cronobacter strains were previously

identified at the species level and characterised by several phenotyping and molecular methods

(Turcovsky et al. 2011). A list of strains studied is presented in Table 1.

All strains were maintained in 15 % glycerol solution at -70 °C and freeze-dried for long-

period storage. Strains were cultured on Luria-Bertani or Brain Heart broth/agar (Merck) at

37 °C.

Determination of thermotolerance. The thermotolerance of strains was determined by

dispensing a series of 70 µl aliquots of the first decimal dilution of overnight cultures

(approximately 18 h at 37 °C) in Brain Heart broth into sterile 200 µl thin-wall microtubes which

were incubated in a thermoblock adjusted to 58 °C. The initial concentration of cells estimated

from decimal dilutions by the plate-count method was within the range from 5 x 107 to 8 x 107

CFU/ml. At given time periods, three tubes were transferred to another thermoblock adjusted to

10 °C. The numbers of viable cells were determined from appropriate decimal dilutions by the

plate-count method. The time required for the viable count to decrease by 1 log order (decimal

reduction time = D-value) at 58 °C was determined by plotting the log10 CFU/ml against the time

of incubation using linear regression and the D-value determined as the negative reciprocal of the

slope. Each D-value was determined in triplicate for each culture in two independent

experiments.

PCR detection of the orfI thermotolerance marker. Chromosomal DNA was isolated

using a DNeasy blood and tissue kit (Qiagen, Hilden, Germany) according to the manufacturer´s

instructions. PCR primers ThrF (gccaacgtggaatcggta) and ThrR (acggacgacagcaaggtg)

complementary to the C. sakazakii ATCC 29544 sequence were used for the detection of orfI in

enterobacterial strains.

Sequencing of the thermotolerance region. The sequence of the thermotolerance DNA

region in C. sakazakii ATCC 29544 was obtained from PCR products with primers designed

according to similar sequences from DNA databases and/or by the inverse PCR approach. DNA

sequencing was performed using an ABI 3130 Prism Avant automatic DNA analyzer (Applied

Biosystems) using a Big Dye Terminator 3.1 kit (Applied Biosystems). DNA sequences were

assembled in Vector NTI software (Invitrogen), coding regions were annotated by

GeneMark.hmm for prokaryotes (Lukashin and Borodovsky 1998) and a search for potential

promoters was performed using promoter prediction software

(http://www.fruitfly.org/seq_tools/promoter.html). Potential Orfs were analyzed for homology to

other proteins and for the presence of conserved domains using the NCBI/Blast server

(http://blast.ncbi.nlm.nih.gov/Blast.cgi). The presence of signal peptides was detected with

SignalP 3.0 (http://www.cbs.dtu.dk/services/SignalP/) and the cell localization was assessed by

PSORTb v3.0 (http://www.psort.org/psortb/index.html, Yu et al. 2010). The sequence obtained

has been deposited in the EMBL database (FR714908).

Detection of transcription by rtPCR. Total bacterial RNA was isolated from overnight

bacterial cultures grown for 18-20 h at 37 ºC in LB medium as well as from the exponential

growth phase cells, which were cultivated up to 0.3-0.5 OD600. Total RNA was isolated using an

RNeasy Protect Mini Kit (Qiagen). Five µg RNA were used for reverse transcription with a First

Strand cDNA Synthesis Kit (Fermentas). Gene expression from the thermotolerance DNA region

was detected by amplification of cDNA samples with orf-specific primers, chromosomal DNA

from C. sakazakii ATCC 29544 being used as a positive control.

Cloning of orfH-K in Escherichia coli. A part of the thermotolerance DNA region from C.

sakazakii ATCC 29544 covering orfH-K was amplified with primers p1163F-BamHI

(agcaggatccactgaaggcaagccag) and p1167R-EcoRI (catcgaattcgtcggcattgttcaagg). The PCR

product was digested with EcoRI and BamHI and, after ligation into pUC21 (Vereira and

Messing, 1991), the recombinant plasmid pKK12 was created and transformed into E. coli XL1

Blue (Stratagene). Thermoresistance of recombinant bacteria was measured according to the

same protocol as for Cronobacter strains.

