2013 WCU Baseball Yearbook

11 NCAA TOURNAMENT APPEARANCES: 1985 1986 1987 1988 1989 1992 1993 1994 1997 2003 200711-TIME SOUTHERN CONFERENCE BASEBALL REGULAR SEASON CHAMPION 9-TIME SOUTHERN CONFERENCE BASEBALL TOURNAMENT CHAMPION

2013 CATAMOUNT BASEBALLCATAMOUNTSPORTS.COM 1

FEBRUARY

FEB. 15 FRI. WASHINGTON STATE CULLOWHEE 4:00 PM

FEB. 16 SAT. WASHINGTON STATE CULLOWHEE 2:00 PM

FEB. 17 SUN. WASHINGTON STATE CULLOWHEE 12:00 PM

Feb. 19 TUES. WAKE FOREST CULLOWHEE 4:00 pm

Feb. 22 Fri. vs. Michigan State # Greenville, S.C. 1:00 pm

Feb. 23 Sat. vs. Miami (Ohio) # Greenville, S.C. 10:00 am

Feb. 24 Sun. vs. Cincinnati # Greenville, S.C. 3:00 pm

FEB. 26 Tue. LONGWOOD CULLOWHEE 4:00 PM

FEB. 27 Wed. LONGWOOD CULLOWHEE 4:00 PM

MARCH

MAR. 2 SAT. HOFSTRA (DH) CULLOWHEE 12:00 PM

MAR. 3 SUN. HOFSTRA CULLOWHEE 12:00 PM

Mar. 5 Tues. at Georgia Athens, Ga. 5:00 pm

Mar. 8 Fri. at Davidson * Davidson, N.C. 6:00 pm

Mar. 9 Sat. at Davidson * Davidson, N.C. 2:00 pm

Mar. 10 Sun. at Davidson * Davidson, N.C. 1:00 pm

MAR. 13 Wed. EASTERN KENTUCKY CULLOWHEE 5:00 pm

Mar. 15 Fri. at Col. of Charleston * Charleston, S.C. 6:00 pm

Mar. 16 Sat. at Col. of Charleston * Charleston, S.C. 2:00 pm

Mar. 17 Sun. at Col. of Charleston * Charleston, S.C. 1:00 pm

Mar. 20 Wed. at Tennessee Knoxville, Tenn. 6:00 pm

MAR. 22 FRI. ELON * CULLOWHEE 5:00 PM

MAR. 23 SAT. ELON * CULLOWHEE 2:00 PM

MAR. 24 SUN. ELON * CULLOWHEE 1:00 PM

Mar. 26 Tue. at Wake Forest Winston-Salem, N.C. 6:00 pm

Mar. 27 Wed. at Gardner-Webb Boiling Springs, N.C. 6:00 PM

MAR. 29 FRI. THE CITADEL * CULLOWHEE 5:00 PM

MAR. 30 SAT. THE CITADEL * CULLOWHEE 2:00 PM

MAR. 31 SUN. THE CITADEL * CULLOWHEE 1:00 PM

APRIL

APR. 2 TUES. UNC ASHEVILLE CULLOWHEE 5:00 PM

Apr. 3 Wed. at UNC Asheville Asheville, N.C. 3:00 pm

Apr. 5 Fri. at Furman * Greenville, S.C. 6:00 pm

Apr. 6 Sat. at Furman * Greenville, S.C. 4:00 pm

Apr. 7 Sun. at Furman * Greeenville, S.C. 1:00 pm

APR. 9 TUES. CLEMSON CULLOWHEE 6:00 PM

APR. 12 FRI. SAMFORD * CULLOWHEE 5:00 PM

APR. 13 SAT. SAMFORD * CULLOWHEE 2:00 PM

APR. 14 SUN. SAMFORD * CULLOWHEE 1:00 PM

APR. 17 WED. GARDNER-WEBB CULLOWHEE 5:00 PM

APR. 19 FRI. GEORGIA SOUTHERN * CULLOWHEE 5:00 PM

APR. 20 SAT. GEORGIA SOUTHERN * CULLOWHEE 2:00 PM

APR. 21 SUN. GEORGIA SOUTHERN * CULLOWHEE 1:00 PM

APR. 23 TUES. KENNESAW STATE CULLOWHEE 5:00 PM

Apr. 24 Wed. at Clemson Clemson, S.C. 6:30 pm

Apr. 26 Fri. at UNC Greensboro * Greensboro, N.C. 6:00 pm

Apr. 27 Sat. at UNC Greensboro * Greensboro, N.C. 1:00 pm

Apr. 28 Sun. at UNC Greensboro * Greensboro, N.C. 1:00 pm

MAY

May 1 Wed. at Kennesaw State Kennesaw, Ga. 5:00 pm

MAY 3 FRI. TENNESSEE TECH CULLOWHEE 6:00 PM

MAY 4 SAT. TENNESSEE TECH CULLOWHEE 2:00 PM

MAY 10 FRI. WOFFORD * CULLOWHEE 6:00 PM

MAY 11 SAT. WOFFORD * CULLOWHEE 6:30 PM

MAY 12 SUN. WOFFORD * CULLOWHEE 1:00 PM

May 16 Thur. at Appalachian State * Boone, N.C. 6:30 pm

May 17 Fri. at Appalachian State * Boone, N.C. 6:30 pm

May 18 Sat. at Appalachian State * Boone, N.C. 3:00 pm

May 22-26 2013 Southern Conference Greenville, S.C. TBA Baseball Championship

* - denotes Southern Conference Games All times listed are EST# - Greenville Drive Tournament (Fluor Field – hosted by Furman Univ., Greenville, S.C.)

2013 WESTERN CAROLINA CATAMOUNT BASEBALL SCHEDULE


2013 CATAMOUNT BASEBALL CATAMOUNTSPORTS.COM22010101200 3 3 3 3 CATCCCCACATTAMOAMOAMOMOOUNTUUUNTNTNTNTU T BABASBASBASASBASAB EBAEBAEBABEBAEBAEB LLLLLLLLLLLLLLL CATCATCATCATCATCATATTATTATTAMOAMAMOAMOAMOMOMOMOMOMOAAMMOAMOAMOAA UNTUNTUUNTUNTUNTUNTUNTNU SPOSPOSPOSPOSPOSPOSPOSPOPSPPOPORTSRTSRTSRTSRRTSRTSSSRTS.CO.CO.CO.C.CO.CO.COOOO.COO..C MMMMMM2222222222222

TA B L E O F C O N T E N T STA B L E O F C O N T E N T SINTRODUCTION ........................................................................................... 1-10 2013 Catamount Baseball Schedule ...................................................... 1 Quick Facts / Table of Contents .............................................................. 2 Media Information ................................................................................. 3 General Information / What is a Catamount?.......................................... 4 Directions to Cullowhee .......................................................................... 5 Department Role / Mission / Fan Statement .......................................... 6 2013 WCU Baseball Roster .................................................................... 7 2013 Season Preview .......................................................................... 8-9 2013 WCU Projected Depth Chart ........................................................ 10

WESTERN CAROLINA COACHING STAFF ..................................................... 11-18 Head Coach Bobby Moranda ...........................................................12-14 Assistant Coach / Recruiting Coordinator Alan Beck ............................. 15 Assistant Coach Bruce Johnson ............................................................ 16 Assistants Brandon Johnson / Kyle Deese .............................................17 WCU Baseball Support Staff ................................................................ 18

2013 CATAMOUNT PLAYER BIOS ...............................................................19-36 WCU Veterans .................................................................................20-33 WCU Newcomers .............................................................................34-35

2012 SEASON IN REVIEW ..........................................................................37-42 Seasonal Highlights ............................................................................. 38 WCU’s 2012 Results............................................................................. 39 WCU’s 2012 Overall Stats .................................................................... 40 Games Summary / Misc. Stats ............................................................. 41 2012 Southern Conference Recap ........................................................ 42

WESTERN CAROLINA RECORD BOOK .........................................................43-94 WCU Team Season Stats From 1969-pres. ............................................ 44 Game / Season / Career Records ......................................................... 45 WCU’s Triple Crown Winners ................................................................. 46 WCU Single-Season Records ...........................................................46-49 WCU Career Leaders .......................................................................50-52 WCU Annual Category Leaders ........................................................53-54 WCU Baseball Honors .....................................................................55-56 In the SoCon Record Books .................................................................. 57 WCU All-Americans .........................................................................58-59 SoCon Tournament / Regional History .............................................60-61 WCU Head Coaches ........................................................................62-63 Year-by-Year Scores .........................................................................64-76 All-Time Series History ....................................................................77-85 Record vs. All Opponents ...................................................................... 86 All-Time Letter Winners ...................................................................87-89 Catamounts in Professional Baseball ..............................................90-91 WCU Athletics Hall of Fame .............................................................92-94

WESTERN CAROLINA UNIVERSITY ............................................................ 95-111 Western Carolina University .............................................................96-97 Campus Life ....................................................................................98-99 Spirit, Pride & Tradition ...............................................................100-101 WCU Chancellor, Dr. David Belcher ..............................................102-103 WCU Athletics Director, Mr. Randy Eaton .....................................104-105 Administrative Staff ........................................................................... 106 WCU Athletics Staff Directory ............................................................. 107 Childress Field at Hennon Stadium ..............................................108-109 This is the Southern Conference................................................... 110-111

The 2012 Western Carolina Baseball Media Guide was designed, written and edited by Assistant Athletic Director for Media Relations, Daniel Hooker (Western Carolina, 2001), who also designed the four covers. Statistical, editorial and graphic assistance provided by Media Relations Assistant, Bryan Powell, with research assistance provided by Director of Media Relations, Denise Gideon.

Special thanks to Mike Cawood, Steve White, the Western Carolina baseball staff and additional WCU Sports Information predecessors in compiling information.