Results and Discussion

Thermotolerance of Cronobacter strains. Since thermoresistance of Cronobacter is an

important parameter likely facilitating contamination of powdered infant milk formula, the

ability of strains to survive at 58 ˚C was measured in our study. In agreement with other authors

(Edelson-Mammel and Buchanan 2004; Dancer et al. 2009, Walsh et al. 2010), strains were

separated into two groups; D58 values of twelve thermosensitive strains fell within the range from

15 to 60 s. On the other hand, eleven strains were assessed as thermotolerant because their D58

values ranged from 102 to 217 s (Table 1). According to several phenotyping and genotyping

tests (Turcovsky et al. 2011), nine of the thermotolerant strains belonged to C. sakazakii, four of

them being closely related according to the AFLP analysis. The other two thermotolerant strains

were identified as Cronobacter malonaticus. Elevated thermoresistance strictly correlated with

the presence of the thermotolerance DNA marker orfI, homologous to the Mfla_1165 gene,

which was described previously (Williams et al. 2005). Several other enterobacterial strains

belonging to Citrobacter freundii, Citrobacter braakii, Enterobacter cloacae and E. coli

contained the orfI marker. Thermotolerance of all enterobacterial strains determined as D58 value

>100 s correlated with orfI presence (Table 1).

Thermotolerance DNA region. In further work, the genetic context of the orfI marker

was analyzed by sequencing of an 18 kbp region in strain C. sakazakii ATCC 29544 (EMBL acc.

no. FR714908). Twenty-two potential open reading frames with sizes ranging from 141 – 2850

bp were found in this region by analysis with GeneMark.hmm for prokaryotes (Lukashin and

Borodovsky 1998). The major feature of the region contained a cluster of conserved genes (orfA-

Q), most of them having significant homologies with bacterial proteins involved in some type of

stress response, including heat, oxidation and acid stress (Fig. 1; Table 2). The GC content of the

orfA-Q region was 61.8%, which is higher than average for the genome of C. sakazakii BAA-

894 (56.7%, Kucerova et al. 2010). The DNA region identified here was not present in the

genome of C. sakazakii BAA-894. By PCR analysis, the same organization of the

thermotolerance DNA region was detected in all strains containing the orfI marker (data not

shown). The region was surrounded at both ends by genes encoding for putative transposases,

these sequences were unique only for Cronobacter and one E. cloacae strains.

By comparison with the GenBank database, the thermotolerance DNA region from

C. sakazakii showed significant similarity to several chromosomal and plasmid sequences from

different Proteobacteria. An almost identical gene cluster was present in genomes of three β-

proteobacteria: Ralstonia pickettii 12D, Burkholderia multivorans ATCC 17616 and M.

flagellatus KT (Fig. 1). Substantial parts of the Cronobacter thermotolerance DNA region were

also homologous to plasmids of the α-proteobacteria Ochrobactrum anthropi ATCC 49188 and

Methylobacterium exorquems AM1 and to chromosomal DNA of the δ-proteobacterium

Desulfovibrio desulfuricans G20. Strains belonging to Burkholderia and Ralstonia species can

grow in intimate associations with plants and they are also important bacterial pathogens of

plants. Similarly, strains belonging to Methylobacterium, as well as its relative Ochrobactrum,

are often found in association with plants (Vuilleumier et al. 2009). Plant material was assumed

to be a natural habitat also for Cronobacter spp. (Iversen and Forsythe 2004; Friedman 2007)

and the ability of Cronobacter strains to associate with plants was recently experimentally

confirmed for environmental as well as clinical strains (Schmid et al. 2009). Thus horizontal

transfer of the thermotolerance DNA region may have happened in this environment.

In the Enterobacteriaceae family, several chromosomal and plasmid replicons from

Escherichia, Yersinia, Enterobacter and Klebsiella showed significant homology to the

thermotolerance DNA region. An almost identical sequence was present in E. coli MS 115-1 and

in Escherichia sp. 1_1_43, strains isolated from human intestine and sequenced in the Human

Microbiome Project (Turnbaugh et al. 2007). The former strain contained all the structural genes

of the thermotolerance DNA region, whereas the latter isolate showed high similarity to both

ends covering orfB-E and orfL-Q, but the genes H-K were missing (Fig. 1). The DNA region

encoding for OrfB-J was nearly identical to sequence from a large conjugative plasmid of

Klebsiella pneumoniae C-132-98 which was sequenced recently (Bojer et al. 2010). The region

restricted to orfCD was also found in E. cloacae ATCC 13047.

Expression of the thermotolerance DNA region. The level of mRNA transcription for

genes from the thermotolerance DNA region was measured in three thermotolerant strains by

rtPCR. We observed high expression throughout the whole thermotolerance gene cluster (orfA-

Q). Similar levels of transcription were observed in all strains and in both stationary and

exponentially growing bacteria (Fig. 2A). We obtained positive results from several mutually

overlapping rtPCRs throughout all of the thermotolerance genomic island, which supports our

proposal that the region is transcribed as a continuous operon. A very weak or no mRNA signal

was detected in the outer regions containing the putative transposase genes (Fig. 2B).

Genes from the thermoresistance DNA region. The thermotolerance DNA region of

C. sakazakii ATCC 29544 contained seventeen genes transcribed in the same orientation (Fig. 1),

many of them showed similarity to stress response proteins (Table 2).

The OrfB is similar to the N-terminal domain of MerR superfamily transcriptional

regulators. It has been shown that these proteins mediate responses to stress including exposure

to heavy metals, drugs, or oxygen radicals in eubacterial and some archaeal species (Brown et al.

2003). Compared to homologous proteins from Ralstonia, Methylobacillus and Escherichia,

Cronobacter OrfB is shortened by about one third at the C-terminal end.

Proteins OrfC and OrfH belong to the family of the small heat-shock proteins (sHsps).

These proteins contain a common α-crystallin domain and function as ATP-independent holding

chaperones, which assist in the folding process by stabilizing the unfolded or partially folded

proteins, without actively promoting their remodelling (Baneyx and Mujacic, 2004; Han et al.

2008). The sHsps are present in almost all organisms. Two genes named ibpA and ibpB, are

present in E. coli and their homologues were also found in the C. sakazakii BAA-894 genome

(Kucerova et al. 2010).

Protein OrfD is homologous to Clp ATP-dependent chaperones. These proteins are

known to increase the survival during heat shock and their function is to disaggregate misfolded

and aggregated proteins (Doyle and Wickner 2008). The OrfD possesses 99% similarity to a new

member of the Clp chaperone family, ClpK from K. pneumoniae, which was characterized

recently (Bojer et al. 2010). By mutation and complementation it was shown that ClpK does not

affect the maximum growth temperature, but specifically enhances the ability of K. pneumoniae

to survive at otherwise lethal temperatures. The clpK marker was present in about 30% of

clinical K. pneumoniae isolates and, as in Cronobacter, a positive correlation between clpK

expression and a thermotolerant phenotype was established (Bojer et al. 2010). Genes encoding

for OrfCD chaperones were found also in E. cloacae ATCC 13047 and in E. cloacae 41S from

our study. These genes might be responsible for the slightly increased thermoresistance of the

latter strain (Table 1).

The orfEFG are, with a high probability, non-functional, being fragments of homologous

genes present in Methylobacillus, Burkholderia and Ralstonia encoding for phospholipase D and

FtsH protease.

The thermotolerance marker OrfI is a member of the YfdX family of conserved proteins

with unknown function found in Proteobacteria. The yfdX gene is essential for growth in E. coli

and is up-regulated in stationary phase (Schlicht et al. 2006) as well as by overexpression of the

EvgA regulator (Nishino et al. 2003; Masuda and Church 2003). Similar to YfdX, the OrfI

localization is extra-cytoplasmic according to PSORTb (Yu et al. 2010). OrfI has a high

similarity to the adjacent OrfJ protein (48% amino acid identity and 63% amino acid similarity).