Special thanks to Mark Haskett (WCU Public Relations) for his dedication, patience and timeliness with various photography. Also, thanks to Ashley Evans and Jarrett Frazier in the WCU Public Rela-tions photography department. Other photos credited to Danny Hirt, Teddy Greene, Harry Duke and a variety of unknown sources.

Printing was completed by the WCU Print Shop (828) 227-7159.

C ATA M O U N T Q U I C K FA C T SC ATA M O U N T Q U I C K FA C T SGENERAL INFORMATION:GENERAL INFORMATION:School Name:School Name: .......................................................... ..........................................................Western Carolina UniversityWestern Carolina UniversityLocation:Location: .................................................................... ....................................................................Cullowhee, N.C. – 28723Cullowhee, N.C. – 28723..........................................................................................................................................................................................Pronounced “KULL - uh - whee”Pronounced “KULL - uh - whee”Founded:Founded: .................................................................................................. ..................................................................................................18891889Enrollment:Enrollment: .............................................................................................. .............................................................................................. 9,3619,361Nickname:Nickname: ...................................................................................... ......................................................................................CatamountsCatamountsColors:Colors: ...................................................................................... ......................................................................................Purple and GoldPurple and GoldSeating Capacity:Seating Capacity: ..................................................................................... .....................................................................................1,5001,500Affi liation:Affi liation: .................................................................................. .................................................................................. NCAA Division INCAA Division IConference:Conference: ........................................................................................ ........................................................................................ SouthernSouthernChancellor:Chancellor: ................................................ ................................................ Dr. David O. Belcher (Furman, 1979)Dr. David O. Belcher (Furman, 1979)Director of Athletics:Director of Athletics: ................................. ................................. Randy Eaton (UT-San Antonio, 1990)Randy Eaton (UT-San Antonio, 1990)Athletic Department Phone:Athletic Department Phone: ..................................................... ..................................................... (828) 227-7338(828) 227-7338Ticket Offi ce Phone:Ticket Offi ce Phone: ................................................................ ................................................................(800) 34-GOWCU(800) 34-GOWCUWebsite (Streaming Audio):Website (Streaming Audio): ..................................... .....................................www.CatamountSports.comwww.CatamountSports.comFacility:Facility: ......................................... .........................................Ronnie G. Childress Field at Hennon StadiumRonnie G. Childress Field at Hennon Stadium

325 (LF) | 375 (LC) | 390 (CF) | 375 (RC) | 325 (RF)THE “PURPLE MONSTER” in LEFT FIELD

Sec. I: 20’ tall & 50’ long – Sec. II: 14’ tall & 50’ longBATTER’S EYE IN CENTER FIELD

20’ tall & 50’ long

WESTERN CAROLINA COACHING STAFF:WESTERN CAROLINA COACHING STAFF:Head Coach:Head Coach: ......................................... .........................................Bobby Moranda (Eastern Kentucky, ‘86)Bobby Moranda (Eastern Kentucky, ‘86)Record at Western Carolina:Record at Western Carolina: ......................................... .........................................156-126-2, fi ve seasons156-126-2, fi ve seasonsCareer Record:Career Record: .......................................................................................... ..........................................................................................SameSameAssistant Coaches:Assistant Coaches:..............................................................Alan Beck (Western Carolina, ‘04) – seventh season at WCUAlan Beck (Western Carolina, ‘04) – seventh season at WCU..........................................................Bruce Johnson (Western Carolina, ‘10) – sixth season at WCUBruce Johnson (Western Carolina, ‘10) – sixth season at WCU............ Brandon Johnson (Western Carolina, ‘11) – Volunteer Assistant, 2nd seasonBrandon Johnson (Western Carolina, ‘11) – Volunteer Assistant, 2nd season.............................. Kyle Deese (Western Carolina) – Undergraduate Assistant, 1st seasonKyle Deese (Western Carolina) – Undergraduate Assistant, 1st seasonBaseball Offi ce:Baseball Offi ce: ....................................................................... ....................................................................... (828) 227-7338(828) 227-7338Athletic Trainer:Athletic Trainer: ................................................. ................................................. David Pryor (Slippery Rock, ‘06)David Pryor (Slippery Rock, ‘06)Athletic Performance:Athletic Performance: ....... .......Nick White (North Georgia College & State Univ., ‘12)Nick White (North Georgia College & State Univ., ‘12)

TEAM INFORMATION:TEAM INFORMATION:2012 Overall Record: .................. 32-24 (19-7 Home; 12-14, Road; 1-3 Neutral)2012 SoCon Record: ............................................ 16-14 (10-5 Home; 6-9 Away)2012 SoCon Finish: ..................................................................................... 5thLetterwinners Returning / Lost: ............................................................... 23 / 5 Starters Returning / Lost: ..........................................................................7 / 1 Staring Pitchers Returning / Lost: ............................................................. 4 / 0 Newcomers: .................................. 13 (including freshmen, transfers, walk-on)

PROGRAM HISTORY:PROGRAM HISTORY:SoCon Championships:SoCon Championships: ............................ ............................ 20 (11 regular season; 9 tournament)20 (11 regular season; 9 tournament)NCAA Appearances:NCAA Appearances: .................................................... .................................................... 11 (13-22 overall record)11 (13-22 overall record)

19 8 5 , ‘ 8 6 , ‘ 87 , ‘ 8 8 , ‘ 8 9 , ‘ 9 2 , ‘ 9 3 , ‘ 9 4 , ‘ 97 , 2 0 0 3 , ‘ 0719 8 5 , ‘ 8 6 , ‘ 87 , ‘ 8 8 , ‘ 8 9 , ‘ 9 2 , ‘ 9 3 , ‘ 9 4 , ‘ 97 , 2 0 0 3 , ‘ 07

WESTERN CAROLINA MEDIA RELATIONS:WESTERN CAROLINA MEDIA RELATIONS:Asst. AD/Media Relations (Baseball Contact):Asst. AD/Media Relations (Baseball Contact): .............................. ..............................Daniel HookerDaniel HookerE-Mail:E-Mail: ......................................................................... ......................................................................... [email protected]@email.wcu.eduOffi ce Phone: Offi ce Phone: .......................................................................... .......................................................................... (828) 227-2339(828) 227-2339Cell Phone:Cell Phone: .............................................................................. .............................................................................. (828) 508-2494(828) 508-2494Offi ce Fax:Offi ce Fax: ................................................................................ ................................................................................ (828) 227-7688(828) 227-7688Hennon Stadium Press Box Phone:Hennon Stadium Press Box Phone: ........................................... ........................................... (828) 227-7020(828) 227-7020Mailing Address:Mailing Address: ...................................................... ......................................................Western Carolina UniversityWestern Carolina University Ramsey Center – Athletics Ramsey Center – Athletics Cullowhee, N.C. 28723 Cullowhee, N.C. 28723

2013 CATAMOUNT BASEBALL CATAMOUNTSPORTS.COM2


2013 CATAMOUNT BASEBALLCATAMOUNTSPORTS.COM 3 2012012012012012012220 33 333 CATCACATACATCATCATCATATA AMOAMOAMOAMAMOMMOUNTUNTUNTNTUNTUUN BASBASBASBB EBEBAEBAAAEBAE LLLLLLLLLLCATCATATCATATATATATCATCA AMOAMOAMOAMOOOOAMAMOOOAMMAMOM UNTUNTUNTUNTNTUNUNN SPOSPOSPOSPOPOSPOPOSSSSPOS OSSS RTSRRTSRTRTSTSTTSSR .COO.CO.CO.COCO..COCOOOOOMMMMMMM 333333333333

INTERVIEW POLICY:INTERVIEW POLICY:The Western Carolina Media Relations Offi ce will assist media personnel with in-The Western Carolina Media Relations Offi ce will assist media personnel with in-terview requests of WCU student-athletes, coaches or administrators. To arrange terview requests of WCU student-athletes, coaches or administrators. To arrange interviews, please contact Daniel Hooker at least 24 hours in advance. Head interviews, please contact Daniel Hooker at least 24 hours in advance. Head Coach Bobby Moranda will be available for interviews prior to or following each Coach Bobby Moranda will be available for interviews prior to or following each practice. With prior notice, student-athletes will be available for interviews at that practice. With prior notice, student-athletes will be available for interviews at that time as well. Unless special permission is granted well in advance, no interviews time as well. Unless special permission is granted well in advance, no interviews of student-athletes or coaches will be conducted on game days until a 10-min-of student-athletes or coaches will be conducted on game days until a 10-min-ute cooling off period after the contest. Media members may attend practices ute cooling off period after the contest. Media members may attend practices after obtaining clearance through the media relations offi ce. Media members are after obtaining clearance through the media relations offi ce. Media members are asked to refrain from contacting student-athletes at their home or residence halls; asked to refrain from contacting student-athletes at their home or residence halls; student-athletes’ phone numbers will not be released by the WCU Department of student-athletes’ phone numbers will not be released by the WCU Department of Athletics. Out-of-town media may set up phone interviews. Head Coach Bobby Athletics. Out-of-town media may set up phone interviews. Head Coach Bobby Moranda may be reached weekday mornings, however, it is asked that a specifi c Moranda may be reached weekday mornings, however, it is asked that a specifi c interview time be scheduled.interview time be scheduled.

WORKING CREDENTIALS:WORKING CREDENTIALS:Newsprint and electronic media representatives planning to cover a baseball Newsprint and electronic media representatives planning to cover a baseball game at Western Carolina University are asked to request in written form (E-mail game at Western Carolina University are asked to request in written form (E-mail or FAX) working credentials from WCU’s Media Relations Offi ce. Season passes or FAX) working credentials from WCU’s Media Relations Offi ce. Season passes will be issued to those who cover the Catamounts on a permanent basis. Press will be issued to those who cover the Catamounts on a permanent basis. Press passes will be assigned by priority to WCU beat writers, beat writers of the oppo-passes will be assigned by priority to WCU beat writers, beat writers of the oppo-nents, metropolitan media fi ling for deadline and specialty publications. If time nents, metropolitan media fi ling for deadline and specialty publications. If time permits, credentials will be mailed. If not, credentials can be picked up on game permits, credentials will be mailed. If not, credentials can be picked up on game day (two hours prior to fi rst pitch) at the Hennon Stadium ticket booth. Credentials day (two hours prior to fi rst pitch) at the Hennon Stadium ticket booth. Credentials will be issued only to those attending the game in a working capacity. Spouses, will be issued only to those attending the game in a working capacity. Spouses, dates, children and other nonworkers will dates, children and other nonworkers will NOTNOT be permitted in the press box. be permitted in the press box.

PHOTOGRAPHERS:PHOTOGRAPHERS:Credentials for photographers will be issued on a fi rst-come, fi rst-serve basis with Credentials for photographers will be issued on a fi rst-come, fi rst-serve basis with agencies covering the participating schools on a regular basis receiving priority. agencies covering the participating schools on a regular basis receiving priority. Each photographer must pick up a photo pass prior to the game. Photographers Each photographer must pick up a photo pass prior to the game. Photographers will shoot from designated areas. Photographers wishing to take fi eld-level pho-will shoot from designated areas. Photographers wishing to take fi eld-level pho-tos must do so along the fences beyond the dugouts towards the outfi eld.tos must do so along the fences beyond the dugouts towards the outfi eld.

VISITING RADIO BROADCASTS:VISITING RADIO BROADCASTS:The visiting radio station or network (limited to one crew only as designated The visiting radio station or network (limited to one crew only as designated through the visiting team’s sports information offi ce) is asked to request creden-through the visiting team’s sports information offi ce) is asked to request creden-tials through Western Carolina’s Media Relations offi ce. A B-1 dialtone line will tials through Western Carolina’s Media Relations offi ce. A B-1 dialtone line will be provided at no charge to all Southern Conference opponents and to others who be provided at no charge to all Southern Conference opponents and to others who wish to enter into a reciprocal agreement with WCU. Otherwise, the lines are avail-wish to enter into a reciprocal agreement with WCU. Otherwise, the lines are avail-able to visiting radio crews on a pro rata basis. Any additional special broadcast able to visiting radio crews on a pro rata basis. Any additional special broadcast lines, such as ISDN, can be ordered through Frontier Communications.lines, such as ISDN, can be ordered through Frontier Communications.

CATAMOUNTS ON THE WEB, ONLINE BROADCASTS:CATAMOUNTS ON THE WEB, ONLINE BROADCASTS:The WCU baseball home page provides the latest information regarding the Cata-The WCU baseball home page provides the latest information regarding the Cata-mounts including updated statistics, rosters, and press releases. For those unable mounts including updated statistics, rosters, and press releases. For those unable to attend contests, the Catamount Sports Network will broadcast select games to attend contests, the Catamount Sports Network will broadcast select games over the Internet as well – those games can be heard online through Stretch In-over the Internet as well – those games can be heard online through Stretch In-ternet services at www.CatamountSports.com. In addition, live stats will be made ternet services at www.CatamountSports.com. In addition, live stats will be made available for all WCU baseball home games via GameTracker on:available for all WCU baseball home games via GameTracker on:

WWW.WWW.CATAMOUNTCATAMOUNTSPORTSSPORTS.COM.COMSOUTHERN CONFERENCE MEDIA SERVICES:SOUTHERN CONFERENCE MEDIA SERVICES:

The Southern Conference maintains a comprehensive site on the world wide web The Southern Conference maintains a comprehensive site on the world wide web at www.SoConSports.com. Complete baseball standings, weekly game notes, at www.SoConSports.com. Complete baseball standings, weekly game notes, schedule/results and statistics for each league member are updated on a timely schedule/results and statistics for each league member are updated on a timely basis. Similar information on the SoCon’s other 18 sports are available as well. basis. Similar information on the SoCon’s other 18 sports are available as well. Please contact Phil Perry (864) 591-5100 in the SoCon Public Affairs for addi-Please contact Phil Perry (864) 591-5100 in the SoCon Public Affairs for addi-tional information.tional information.

PRINT MEDIA OUTLETSASSOCIATED PRESS

Joedy McCreary, Sports Editor4020 W. Chase Blvd., Suite 300

Raleigh, NC 27606-3933(919) 510-8937 - phone

[email protected]

ASHEVILLE CITIZEN-TIMESBob Berghaus, Sports Editor

Tyler Norris Goode, WCU Beat Writer14 O’Henry Avenue

Asheville, NC 28802(828) 232-5866 - phone

[email protected]

FRANKLIN PRESSAndy Scheidler, Sports Editor

PO Box 350Franklin, NC 28734

(828) 524-2010 - [email protected]

HENDERSONVILLE TIMES-NEWSRon Wagner, Sports Editor

PO Box 490Hendersonville, NC 28739

(828) 692-0505 - [email protected]

SMOKY MOUNTAIN TIMESKyle Dixon, Teddy Greene (photo)

PO Box 730Bryson City, NC 28713

(828) 488-2189 - phone

SYLVA HERALD & RULARITECarey Philips, Sports Editor

Box 307Sylva, NC 28779

(828) 586-2611 - phone(828) 586-2637 - FAX

[email protected]

WESTERN CAROLINA MEDIA OUTLETSWAYNESVILLE ENTERPRISE-MOUNTAINEER

Chuck Fiebernitz, Sports EditorDrawer 19

Waynesville, NC 28786(828) 452-0661 - phone

[email protected]

WESTERN CAROLINIANSports Editor

PO Box 66Cullowhee, NC 28723

(828) 227-7267

ELETRONIC MEDIA OUTLETSWLOS-TV (ABC)

Stan Pamfi lis, Sports DirectorLuke Notestine, Sports Anchor

110 Technology DriveAsheville, NC 28803

(828) 651-4563 - phone(828) 651-4618 - FAX

[email protected]

WWCU RADIO (90.5 FM)Western Carolina University

Old Student UnionCullowhee, NC 28723

(828) 227-7173 - phone

WRGC RADIO (540 AM)Roy Burnette, General Manager

Box 1044Sylva, NC 28779

(828) 586-9742 - phone

WISE RADIO (1310 AM)Bill McClement, Programming Director

Pat Ryan, WISE Guys90 Lookout Road

Asheville, NC 28804(828) 259-9695 - phone




Fight on! You Catamounts,Fight for purple and gold.

Fight on to victory, True warriors bold.Wave the royal banner high,

And let it fi ll the Western sky.So, fi ght on! you Catamounts, Fight to vic-to-ry!

Western, Western, Go-Western!Go—Cats!

Fight on! You Catamounts,Fight for purple and gold.

Fight on to victory, True warriors bold.Wave the royal banner high,

And let it fi ll the Western sky.So, fi ght on! you Catamounts, Fight to vic-to-ry!

– Adopted in 1981, Western’s fi ght song wascomposed by members of the University faculty

Hail to thee, our Alma Mater Faithful, kind, and true;Every son and every daughter Offers praise to you.

- Chorus - Hail to the dearest spot of all; Hail to WCU!

Light and life and fond devotion All to thee are due.

Purple robes and colors golden, Streaming everywhere,Swell our hearts with pride for olden Days and friendships dear.

- Chorus - Under shade trees’ friendly bowers, Voices, ever gay,

Mingles with breath of fl owers And the song birds’ lay. - Chorus -

Shout aloud with one loud chorus, Voices clear and true,Lifted high in praise and honor, All for WCU!

- Chorus -

WESTERN CAROLINA FIGHT SONG WESTERN CAROLINA ALMA MATER

WESTERN CAROLINA ATHLETICS MEDIA RELATIONS

Daniel Hooker, Western Carolina ‘01Assistant Athletics Director for Media Relations

Catamount Baseball ContactOffi ce: (828) 227-2339Cell: (828) 508-2494

E-Mail: [email protected]

Hennon Stadium Press Box: (828) 227-7020Fax : (828) 227-7688

DENISE GIDEONDirector of Media Relations

[email protected] HOOKER

Assistant Athletic Directorfor Media Relations

WILL ADAMSMedia Relations [email protected]

WCU PRESS BOX / GAME DAY STAFFBaseball Game Day Admin.: ........................... Todd LawingWCU Promotions Contact: ......................... Lindsey LessingPublic Address Announcers: .......Jeff Bryson & Josh ThompsonPress Box / Game Day Assistants:

Ross Brown ...................................................David FoxClay Cantler ........................................... Hayley HensonChris Downey .............................................. Brad NorthRoyce Dunnivan ..................................... Andrew Wyrick



From Asheville, N.C.:Take I-40 West to Exit 27 (Clyde / Waynesville / Murphy / Maggie Valley) onto HWY 74 West/US 23 South. Stay on HWY 74W / US 23S to Exit 85 in Sylva. Take a left at the third traffi c light (where the road dead-ends) and follow NC Rt. 107 South to Cullowhee and Western Carolina University.

From Charleston, S.C.:Take I-26 West to Asheville; follow the same directions as listed above.

From Knoxville, Tenn.:Take I-40 East to Exit 20 (Maggie Valley) onto HWY 276. Stay on 74W to Exit 85 in Sylva. Take a left at the second traffi c light and follow Rt. 107 South to Cullowhee and WCU.

From Charlotte, N.C. — You have three options: Take I-77 North to Statesville. Take I-40 West to Asheville and follow the same directions listed above. Take I-85 South to Spartanburg, S.C. Take I-26 West to Asheville and follow the directions from Asheville above. Taking I-85 South, at Kings Mountain, take Highway 74 to I-26. Take I-26 West to Asheville and follow the directions from Asheville above.

From Atlanta, Ga.:Take I-85 North to Rt. 985 North. Stay on 985 until you reach 441. Stay on 441 until you get to Dillsboro, N.C. Take Rt. 107 South, which takes you into Cullowhee and WCU.