However, OrfJ does not possess a signal peptide and membrane spanning regions. OrfI was

discovered as a marker associated with increased thermotolerance in Cronobacter (Williams at

al. 2005). Both OrfI and OrfJ (as well as OrfD) change their expression and cellular localization

during osmotic and desiccation stress (Riedel and Lehner 2007). These results may indicate a

possible interaction of these proteins with the cell membrane during stress conditions.

The orfK encodes for a conserved transmembrane protein belonging to the HdeD family.

The hdeD gene is a part of the acid resistance island in E. coli and it is involved in the same

regulatory network as yfdX (Masuda and Church 2003). The HdeD protein participates in an acid

resistance mechanism exhibited only at high cell densities (Mates et al. 2007). In our study, the

role of the orfH-K genes in thermoresistance also was confirmed experimentally. We have

observed that an E. coli strain containing the orfHIJK genes cloned on multicopy plasmid

exhibited more than 2-fold increased D58 value comparing with the value for the control strain

(Fig. 3).

The OrfL gene is probably involved in regulation of gene expression from the

thermotolerance DNA region because this protein shows similarity with the alternative sigma 28

factors of RNA polymerases from several bacteria including Burkholderia ubonensis and

Ochrobactrum anthropi. orfM encodes for a putative thioredoxin, a small protein essential for

the maintenance of proper reduction status of proteins and the cell redox potential. By its redox

activity or by non-oxidative interaction, thioredoxin modulates the activity of many cellular

proteins (Kumar et al. 2004). The OrfN protein showed highest homology to the KefC

glutathione-regulated potassium-efflux protein. This efflux system is involved in detoxification

of toxic metabolites such as methylglyoxal (Roosild et al. 2009).

The OrfP protein is a putative peptidase of the M-48 superfamily homologous to HtpX of

E. coli. This zinc metalloprotease has been shown to participate in the proteolytic quality control

of membrane proteins and its function is closely connected with the FtsH ATP-dependent

protease (Sakoh et al. 2005). A HtpX metalloprotease from an unknown organism with 98%

similarity to Mfla_1159 from M. flagellatus KT and 73% similarity to OrfP was expressed in E.

coli and proved to be proteolytically active and localized in cell inner membrane (Siddiqui at al.

2007). OrfQ was assigned to HtrA/DegP family of proteins, which are periplasmic proteins with

chaperone and protease activity and have been implicated as key players in the control of protein

quality in the periplasmic space of Gram-negative bacteria, in particular during thermal and other

stresses (Kim et al. 2005). The domain structure of OrfQ is most similar to that of DegS from E.

coli, which functions to activate the sigmaE factor.

Conclusion. By measurement of the D58 values, we have observed that Cronobacter, as

well as other enterobacterial strains with the thermotolerance DNA region, have two to ten fold

increased thermotolerance compared to negative strains of the same species (Table 1). However,

we observed also two-fold differences in thermotolerance between thermotolerant strains. These

differences may be due to the presence of additional genes outside this region or due to

differences in the expression of the genes in the thermotolerance region. Involvement of the

OrfD and OrfHIJK in survival at increased temperatures was confirmed experimentally (Bojer et

al. 2010; this study). However, the contribution of particular genes from this region to the

increased thermotolerance is still not understood and their influence on the survival at elevated

temperatures and to resistance to other stress conditions (e. g. to dry and acid stress) must be

further elucidated.

Acknowledgement

This publication is the result of the project implementation: Centre of excellence for

utilization of information bio-macromolecules in disease prevention and in improving of quality

of life (ITMS 26240120027) supported by the Research & Development Operational Programme

funded by the ERDF. This work was also supported by Slovak Research and Development

Agency under the contract No. APVV-27-009705 and by Slovak Ministry of Education under the

contract No. VEGA 1/0344/10. Tomáš Kuchta and Katarína Oravcová from the Food Research

Institute Bratislava are acknowledged for the critical reading of the manuscript.

References

Arroyo C, Condón S, Pagán R (2009) Thermobacteriological characterization of Enterobacter

sakazakii. Int J Food Microbiol 136:110-118.