BasketballMedia

Parking



The Department of Athletics at Western Carolina University is an integral program of the institution and exists solely to complement the central University mission of teaching and learning. The University seeks to create a community of schol-arship in which the activities of its members are consistent with the highest standards of knowledge and practice in their disciplines. The athletics program refl ects this commitment to highest standards and shares the responsibility of achieving the goals of the University.

The activities of the athletics program provide an environment in which student, coaches, faculty, staff and administrators jointly assume the responsibility for the success on and off the fi eld of play. The athletics program embraces the concept that student-athletes are fi rst and foremost students — possessing academic goals, personal interests, and vocational am-bitions not unlike those of any other student. The athletics program complements other University programs by enhancing the educational, social, career and athletic opportunities of the students who participate in athletics. This environment also fosters a commitment to high standards of personal and professional conduct by all members of the athletic community manifested in the highest level of sportsmanship.

Western Carolina University is committed to ensuring equitable participation and treatment of men and women of all races and ethnic origins. The athletics program actively promotes an environment in which fair and equitable distribution of athletic opportunities, benefi ts, and resources are available to all athletics program participants, and in which any person is free from discrimination.

The athletics program provides signifi cant contributions to the University by enhancing loyalty to the alma mater, strength-ening the pride and enthusiasm of alumni, fostering a strong sense of community, and serving as a positive public relations tool for the University.

Western CarolinaCode of Fan Conduct

It is the policy of Western Carolina Universitythat all Fans at athletic sporting events

must maintain the highest degree ofcredibility and decorum possible.

All fans must make every attempt to conductthemselves in a manner as not to embarrass

the institutions by their actions.

Behavior by fans that does not meet thisstandard and which has the potential of harming

the reputation of the institution or anyof its units is prohibited.

Good sportsmanship must be an integralpart of every sport sponsored by WCU. The

ethical environment of the university must assertand refl ect primacy of human dignity, must encourage

growth and achievement, and mustinsist on respect in all interpersonal relations.

WCU students and fans must be heldaccountable for their use of profane and

vulgar language, banners, posters, signs, fl ags,treatment of opponents, and treatment of offi cials.

In respect to NCAA policies, WCU is heldaccountable for the actions of its fans.

Southern ConferenceCode of Spectator

Conduct

Southern Conference teams shall be supportedwith enthusiasm and dedication, for strong

spectator support is a vital part of the experienceof college competition.

We expect good sportsmanship from playersand coaches. They have a right to expect

the same from spectators.

Therefore, we urge Southern Conference students,alumni and friends to cheer their teams to victory

while upholding those ideals our collegesand universities have nurtured during the long history

of the Southern Conference.

Our spectators should be courteous and judiciousin choice of expression, and should exhibitgood manners and kindness to all others.

The scoreboard will refl ect the quality of the teamsin competitions while the kind of support given

by the spectators will reveal the character ofSouthern Conference fans.

I N T E R C O L L E G I A T E A T H L E T I C SR O L E A N D M I S S I O N

Western Carolina University Athletics’ vision is to be the best place to be a student-athlete in the Southern Conference The fi rst question that this statement causes to surface is, “What does ‘best place’ mean?” For the Athletics Department (Athletics), it means all of the following:

• ACADEMICS – Athletics will become the number one program among the public institutions in The Southern Conference (SoCon) for graduation rates for its student-athletes. Athletics is committed to ensuring that every student-athlete gradu-ates. This means giving greater attention to study halls, tutoring, and other means of coping with the additional pressures student-athletes face in balancing their academic and athletics goals.

• WINNING – Athletics is committed to upgrading its competitiveness and dominating the SoCon in all sports by compet-ing for and winning Conference championships and post-season competitions.

• SUPPORT – Athletics has fostered support (fi nancial and attendance) based on shared ownership among the following groups: University Administration; Faculty/Staff; Student Body; Alumni; Community.

• PEOPLE – Athletics personnel includes coaches, administration and support staff are highly skilled at what they do and determined to help the student-athletes realize a meaningful and enjoyable experience during their tenure at WCU.

• LIFE SKILLS – Athletics maintains a vibrant Life Skills program which is a model in the SoCon. Support for this program continues to foster the growth of student-athletes by emphasing the following commitments: academic excellence, athletic excellence, personnel development, career development and service.

• FACILITIES – Athletic facilities are comparable to or better than any of those within SoCon.

• COMPETITION – Athletics has enhanced its level of competition, thereby increasing the quality of play within the SoCon and the possibilities for post-season opportunities.

• ATTITUDE – Athletics has developed a winning attitude. This sustained attitude, coupled with real success, has created a new winning tradition for Western.

• GENDER AND MINORITY EQUITY – The athletics program refl ects its commitment to ensuring equitable participation and treatment of men and women of all races and ethic origins.

I N T E R C O L L E G I A T E A T H L E T I C SV I S I O N



2 0 1 3 W E S T E R N C A R O L I N A C ATA M O U N T B A S E B A L L R O S T E R NO. NAME POS. B/T HT. WT. CL. HOMETOWN / PREVIOUS SCHOOL / HIGH SCHOOL 1 Bradley Strong INF L/R 5-8 165 So. Richlands, Va. / Richlands HS 2 Aaron Attaway INF R/R 5-8 170 Jr. Morganton, N.C. / Patton HS 3 J.D. Long INF R/R 5-9 165 Fr. Waxhaw, N.C. / Cutherbertson HS 4 Julian Ridings OF L/R 6-2 170 Jr. Shelby, N.C. / Crest HS 5 Luke Gragg C/OF L/R 5-6 160 Jr. Moravian Falls, N.C. / Wilkes Central HS 6 Bryce Danielson LHP L/L 6-1 165 R-So. Etowah, N.C. / Wingate / West Henderson HS 8 Dale Urquhart Jr. OF R/R 5-10 220 So. Hope Mills, N.C. / Southview HS 11 Adam Martin C R/R 6-2 235 Jr. Marietta, Ga. / Harrison HS 12 Cody Jones OF L/L 6-1 205 Jr. Enka, N.C. / Enka HS 14 Dykota Spiess OF/INF L/R 6-2 200 Jr. Morganton, N.C. / Patton HS 15 Jason Smith C/INF R/R 5-11 210 Fr. Kernersville, N.C. / Robert B. Glenn HS 16 Colton Davis RHP R/R 6-1 185 Fr. Commerce, Ga. / Commerce HS 17 William Frazier LHP L/L 5-10 155 Fr. Charlotte, N.C. / Charlotte Country Day School 18 Reece Strong INF L/R 5-8 170 Fr. Richlands, Va. / Richlands HS 19 Danny Schneider RHP R/R 6-5 225 So. Roswell, Ga. / Mount Pisgah Christian 20 Tyler White INF R/R 5-11 220 Sr. Forest City, N.C. / Chase HS 21 Danny Bermudez C R/R 5-11 205 Fr. Cumming, Ga. / Forsyth Central HS 22 Morgan McKinney LHP L/L 6-3 200 R-Sr. Gainesville, Fla. / Santa Fe CC / Buchholz HS 26 Tyler Powell RHP R/R 6-5 210 So. Charlotte, N.C. / Myers Park HS 27 Jacob Hoyle 1B/LHP L/L 6-2 250 So. Hickory, N.C. / St. Stephen HS 28 Jordan Smith RHP R/R 6-1 210 Jr. Liberty, N.C. /Providence Grove HS 29 Thomas Young RHP L/R 6-4 165 Fr. Cary, N.C. / Panther Creek HS 30 Preston Hatcher RHP R/R 6-2 210 Sr. Atlanta, Ga. / Roswell HS 31 John McClure LHP L/L 6-5 210 Jr. Albemarle, N.C. / USC Lancaster /Albemarle HS 32 Hunter Brister LHP L/L 6-0 190 Sr. Plesant Grove, Ala. / Gadsden State / Pleasant Grove HS 33 Austin Neary INF R/R 6-3 210 So. Baltimore, Md. / Archbishop Spalding HS 34 Jon Nadale LHP L/L 5-11 210 Sr. Petaoma, Calif. / Santa Rosa JC / Petaloma HS 36 Alex Barr LHP L/L 6-1 235 Fr. Hamptonville, N.C. /Starmount HS 39 Dillon Bray LHP L/L 5-11 200 Fr. Hamptonville, N.C. / Starmount HS 40 Adam Curtis LHP L/L 6-0 185 Sr. Arden, N.C. / T.C. Roberson HS 44 Bryant Noteboom OF R/R 6-1 220 sr. Smithfi eld, N.C. / Smithfi eld-Selma HS 45 Taylor Sandefur RHP R/R 6-1 225 R-Jr. Mechanicsville, Va. / Atlee HS 46 Jeremy Null RHP R/R 6-8 230 So. Claremont, N.C. / Bunker Hill HS 47 Jonathan Waszak RHP R/R 6-6 245 Fr. Wendell, N.C. / East Wake HS

W E S T E R N C A RO L I N A C OAC H I N G S TA F F : 25 Bobby Moranda Head Coach Eastern Kentucky, 1986 6th Season at WCU 24 Alan Beck Asst. Coach – Recruiting Coordinator Western Carolina, 2004 7th Season at WCU 10 Bruce Johnson Assistant Coach Western Carolina, 2010 6th season at WCU 41 Brandon Johnson Volunteer Assistant Coach Western Carolina, 2012 2nd season at WCU 43 Kyle Deese Undergraduate Assistant Coach Western Carolina 1st season at WCU

PITCHERS (18)

6 Bryce Danielson.........................R-Soph. ....................LHP 16 Colton Davis ...........................Freshman ................... RHP 17 William Frazier ..................... Sophomore ....................LHP 19 Danny Schneider ................. Sophomore ................... RHP 22 Morgan McKinney .....................R-Senior ....................LHP 26 Tyler Powell .......................... Sophomore ................... RHP 28 Jordan Smith ................................Junior ................... RHP 29 Thomas Young ........................Freshman ................... RHP 30 Preston Hatcher ........................... Senior ................... RHP 31 John McClure ................................Junior ....................LHP 32 Hunter Brister .............................. Senior ....................LHP 34 Jon Nadale .................................. Senior ....................LHP 36 Alex Barr .................................Freshman ....................LHP 39 Dillon Bray ..............................Freshman ....................LHP 40 Adam Curtis................................. Senior ....................LHP 45 Taylor Sandefur ......................... R-Junior ................... RHP 46 Jeremy Null .......................... Sophomore ................... RHP 47 Jonathan Waszak ....................Freshman ................... RHP

CATCHERS (2)

11 Adam Martin ................................Junior ........................C 21 Danny Bermudez .....................Freshman ........................C

INFIELDERS (6)

1 Bradley Strong ..................... Sophomore .....................INF 2 Aaron Attaway ..............................Junior .....................INF 3 J.D. Long.................................Freshman .....................INF 18 Reece Strong ..........................Freshman .....................INF 20 Tyler White ................................... Senior .....................INF 33 Austin Neary ........................ Sophomore .....................INF

OUTFIELDERS (5)

4 Julian Ridings ...............................Junior ......................OF 8 Dale Urquhart Jr ................... Sophomore ......................OF 12 Cody Jones ...................................Junior ......................OF 14 Dykota Spiess ...............................Junior ......................OF 44 Bryant Noteboom ........................ Senior ......................OF

UTILITY / MULTIPLE POSITIONS (3)

5 Luke Gragg ...................................Junior ..................OF/C 15 Jason Smith ............................Freshman .................C/INF 27 Jacob Hoyle ......................... Sophomore ............. 1B/LHP

ALPHABETICAL CATAMOUNT ROSTER

2 ATTAWAY, Aaron ............................Junior .....................INF 36 BARR, Alex .............................Freshman ....................LHP 21 BERMUDEZ, Danny .................Freshman ........................C 39 BRAY, Dillon ............................Freshman ....................LHP 32 BRISTER, Hunter .......................... Senior ....................LHP 40 CURTIS, Adam ............................. Senior ....................LHP 6 DANIELSON, Bryce .....................R-Soph. ....................LHP 16 DAVIS, Colton .........................Freshman ................... RHP 17 FRAZIER, William ................. Sophomore ....................LHP 5 GRAGG, Luke ................................Junior ..................C/OF 30 HATCHER, Preston ....................... Senior ................... RHP 27 HOYLE, Jacob ....................... Sophomore ...............INF/OF 12 JONES, Cody .................................Junior ......................OF 3 LONG, J.D. ..............................Freshman .....................INF 11 MARTIN, Adam .............................Junior ........................C 31 McCLURE, John.............................Junior ....................LHP 22 McKINNEY, Morgan ...................R-Senior ....................LHP

34 NADALE, Jon ................................ Senior ....................LHP 33 NEARY, Austin ...................... Sophomore .....................INF 44 NOTEBOOM, Bryant ..................... Senior ......................OF 46 NULL, Jeremy ....................... Sophomore ................... RHP 26 POWELL, Tyler ...................... Sophomore ................... RHP 4 RIDINGS, Julian ............................Junior ......................OF 45 SANDEFUR, Taylor ..................... R-Junior ................... RHP 19 SCHNEIDER, Danny .............. Sophomore ................... RHP 15 SMITH, Jason ..........................Freshman .................C/INF 28 SMITH, Jordan ..............................Junior ................... RHP 14 SPIESS, Dykota.............................Junior ...............OF/INF 1 STRONG, Bradley ................. Sophomore .....................INF 18 STRONG, Reece ......................Freshman .....................INF 8 URQUHART JR., Dale ............ Sophomore ......................OF 47 WASZAK, Jonathan ..................Freshman ................... RHP 20 WHITE, Tyler ................................. Senior .....................INF 29 YOUNG, Thomas ......................Freshman ................... RHP

WCU BASEBALL ROSTER BY POSITION

WCU BASEBALL PRONUNCIATION GUIDE

2 Aaron ATTAWAY .......................AT - uh - way

4 Julian RIDINGS ......................... RYE - dings

8 Dale URQUHART.......................URK - heart

14 DYKOTA SPIESS......... (like Dakota) SPEECE

21 Danny BERMUDEZ ...........BURR - muu - dez

34 Jon NADALE ....................... nuh - DOLL - ee

45 Taylor SANDEFUR ................ SAN - duh - fur

47 Jonathan WASZAK .............. WAUGH - szack

HC Bobby MORANDA ...........More – RAN – duh



2 0 1 3 S E A S O N P R E V I E W2013 WESTERN CAROLINA OVERVIEW:

• WCU was picked second by the league’s head coaches but sixth by the voting media in the offi cial SoCon tabula-tions ... the Catamounts were also tabbed anywhere from fourth by Baseball America; second by CollegeBaseball-Daily.com; and to win that illusive 21st all-time conference championship by College Baseball Today;

• On the hill, WCU returns 30 of its 32 victories (93.8%) including six-game winners in redshirt senior Morgan McK-inney and classmate closer Preston Hatcher, who also had a team-high 10 saves en route to being tabbed fi rst team All- SoCon. Six pitchers – all returners – had four-or-more wins including mid-week starting ace, senior Adam Curtis who had fi ve victories, and weekend hurlers Jordan Smith and All-Freshman selection, Jeremy Null, with four wins apiece;

• All told, WCU’s pitching staff returns 349 of its 399 strikeouts (87.5%) from the 2012 season;

• Western Carolina returns all 56 starts and 30 victories on the mound from last season’s 32-win team, as well as nine of the 10 position starters … WCU returns all three weekend starting pitchers;

• WCU brings back eight hitters which batted over .300 last season including senior Tyler White who hit .354 to help the Catamounts lead the SoCon with a collective .310 aver-age … A total of 128 of the team’s 155 extra base hits are back in the Catamount lineup;

• Five of WCU’s 2013 opponents – and a combined 12 games on the slate – are teams that participated in last year’s NCAA baseball championship tournament ... WCU also faces four teams for the fi rst time in program history including Washington State (Feb. 15-17), Cincinnati (Feb. 24), Longwood (Feb. 26-27) and Hofstra (March 2-3).

CATAMOUNTS NAME 2013 TEAM CAPTAINS:Just before entering fi nal exam week at Western Caro-

lina, the Catamount baseball team announced its team captains for the 2013 season (pictured upper right). Three seniors – RHP relief Preston Hatcher, LHP starter Morgan McKinney and fi rst baseman Tyler White – and one junior in outfi elder Cody Jones have been selected to lead the team.

Hatcher and McKinney led the Catamounts a season ago on the hill, both fi nishing with six victories apiece. Hatcher made a team-high 29 appearances - all out of the bullpen - and led the team with 10 saves to rank tied for second in WCU’s single-season record books and tied for third in the Southern Conference. A native of Atlanta, Ga., Hatcher was also named to the fi rst team All-SoCon by both the league’s head coaches and voting media at the end of 2012.

McKinney made 15 starts on the mound in 2012, tied for the most among WCU’s pitching staff. The Gainesville, Fla., native ranked second among the Catamount starting hurl-ers with a 3.74 ERA with his 68 strikeouts ranking second on the squad and just outside the top 10 in the SoCon.

White was only one of three players to start all 56 games a season ago, leading the team with a .354 (75-for-212) batting average which ranked him fi fth in the SoCon. He legged out 16 of his 37 career doubles a season ago and fi elded an impressive .987 with 414 putouts - mostly at fi rst base. White, a product of Forest City, N.C., is coming off a very solid summer that saw him earn mid-season All-Star plaudits and the Offensive MVP of the All-Star game in the Coastal Plain League with the Gastonia Grizzlies.

The only underclassman selected as a captain, Jones hit .312 a year ago with eight extra base hits, and is coming off a very solid fall performance in the team’s College World Se-

ries intrasquad scrimmages. The Enka, N.C., native started 40-straight games to end the 2012 season making 50 total starts among his 53 combined appearances including 38 in right fi eld. Jones fi nished tied for second on the team with 22 multiple hit games and had four multi-RBI performances and was selected second team all-conference in the outfi eld by the College Sports Madness staff.

FIVE CATAMOUNTS NAMED PRESEASON ALL-SOCON:• Led by preseason All-America selection Preston Hatcher,

Western Carolina put a league-best fi ve players on the pre-season All-Southern Conference team as selected by the conferences’ 11 head coaches ... WCU’s fi ve selections on the preseason squad are the most for WCU since 2008 when a total of six (three fi rst team, three second team) Cata-mounts were honored ... WCU’s four second-team honorees were the most by one team on the second unit;

• Preston Hatcher was a fi rst-team selection and was joined on the preseason All-SoCon team by fellow senior captain Tyler White on the second team ... the duo was fl anked by juniors Aaron Attaway and Julian Ridings, and sophomore Jacob Hoyle as the designated hitter;

• Nine of the 11 SoCon schools placed at least one student-athlete on either the fi rst or second teams as the coaches were not allowed to vote for their own players Elon and Samford trailed the Catamounts with four players listed among the top preseason players in the league. The Phoenix was joined by Appalachian State, sharing SoCon-best hon-ors with three selections on the fi rst team.

POSITION PREVIEW – CATCHERS:Western Carolina has two players that will do the majority

of the catching this season. Junior Adam Martin is an all-conference caliber catcher who will be backed up by true freshman Danny Bermudez. Martin threw out 16 would-be base stealers as a sophomore in 2012, but was also a deep threat at the plate by hitting .281 with 18 extra base hits including nine doubles, two triples and seven home runs.

Freshman Jason Smith is also listed as a catcher on the roster. However, he is expected to sit out the 2013 season, coming off an injury. He will assist at practices and during home games with bullpen catching duties.