Baneyx F, Mujacic M (2004) Recombinant protein folding and misfolding in Escherichia coli.

Nat Biotechnol 22:1399-1407.

Bojer MS, Struve C, Ingmer H, Hansen DS, Krogfelt KA (2010) Heat resistance mediated by a

new plasmid encoded Clp ATPase, ClpK, as a possible novel mechanism for nosocomial

persistence of Klebsiella pneumoniae. PLoS ONE 5:e15467.

Breeuwer P, Lardeau A, Peterz M, Joosten HM (2003) Desiccation and heat tolerance of

Enterobacter sakazakii. J Appl Microbiol 95:967–973.

Brown NL, Stoyanov JV, Kidd SP, Hobman JL (2003) The MerR family of transcriptional

regulators. FEMS Microbiol Rev 27:145-163.

Caubilla-Barron J, Hurrell E, Townsend S, Cheetham P, Loc-Carrillo C, Fayet O, Prère M-F,

Forsythe SJ (2007) Genotypic and phenotypic analysis of Enterobacter sakazakii strains from an

outbreak resulting in fatalities in a neonatal intensive care unit in France. J Clin Microbiol 45:

3979-3985.

Chang C-H, Chiang M-L, Chou C-C (2009) The effect of temperature and length of heat shock

treatment on the thermal tolerance and cell leakage of Cronobacter sakazakii BCRC 13988. Int J

Food Microbiol 134:184-189.

Dancer GI, Mah J-H, Rhee M-S, Hwang I-G, Kang D-H (2009) Resistance of Enterobacter

sakazakii (Cronobacter spp.) to environmental stresses. J Appl Microbiol 107:1606-1614.

Doyle SM, Wickner S. (2009) Hsp104 and ClpB: protein disaggregating machines. Trends

Biochem Sci 34:40-48.

Edelson-Mammel SG, Buchanan RL (2004) Thermal Inactivation of Enterobacter sakazakii in

Rehydrated Infant Formula. J Food Prot 67:60-63.

FAO/WHO report (2008) Enterobacter sakazakii (Cronobacter spp.) in powdered follow-up

formulae: Meeting report. Microbiological Risk Assessment Series No. 15, Rome, Italy.

Friedemann M (2007) Enterobacter sakazakii in food and beverages (other than infant formula

and milk powder). Int J Food Microbiol 116:1-10.

Gurtler JB, Kornacki JL, Beuchat LR (2005) Enterobacter sakazakii: A coliform of increased

concern to infant health. Review. Int J Food Microbiol 104:1-34.

Han M-J, Yun H, Lee SY (2008) Microbial small heat shock proteins and their use in

biotechnology. Biotechnol Adv 26:591-609.

Healy B, Cooney S, O'Brien S, Iversen C, Whyte P, Nally J, Callanan JJ, Fanning S (2010)

Cronobacter (Enterobacter sakazakii): An opportunistic foodborne pathogen. Foodborne Pathog

Dis 7:339-350.

Iversen C, Forsythe S (2004) Isolation of Enterobacter sakazakii and other Enterobacteriaceae

from powdered infant formula milk and related products. Food Microbiol 21:771-777.

Iversen C, Lane M, Forsythe SJ (2004) The growth profile, thermotolerance and biofilm

formation of Enterobacter sakazakii grown in infant formula milk. Lett Appl Microbiol 38:378-

Iversen C, Mullane N, McCardel B, Tall BD, Lehner A, Fanning S, Stephan R, Joosten H (2008)

Cronobacter gen. nov., a new genus to accommodate the biogroups of Enterobacter sakazakii,

and proposal of Cronobacter sakazakii gen. nov., comb. nov., Cronobacter malonaticus sp. nov.,

Cronobacter turicensis sp. nov., Cronobacter muytjensii sp. nov., Cronobacter dublinensis sp.

nov., Cronobacter genomospecies 1 and three subspecies, Cronobacter dublinensis subsp.

dublinensis subsp. nov., Cronobacter dublinensis subsp. lausannensis subsp. nov. and

Cronobacter dublinensis subsp. lactaridi subsp. nov. Int J Syst Evol Microbiol 58:1442-1447.