Moranda and the Catamounts also have position players Luke Gragg and Bryant Noteboom that could move behind the plate if the situation called for it.

POSITION PREVIEW – INFIELDERS:Western Carolina again returns three-quarters of its solid

infi eld – and should be the strength of the squad as it enters the 2013 season despite having to replace All-SoCon and All-American Ross Heffl ey at second base.

Entering 2013, sophomore Bradley Strong will move from third to second to fi ll the void on the right side of the in-fi eld. Senior Tyler White is expected to move from fi rst base to third base, a position he has played before through high school and summer league baseball.

Junior Aaron Attaway (pictured below) resumes his po-sition at shortstop where he has started all but one career game. Attaway batted .302 as a sophomore collecting 10 doubles and the coaching staff expects a breakout season in 2013 offensively.

At fi rst base, the Catamounts are deep with sophomore Austin Neary expected to start and split time with hard-hitting classmate, Jacob Hoyle. In late game situations, the Catamounts could also move the sure-handed White back to the opposite corner. Hoyle could also see time as the team’s designated hitter, providing another deep threat from the left-side of the plate.

Adding depth for the Catamounts will be freshmen in-fi elders J.D. Long and Reece Strong, the younger brother of second baseman, Bradley.

Western Carolina’s 2013 team captains (l-r): RHP Preston Hatcher, OF Cody Jones, LHP Morgan McKinney and INF Tyler White



2 0 1 3 S E A S O N P R E V I E W

Western Carolina senior pitcher Morgan McKinney has been selected this season’s “Leggett No. 7 Legacy” player as chosen by head coach Bobby Moranda and the Catamount baseball coach-ing staff. McKinney, a left-handed starter, will wear the No. 7 jersey which was made famous at WCU by former coaching great, Jack Leggett.

McKinney, who was voted a 2013 team captain at the conclu-sion of fall workouts, is the third player to have the legacy honor bestowed upon. Former Catamount catcher Stephen Notaro was the fi rst recipient with left-handed pitcher Vance Chavis receiving the honor in 2012.

The annual program was introduced by Moranda at the “Cel-ebration of Catamount Baseball” banquet held on campus in conjunction with the 2011 season-opening weekend that year. The WCU coaching staff selects one player each year that is com-mitted to keeping with the principles and integrity established by the former Catamount skipper during his tenure.

“Among the many great past individuals that have infl uenced the success and the prestige of Western Carolina baseball, Jack Leggett stands out above most. His legacy lives on here every day,” said Moranda of the Leggett Legacy tradition. “Every season, we will name one player who exemplifi es what it is to be a Catamount baseball player and that is deserving to wear the No. 7 jersey to honor the foundation laid by Jack.”

McKinney matched the team’s most victories on the mound in 2012, winning six games. He recorded at least two strikeouts in all but one start, posting fi ve-or-more K’s seven times. In just his second career start, he fanned nine batters in six innings of work in picking up the victory against Fordham. He later struck out a career-best 10 in 6.1 innings against Davidson. He twice worked into the ninth inning against both the College of Charleston and Georgia Southern.

A junior college transfer from Sante Fe College in Gainesville, Fla., prior to the 2011 season, McKinney underwent Tommy John surgery on his pitching elbow in 2010. As a redshirt sophomore in 2011, he ranked second on the WCU squad with 26 relief appearances, used in a left-handed situational role, fi nishing with 9.1 innings pitched.

“It is an honor to bestow upon Morgan the ̀ Leggett No. 7’ for this year,” said Moranda. “He is just outstanding. He went through Tommy John surgery out of junior college, came in here and has worked hard. He spent a year in relief and has really sacrifi ced. His attitude is just ‘A-plus’ in everything he does. He’s tough on the mound, really competes. He’s the perfect Jack Leggett guy.”

Entering his senior season, McKinney has made 41 appearances including 26 out of the bullpen in 2011 and 15 starts a year ago. He’s tossed 93.2 innings with 82 career strikeouts.

To earn the honor of the “Leggett No. 7 Legacy,” a Catamount baseball player must have a passion for the game of baseball; show total intensity daily; do more with less; use adversity as preparation for greatness; and be committed to the ideals of T.E.A.M. by displaying: T-Toughness, E-Effort, A-Approach to fi nd a way to M-Make it Happen.

The fi rst year, catcher Stephen Notaro wore the honorary jersey No. 7 as the fi rst honoree in the Leggett Legacy. Notaro hit .335 overall that season, and fi nished second to Catamount teammate Ross Heffl ey in the SoCon in hitting in league games only a season ago at .394 with six home runs and four doubles with 28 RBI.

In 2012, fi fth-year senior Vance Chavis donned the No. 7 jersey, fi nishing the year with 28 appearances to rank second on the team. The Laurinburg, N.C., native posted a 2.08 ERA through 26.0 innings pitched, striking out 25 batters.

Leggett, who is entering his 20th season on the bench with the Clemson Tigers, spent nine seasons in the dugout in Cullowhee, amass-ing a program-best 302 career victories from 1983 through 1991. He guided the Catamounts to 10 combined Southern Conference championships and fi ve NCAA tournament appearances.

He also helped shape the future of WCU baseball by recruiting and coaching his three successors in Keith LeClair, Rodney Hennon and Todd Raleigh. Leggett’s three protégés combined to win 567 games and a combined eight SoCon titles in 15 seasons, while also capturing fi ve SoCon Coach of the Year honors.

“It is an honor to continue to be remembered in such a manner at Western Carolina,” said Leggett. “WCU and Catamount baseball is a big part of my life and coaching career. I am privileged to have that number 7 hanging on the fence at Childress Field / Hennon Stadium, and honored to have a deserving student-athlete wear the number during the season.”

During his tenure as an assistant coach at Wake Forest, Virginia and Georgia Tech, Moranda coached against Leggett’s Clemson Tiger teams.

MORANDA TABS MORGAN MCKINNEY AS LEGGETT NO. 7 LEGACY RECIPIENT

POSITION PREVIEW – OUTFIELDERS:Patrolling the outfi eld for Moranda will be a solid group

of juniors. WCU is expected to start a trio of juniors from left-to-right across the outfi eld with Dykota Spiess (left), Julian Ridings (center) and Cody Jones (right) penciled in as the season starters. Ridings (pictured at the right) has the tools – speed, solid bat and is good in the outfi eld – that could lead to a junior Major League Baseball draft pick following the 2013 season.

The Catamounts have only one senior in the outfi eld in four-year letterwinner Bryant Noteboom, who is an accom-plished outfi elder who has been an invaluable substitute and pinch hitter the fi rst three seasons in the Purple & Gold.

Adding depth to the outfi eld will be junior Luke Gragg and sophomore Dale Urquhart, Jr., who saw action in 31 games as a freshman. Gragg is likely to see a bulk of time as the team’s designated hitter with Austin Neary possibly join-ing the outfi eld rotation to help provide comfortable depth for Moranda and staff.

POSITION PREVIEW – PITCHERS:Entering the 2013 season, the Catamount pitching staff

fi gures to be one of the best in the Southern Conference from top-to-bottom. WCU returns all three weekend start-ers including redshirt senior LHP Morgan McKinney, junior RHP Jordan Smith and hard-throwing sophomore RHP Jer-emy Null. Smith is the most experienced starter, entering his third season among WCU’s weekend rotation. He has 10 vic-tories and tossed three complete games. McKinney is in his third season in Cullowhee and second as a starter, with Null expected to move from Sunday to the Friday start in 2013.

On the back-end, Moranda expects sophomore RHP Tyler Powell to move into a set-up role with the plan to get the ball to preseason All-American closer, RHP Preston Hatcher, late in games to lock down the save.

Hatcher enters his fi nal season in Cullowhee bearing down on both the single-season and career saves record. The Atlanta, Ga., native collected 10 saves as a junior and is poised to duplicate or improve upon that performance in 2013 and will be critical to the Catamounts’ success.

The Catamounts also return an experienced mid-week starter in senior LHP Adam Curtis who has been a staple in the mid-week rotation during his WCU career. Curtis has eight career victories entering 2013 including a career-best fi ve in 2012.

Western Carolina welcomes back redshirt junior RHP Taylor Sandefur who missed 2012 due to a shoulder injury. The Catamounts are hoping Sandefur can return to form that landed him the Friday night starter role midway through his freshman season in 2011, as well as the Valley League’s top pitcher award.

A trio of returning southpaw relievers will help add depth to the Catamount bullpen, while also being viable options for starts. Seniors Jon Nadale and Hunter Brister are joined by fellow lefty Bryce Danielson, who sat out a year ago after transferring to WCU.

The Catamounts also return RHP Danny Schneider and soft-tossing LHP William Frazier, both of which worked out of the bullpen in 2012. Moranda could also use utility infi elder and designated hitter Jacob Hoyle on the mound for an in-ning or two during the course of the season.

Five true freshmen and a junior college transfer will also fi nd roles on the pitching staff throughout the year. The WCU coaching is very high on hard-throwing right-hander Jona-than Wazak (Wendell, N.C.) who could factor into middle to late inning relief, with fellow righty Colton Davis (Commerce, Ga.) expected to contribute this season.

Left-hander Alex Barr (Hamptonville, N.C.) and former high school teammate Dillon Bray (Hamptonville, N.C.) could see time on the hill with John McClure (Albemarle, N.C.) offering another left-handed option with some colle-giate experience coming out of USC Lancaster. Hard-throw-ing right-hander Thomas Young (Cary, N.C.) could work his way into the pitching rotation as the season progresses.



2 0 1 3 S E A S O N P R E V I E W – P R O J E C T E D D E P T H C H A R T

TOP RELIEF PITCHERS 6 Bryce Danielson ..............R-So. ............. LHP 16 Colton Davis ........................ Fr. .............RHP 26 Tyler Powell ......................... So. .............RHP 30 Preston Hatcher ................... Sr. .............RHP 32 Hunter Brister ...................... Sr. ............. LHP 34 Jon Nadale ...........................Jr. ............. LHP 36 Alex Barr .............................. Fr. ............. LHP 45 Taylor Sandefur ................. R-Jr. .............RHP 47 Jonathan Waszak ................. Fr. .............RHP

WCU STARTING PITCHERS: 22 Morgan McKinney .............R-Sr. ............. LHP 28 Jordan Smith ........................Jr. .............RHP 40 Adam Curtis ........................ Sr. ............. LHP 46 Jeremy Null .......................... Fr. .............RHP CATCHER

11 – ADAM MARTIN, JR. 21 – Danny Bermudez, Fr.

1ST BASE33 – AUSTIN NEARY, SO.

27 – Jacob Hoyle, So.

1ST BASE COACHBruce Johnson

3RD BASE COACHAlan Beck

2ND BASE 1 – BRADLEY STRONG, SO.

18 – Reece Strong, Fr.

SHORTSTOP 2 – AARON ATTAWAY, JR.

3 – J.D. Long, Fr.

CENTER FIELD 4 – JULIAN RIDINGS, JR.

8 – Dale Urquhart, So.LEFT FIELD

14 – DYKOTA SPIESS, JR.5 – Luke Gragg, Jr.

RIGHT FIELD 12 – CODY JONES, JR.44 – Bryant Noteboom, Sr.

3RD BASE 20 – TYLER WHITE, SR.

3 – J.D. Long, Fr.





Bobby MORANDAHEAD COACH

Bobby Moranda was offi cially introduced as the 10th different head baseball coach at Western Carolina on July 19, 2007. The former Georgia Tech associate head coach brought over 23 years of coaching experience – 18 of which comes from schools in the Atlantic Coast Conference – to WCU.

In fi ve seasons at Western Carolina, Moranda has already posted signa-ture victories over fourth-ranked Georgia Tech in the Yellow Jackets fi rst-ev-er trip to Cullowhee, as well as over 24th-ranked Southern California (USC) on the program’s fi rst-ever trip to California. WCU has also secured road wins over Clemson – sweeping the regular season series for the fi rst-time in program history in 2012 – as well as at Georgia and Tennessee and advanced to the Southern Conference tournament championship game during the 2010 season.

He also has a signature victory in the longest game in program and Southern Conference history as WCU outlasted and upset the top-seeded Elon Phoenix in the opening round of the 2011 SoCon Baseball Championship at Riley Park in Charleston, S.C.

During his fi rst season at WCU, Moranda recruited and coached current Catamount second baseman Ross Heffl ey, who was the consensus Southern Conference Freshman of the Year in 2009 and was also a Louisville Slugger Freshman All-America selection. He also had Brent Greer named All-SoCon, with four players drafted out of WCU in the Major League Draft in ‘09. Heffl ey went on to

become a fi rst-team All-America selection at second base at the conclusion of the 2011 season.Since Moranda has been in Cullowhee, 10 players on roster have been drafted by MLB squads including All-America selection Ross Heffl ey (18th Round, Atlanta

Braves) in 2012, with Kyle Deese (23rd Round, St. Louis Cardinals) and Matt Benedict (30th Round, Pittsburgh Pirates) following the 2011 season. Two recruits in the 2011 season – right-handed pitchers Jeremy Null and Tyler Powell – were also drafted in ‘11, both opting to come to WCU in the fall of 2012.

Moranda came to Cullowhee after having spent six seasons as the associate head coach at Georgia Tech where he also served a vital role in recruiting and worked extensively with the pitching staff. Prior to his stint with the Yellow Jackets, he spent six years in a similar role at Wake Forest (1996-2001) and was an assistant coach at both Virginia (1990-95) and his alma mater, Eastern Kentucky (1987-89). Overall, Moranda has been a part of 10 conference championships and 12 NCAA Tourna-ment appearances as either a player or a coach.

Prior to WCU, a combined 19 players that Moranda either recruited or coached have gone on to careers in the Major Leagues. Twelve pitchers have been selected through the top fi ve rounds alone of the Major League Baseball Draft under the tutelage of Moranda. He also helped recruit and coach Matt Wieters, the fi fth pick of the 2007 MLB Draft out of Georgia Tech. In all, Moranda has coached over 65 players who have been selected in the baseball draft, 22 of which were undrafted out of high school.

“I am extremely excited to be the head baseball coach at Western Carolina,” said Moranda after being introduced to the WCU family. “This is an awesome opportu-nity. Catamount baseball has a strong tradition, and I am humbled and honored to now be a part of it. I look forward to embracing and continuing that tradition while raising the bar and elevating our baseball program.”

6th Season – Overall Record of 156-126-2 at WCU(Eastern Kentucky, 1986)



Coaching QUICK FACTSBOBBY MORANDAFULL NAME: Robert Steven Moranda

BIRTHDATE: August 18, 1964

EDUCATION: Bachelor’s degree in Broadcast Management with a minor in Marketing from Eastern Kentucky in 1986; Master’s degree in Recreation Administration from Eastern Kentucky in 1989.

PLAYING EXPERIENCE:Harper Community College, in Palatine, Ill. (1983-84);Eastern Kentucky University, in Richmond, Ky. (1985-86)COACHING EXPERIENCE:Assistant Coach at Eastern Kentucky (1987-98)Head Assistant Coach / Recruiting Coordinator at Virginia (1990-95)Associate Head Coach / Recruiting Coordinator at Wake Forest (1996-2001)Associate Head Coach at Georgia Tech (2002-2007)Head Coach at Western Carolina (2008-present)

During his six seasons at Georgia Tech, Moranda helped guide the Yellow Jack-ets to four Top 10 fi nishes, four Super Regional appearances, three ACC titles and a pair of appearances in the NCAA College World Series in Omaha. In 2002, Geor-gia Tech won a school-record 52 games en route to the CWS thanks in part to a pitching staff which set school records for “Fewest Walks per Nine Innings” (2.54 per 9 IP) and best “Walk to Strikeout” ratio (2.90 to 1) while boasting the best team earned run average since 1994 (4.06) and recorded its most shutouts (6) since 1997. He was also a part of an ACC record 25-straight conference victories with the Jackets.

Amidst the run to the College World Series, Moranda’s work with the Georgia Tech pitching staff was more evident than ever as the starting rotation of Kyle Bak-ker, Chris Goodman and Brian Burks combined for a 5-0 record and 0.77 ERA in NCAA regional play, while the entire staff combined for a 2.40 ERA and held op-ponents to a .208 batting average.

A year later, in 2003, Moranda’s pitching staff helped Tech win the ACC cham-pionship by sweeping the fi rst triple-header in conference history. The Yellow Jack-ets defeated North Carolina, Florida State and NC State on the fi nal day of the tournament to capture the league title. Tech’s 2003 pitching staff again ranked as one of the better staffs in recent GT history. The Yellow Jackets allowed the fewest hits per nine innings in the last 10 years, while posting the second best ERA in that span.

Prior to making the move to Georgia Tech in 2001, Moranda spent the previous six years at Wake Forest where he helped lead the Demon Deacons to three ACC Championships in his last four seasons. For his work, he was recognized by Base-ball America magazine in January 2001 as one of the country’s “Rising Stars” in the college baseball coaching ranks.

After helping lay the groundwork for his fi rst two seasons at Wake Forest as head assistant coach, Moranda helped the Demon Deacons to back-to-back ACC Championships in 1998 and 1999, and a third title in 2001. He helped build the Demon Deacon program into one of the best in the nation through his recruiting efforts and his on-fi eld work with the Wake Forest pitching staff and defense. His pitchers tossed two no-hitters, the school’s fi rst in 60 years.

Moranda’s recruiting classes were annually ranked among the nation’s top classes, while his pitching staffs have attracted national attention from both col-

legiate baseball experts and professional scouts. His recruiting efforts at Wake Forest resulted in six Freshman All-Americans, including the 2001 National Fresh-man of the Year, the 2003 ACC Player of the Year, and the fi rst collegiate draft pick in 2003.

In 1998 his Demon Deacon pitching staff attracted national attention by throw-ing fi ve complete games in the six-game ACC tournament. The feat helped Wake Forest win the 1998 ACC Championship and advance to the NCAA South I Region-al, the Deacons’ fi rst NCAA appearance in 21 years. Moranda and the Deacons followed that 1998 performance with a fi ve game sweep through the 1999 ACC Tournament, a trip to the NCAA Super Regional and a top-10 national ranking.

In his six years at Wake Forest, Moranda consistently developed outstanding pitchers. Ten of his pitchers were selected in the Major League Baseball amateur draft, including six that advanced majors including current players David Bush with Milwaukee Brewers and Mike MacDougal of the Kansas City Royals. Five pitchers earned All-America honors, while his pitchers earned all-ACC accolades seven times in his last fi ve years.

His experience with top pitchers extends back to his days at the University of Virginia, where from 1990 to 1995 Moranda helped lay the groundwork as recruit-ing coordinator that led to the Cavaliers 1996 ACC Championship team.

During his six years in Charlottesville as Virginia’s head assistant coach and recruiting coordinator, the Cavs produced more professional players than the program’s previous 100 years combined. Prior to Moranda’s arrival, Virginia had never produced a fi rst-round draft pick or a fi rst-team All-American. By 1996, however, the Cavaliers had two fi rst round picks among 23 combined players drafted and two fi rst-team All-Americans. Moranda’s star pupils and recruits were outfi elder Brian Buchannan and pitcher Seth Greisinger. Buchannan has played with the San Diego Padres and Greisinger, who starred on the 1996 U.S. Olympic team, reached the Major Leagues in 1998 with the Detroit Tigers.