Kim DY, Kim KK (2005) Structure and function of HtrA family proteins, the key players in

protein quality control. J Biochem Mol Biol 38:266-274.

Kucerova E, Clifton SW, Xia X-Q, Long F et al (2010) Genome sequence of Cronobacter

sakazakii BAA-894 and comparative genomic hybridization analysis with other cronobacter

species. PLoS ONE 5:e9556.

Kumar J, Tabor S, Richardson CC (2004) Proteomic analysis of thioredoxin-targeted proteins in

Escherichia coli. Proc Natl Acad Sci USA 101:3759–3764.

Lukashin AV, Borodovsky M (1998) GeneMark.hmm: New solutions for gene finding. Nucleic

Acids Res 26:1107-1115.

Masuda N, Church GM (2003) Regulatory network of acid resistance genes in Escherichia coli.

Mol Microbiol 48:699-712.

Mates AK, Sayed AK, Foster JW (2007) Products of the Escherichia coli Acid Fitness Island

Attenuate Metabolite Stress at Extremely Low pH and Mediate a Cell Density-Dependent Acid

Resistance. J Bacteriol 189: 2759–2768.

Nazarowec-White M, Farber JM (1997) Thermal resistance of Enterobacter sakazakii in

reconstituted dried-infant formula. Lett Appl Microbiol 24:9-13.

Nishino K, Inazumi Y, Yamaguchi A (2003) Global Analysis of Genes Regulated by EvgA of

the Two-Component Regulatory System in Escherichia coli. J Bacteriol 185:2667–2672.

Riedel K, Lehner A (2007) Identification of proteins involved in osmotic stress response in

Enterobacter sakazakii by proteomics. Proteomics 7:1217-1231.

Roosild TP, Castronovo S, Miller S, Li C, Rasmussen T, Bartlett W, Gunasekera B, Choe S,

Booth IR (2009) KTN (RCK) domains regulate K+ channels and transporters by controlling the

dimer-hinge conformation. Structure 17:893-903.

Sakoh M, Ito K, Akiyama Y (2005) Proteolytic activity of HtpX, a membrane-bound and stress-

controlled protease from Escherichia coli. J Biol Chem 280:33305-33310.

Schlicht M, Berens C, Daam J, Hillen W (2006) Random insertion of a TetR-inducing peptide

tag into Escherichia coli proteins allows analysis of protein levels by induction of reporter gene

expression. Appl Environ Microbiol 72:5637-5642.

Schmid M, Iversen C, Gontia I, Stephan R, Hofmann A, Hartmann A, Jha B, Eberl L, Riedel, K,

Lehner A (2009) Evidence for a plant-associated natural habitat for Cronobacter spp. Res

Microbiol 160:608-614.

Siddiqui AA, Jalah R, Sharma YD (2007) Expression and purification of HtpX-like small heat

shock integral membrane protease of an unknown organism related to Methylobacillus

flagellatus. J Biochem Biophys Methods 70:539-546.

Turcovsky I, Kunikova K, Drahovska H, Kaclikova E (2011) Biochemical and molecular

characterization of Cronobacter spp. (formerly Enterobacter sakazakii) isolated from foods.

Antonie Van Leeuwenhoek 99:257-269.

Turnbaugh PJ, Ley RE, Hamady M, Fraser-Liggett CM, Knight R, Gordon JI (2007) The human

microbiome project. Nature 449:804-810.

van Acker J, de Smet F, Muyldermans G, Bougatef A, Naessens A (2001) Outbreaks of

necrotizing enterocolitis associated with Enterobacter sakazakii in powdered milk formula. J

Clin Microbiol 39:293-297.

Vieira J, Messing J (1991) New pUC-derived cloning vectors with different selectable markers

and DNA replication origins. Gene 100:189-94.

Vuilleumier S, Chistoserdova L, Lee M-C et al (2009) Methylobacterium genome sequences: A

reference blueprint to investigate microbial metabolism of C1 compounds from natural and

industrial sources. PLoS ONE 4: no. 5584.

Walsh D, Molloy C, Iversen C, Carroll J, Cagney C, Fanning S, Duffy G (2011) Survival

characteristics of environmental and clinically derived strains of Cronobacter sakazakii in infant

milk formula (IMF) and ingredients. J. Applied Microbiol. 110:697-703.

Williams TL, Monday SR, Edelson-Mammel S, Buchanan R, Musser SM (2005) A top-down

proteomics approach for differentiating thermal resistant strains of Enterobacter sakazakii.

Proteomics 5:4161-4169.

Yu NY, Wagner JR, Laird MR, Melli G, Rey S, Lo R, Dao P, Sahinalp SC, Ester M, Foster LJ,

Brinkman FS (2010) PSORTb 3.0: Improved protein subcellular localization prediction with

refined localization subcategories and predictive capabilities for all prokaryotes. Bioinformatics

26:1608-1615.

Table 1. Thermal tolerance of strains used in the study

Species

Strain

Origin D58 value

Thermotolerance

marker

C. sakazakii ATCC 29544 clinical 122 +

C. sakazakii LMG 2786 clinical 111 +

C. sakazakii ATCC 29004 unknown 188 +

C. sakazakii ILS 744/03 food 126 +

C. sakazakii 061107/08 food 122 +

C. sakazakii ATCC BAA 894 food 59 -

C. sakazakii 220108/52 food 26 -

C. sakazakii 280108/V1 environmental 28 -

C. malonaticus LMG 23826 clinical 107 +

C. malonaticus 120808/24 food 151 +

C. malonaticus 161007/35 food 15 -

C. dublinensis LMG 23823 environmental 44 -

C. turicensis 290708/07 food 22 -

C. turicensis LMG 23827 clinical 20 -

C. muytjensii ATCC 51329 unknown 53 -

Cronobacter sp. 040407/32 food 31 -

C. braakii CCM 3393 faecal 141 +

C. freundii CCM 4475 food 157 +

E. cloacae CCM 1903 clinical 166 +

E. cloacae CCM 2320 faecal 125 +

E. cloacae 41R unknown 127 +

E. cloacae 41S unknown 85 -

E. cloacae 440 food 193 +

E. cloacae 441 food 166 +

E. cloacae KH22 clinical 67 -

E. cloacae KH35 clinical 243 +

E. coli CCM 2024 unkown 21 -

E. coli KL6 clinical 28 -

E. coli KL53 clinical 182 +

Table 2. Predicted open reading frames from the thermotolerance region in C. sakazakii ATCC 29544

Gene Localization

Predicted protein function in stress response Proteins with the highest similarity E value

orfT5 415 - 717 11.5 Transposase IS3 family InsN from

Salmonella Choleraesuis SC-B67

orfT4 774 - 1808 39 Transposase, Mutator family ZP_07133815

from E. coli MS 115-1

orfA 2159 - 2347 6.9 No significant similarity

orfB 2905 - 3081 6.6 Phage transcriptional regulator of MerR superfamily, induction of

downstream genes in stress conditions

ZP_07136235

orfC 3221 - 3790 21.5 Small heat shock protein of the Hsp-20 family

containing α-crystallin domain,

the ATP-independent holding chaperone

ZP_04871399

from Escherichia sp. 1_1_43

2E-106

orfD 3896 - 6745 104.4 ATPase with chaperone activity ClpK,

disaggregation of misfolded and aggregated proteins

ZP_04871398 from Escherichia sp. 1_1_43

ClpK (YP_003864365) from K. pneumoniae

orfE 6745 - 6936 6.2 N-terminal fragment of phospholipase D ZP_04871397 from Escherichia sp. 1_1_43 7E-25

orfF 6997 - 7686 25.3 N-terminal fragment of metalloprotease FtsH YP_002980601 from R. pickettii 12D 3E-109

orfG 7686 - 7826 5.4 C-terminal fragment of metalloprotease FtsH YP_002980601 from R. pickettii 12D 4E-18

orfH 7914 - 8372 17.4 Small heat shock protein of the Hsp-20 family containing α-

crystallin domain, the ATP-independent holding chaperone

YP_003864367 from K. pneumoniae 1E-79

orfI 8395 - 9309 32.4 Conservative protein, YfdX family, unknown function,

link to thermal, osmotic and desiccation stress

orfJ 9412 - 10299 31.9 Conservative protein, YfdX family, unknown function,

link to thermal, osmotic and desiccation stress

orfK 10393 - 11004 22.5 Conservative transmembrane protein, HdeD family,

unknown function, acid tolerance in high densities

3E-105

11084 - 12229 43.6

Conserved hypothetical protein,

RNA polymerase sigma factor

YP_001372996 from O. anthropi ATCC 49188

orfM 12219 - 12659 16.4 Thioredoxin,

reduction status of proteins, modulation of protein activity

ZP_04871395 from Escherichia sp. 1_1_43 2E-81

orfN 12663 - 14372 59.9 Sodium/hydrogen exchanger of KefC family,

glutathione-regulated potassium-efflux systems protein,

methylglyoxal detoxification

ZP_04871394 from Escherichia sp. 1_1_43 0

orfO 14375 - 14872 18.4 Conserved hypothetical protein containing PsiE domain ZP_04871393 from Escherichia sp. 1_1_43 9E-78

orfP 14850 - 15806 34.3 peptidase of the M48 superfamily homologous to HtpX, ZP_04871392 from Escherichia sp. 1_1_43 4E-159

quality controll of inner membrane proteins

orfQ 15831 - 16982 40.5 DegP2 peptidase of HtrA/DegP family,

periplasmic protein with chaperone and protease activity ZP_04871391 from Escherichia sp. 1_1_43 0

orfT3 17207 - 17788 21.5 transposase IS4 family ZP_07136036

orfT2 17754 - 18275 19.6 transposase IS4 family YP_001750208

Pseudomonas putida W619

orfT1 18335 - 18565 9.2 transposase – N-terminal part ISEhe3 transposase B (ADR67042)

from Klebsiella pneumoniae

Figure 1. Alignment of the thermotolerance genomic region in selected bacteria

Regions shown: C. sakazakii ATCC 29544 (FR714908), M. flagellatus KT genes Mfla_1155 –

Mfla_1173 (CP000284), R. picketii 12D chromosome 1 genes Rpic12D_0611 – Rpic12D_0633

(CP001644), Escherichia sp. 1.1.43 genes ESCG_01078 – ESCG_01089 (NZ_GG665811), E.

cloacae ATCC 13047 genes ECL_03692 – ECL_03701 (CP001918).

Legend: homologous genes from the thermotolerance DNA region are shown in the same colour,

genes encoding for transposases are grey, genes with no homology in the Cronobacter

thermotolerance DNA region are white.

Figure 2. Transcription of genes from the thermotolerance region

A) OrfI transcription in different strains during exponential (1-3) and stationary (4-6) growth

phase, tested strains C. sakazakii ATCC 29544 (1, 4), C. sakazakii 210307/19 (2, 5) and E. coli

KL 53 (3, 6), GeneRuler 1 kb DNA Plus, Fermentas (9)

B) Transcription of different genes from thermotolerance region of C. sakazakii ATCC 29544.

Lanes: orfT1-T3 (1), orfQ (2), orfN (3), orfL (4), orfK (5), orfJ (6), orfI (7), orfH (8), orfD (9),

orfB (10), orfT4-T5 (11), GeneRuler 1 kb DNA Plus, Fermentas (12)

A 1 2 3 4 5 6 7 8 9

B 1 2 3 4 5 6 7 8 9 10 11 12

Figure 3. Survival of E. coli transformed with the C. sakazakii thermoresitance DNA

region at 58 ºC

Legend: E. coli XL1 Blue pKK12 containing orfH-K from C. sakazakii ATCC 29544 thermoresistance

region ( , D58 310 s), control E. coli XL1 Blue pUC21( ,D58 129 s)

Analysis of the DNA region mediating increased thermotolerance at 58°C in Cronobacter sp. and other...

Documents