As a player, Moranda was an All-Region performer at Harper Community Col-lege in Illinois and was part of back-to-back championship teams before accept-ing a scholarship to Eastern Kentucky. The native of Palatine, Ill., batted .307 with 20 home runs and 86 RBI in two seasons at EKU, helping the Colonels win two consecutive Ohio Valley Conference championships and a top-30 national rank-ing. The Colonels made two consecutive NCAA Regional appearances during Mo-randa’s playing career and were just two games away from advancing to Omaha for the College World Series in 1985.

After gaining his undergraduate degree in broadcast management, Moranda stayed at Eastern Kentucky as an assistant coach for three years while working toward his master’s degree in recreation administration, and EKU made an-other NCAA Regional appearance during his tenure. During that time, Moranda also coached an American Legion summer team in Palatine that featured Major League catcher Todd Hundley.

Moranda and his wife Pamela have been married for 19 years. The couple has two children, daughter Taylor Jade and son Breyson Kade.





Western Carolina baseball alum Alan Beck returned to Cullowhee in mid-July, 2008 to join Bobby Moranda’s staff working primarily with the Catamount hitters, as well as serving as the recruiting coordinator.

It is the second-time that the Hudson, N.C., native has coached in Cullowhee. He was on staff as a graduate assistant for two seasons following his graduation from 2004 and ‘05.

Beck returns to WCU after having served as the fi rst-ever Director of Baseball Opera-tions under former Catamount skipper, Todd Raleigh, at the University of Tennessee. His primary responsibilities at UT included man-aging all baseball camps, oversight of stu-

dent managers, serving as an academic liaison and assistance with on-campus recruiting.

Prior to joining the staff at UT, Beck spent the 2007 season as an assistant coach at Young Harris Junior College in Young Harris, Ga. While coaching hitters and infi elders, Beck mentored a club that led all Georgia junior colleges in 10 different offensive statistical categories. The 2007 Mountain Lions won the Re-gion XVII regular season and tournament titles, in addition to claiming the district championship. Beck’s lone season at YHC was highlighted by the school’s fi rst all-time appearance in the Junior College World Series.

Beck ended his four-year career as one of the most outstanding players in both Western Carolina and Southern Conference history. The three-time All-SoCon se-lection (including a pair of fi rst-team honors) ranks on both the school and league career top-10 lists in several statistical categories. He currently ranks third in ca-reer runs (216), third in career RBI (222), third in career total bases (488), fi fth in career hits (285), fi fth in career doubles (60), sixth in career walks (132) and seventh in career home runs (45), while posting a career .341 batting average.

Those numbers additionally ranked on the SoCon all-time lists as he ended his career ranked fourth in RBIs, fi fth in total bases, fi fth in walks, fi fth in runs scored, eighth in hits, eighth in doubles, eighth in at bats, ninth in home runs and 11th in games played (220).

En route to winning SoCon Player of the Year honors in 2003, Beck led the So-Con in home runs (18), RBIs (71), runs scored (67) and walks (45), while rank-ing 30th in the NCAA in homers and tallying seven assists from left fi eld. He was named to the TIAA/CREF Southern Conference All-Academic Team for Spring Sports, was a two-time Southern Conference Player of the Week honoree and was selected second team All-Atlantic Region by the American Baseball Coaches As-sociation.

Beck’s collegiate playing career included numerous other impressive achieve-ments as well. As a junior, he ranked among the SoCon’s top 10 in nine of 12 of-fensive statistical categories. From his sophomore to junior seasons, he authored an impressive streak of reaching base safely (hit, walk or hit by pitch) in 65 con-secutive games, and he reached base safely in 50 of 54 games played in 2002. He earned fi rst-team All-SoCon acclaim in 2001 after ranking among the NCAA leaders in RBIs (16th with an average of 1.29 per game), walks (22nd with an average of 0.85 per game) and doubles (23rd with an average of 0.42 per game). He also ranked among the SoCon top fi ve in nine offensive categories, leading the league in on-base percentage (.515) and walks.

The Baltimore Orioles selected Beck in the 16th round (464th overall pick) of the 2003 MLB draft, and he played for the Bluefi eld Orioles and Class A short-season Aberdeen IronBirds in 2003 before attending spring training in 2004. His professional career was cut short, however, after he suffered a severe wrist injury.

It was following his injury that Beck returned to his alma mater in 2005 as a member of the Catamount coaching staff, working with the outfi elders. He helped mentor outfi elder Steven Strausbaugh to 2005 SoCon Freshman of the Year hon-ors. The following year, Strausbaugh led the SoCon in home runs and RBIs and was tabbed fi rst-team All-SoCon and was eventually drafted in the 37th round of the 2007 MLB Draft by the New York Yankees.

In the summer of 2006, Beck served as manger of the Thomasville HiToms of the Coastal Plain League. Under his direction, the HiToms not only won a then franchise-record 33 regular-season games, but also the club’s fi rst-ever league championship. The team fi nished with an impressive overall record of 37-23, leading the Coastal Plain League in hits, doubles, home runs and total bases.

Beck completed his undergraduate degree in 2004, receiving his B.S. in Sport Management. He later attained his Master’s degree during his two-year coaching stint at WCU, earning an M.A. in Education in 2006.

He was married to current Catamount cheerleading coach, Kim Cherry-Beck, of Denver, N.C., in mid-August of 2008. The couple had their fi rst child – Easton James (pictured left) – in April of 2012.

j

A L A N B E C KAssistant Coach / Recruiting Coordinator

7th Season(Western Carolina, 2004)



Bruce Johnson, who graduated from Western Carolina University in 2009, returns for his fi fth season on staff in Cullowhee, joining as a full-time member after two sea-sons as the Volunteer Assistant Coach and two spent as an undergraduate assistant.

Johnson came to WCU as an undergradu-ate transfer and served as both an under-graduate and volunteer assistant coach for Coach Moranda and staff over the past fi ve years, serving as the fi rst base coach.

Johnson spent the summer of 2011 as the head coach for the Wilson Tobs of the colle-giate wooden-bat Coastal Plains League. He had former Catamount slugger, Barrett Shaft

– who ended his WCU career with a school-record 336 career hits – on his assis-tant coaching staff. The Tobs fi nished with a 25-31 overall record that included a 15-13 fi nish to the fi rst half of the season.

Despite falling short of making the playoffs in 2011, the Tobs did have several bright spots including at stretch of winning 15-of-20 games in the middle of the season. During the run, the Tobs knocked off the eventual CPL champion, the Edenton Steamers.

Prior to making the move to Cullowhee, Johnson spent one year playing base-ball at South Atlantic Conference-member, Newberry College in South Carolina and most at Pitt Community College in Greenville, N.C. As a true freshman at Newberry, Johnson hit just over .200 with a pair of doubles and a home run with eight RBI in 27 games.

Johnson was also an assistant coach the Morehead City Post 46 Hurricanes American Legion baseball team for two seasons. In 2008, the squad posted a team all-time best record of 29-5 which came on the heels of a 2006 American Legion State Championship and third-place fi nish in the south regional.

A graduate of West Carteret High School in Morehead City, N.C., Johnson hit .440 during his senior year with fi ve home runs and 38 RBI helping his squad to a fi nal record of 22-4. He was a two-time, all-conference selection and earned All-State accolades as a senior.

In the classroom, Johnson was a member of the WCHS National Honor Society and was awarded the school’s Academic Achievement Award in 2004.

j

B R U C E J O H N S O NAssistant Coach – 6th Season

(Western Carolina, 2009)



Kyle Deese, who pitched for one season at Western Carolina before being drafted, re-turned to help the baseball team prior to the fall of 2012. He will work alongside former WCU teammate, volunteer assistant coach Brandon Johnson, with the Catamount pitch-ers in the bullpen.

As a redshirt junior in 2011, Deese made 13 relief appearances on the season for the Catamounts, tossing 16.1 innings. The hard-throwing right-hander struck out 22 against 15 walks. He struggled with control early in the season after returning from off-season surgery, walking seven with four wild pitches in his fi rst fi ve appearances.

All told, only one of his seven hits allowed on the season went for extra bases and he recorded at least one strikeout in all but three of his seasonal appearances with WCU winning six of the 13 games he pitched in.

His fi nal two appearances of the season were his best, tossing 2.2 innings of one-run, one-hit relief in a 16-inning game against Furman before keeping top-seeded Elon off the board through a career-long 4.1 innings with a career-high six strikeouts in the epic 20-inning game against the Phoenix in the conference championship event.

Deese was drafted in the 23rd round with the 710th overall pick by the St. Louis Cardinals in the 2011 Major League Baseball First-Year Player Draft as a college junior.

Prior to Western Carolina, Deese signed with Clemson out of high school, redshirting his freshman sea-son. He transferred and played colle-giate baseball at Walters State for a season before coming to WCU for his junior year.

During the summer prior to 2011, he pitched for Florence in the Coastal Plain League where he had a 3.00 ERA and .161 opponents batting average in 36 innings pitched over 12 relief ap-pearances and one start. He recorded one save and 35 strikeouts

Deese was a three-time all-confer-ence selection and an all-region pick in his fi nal two seasons, earning an all-state selection as a senior at Chap-man High.

Brandon Johnson joined the Catamount Baseball coaching staff during the fall of 2011 after concluding his four-year playing career under head coach Bobby Moranda in the spring of 2011. He spent one season as the undergraduate assistant, before moving into the volunteer coaching position prior to 2013. Johnson will work with the Catamount pitching staff on game-days in the bullpen.

The younger brother of assistant coach Bruce Johnson, Brandon assumes the role Bruce held for a season before becoming a full-time assistant at WCU.

A four-year letterwinner, Johnson fi nished his ranked second in Western Carolina history for pitching appearances, taking the mound a

combined 97 times ... The Morehead City, N.C., native recorded 19 career victo-ries on the mound with 18 of those coming out of the bullpen to rank among the all-time best relievers in school history. Overall, his 19 wins ranks tied for 11th on the school ledger, adding four career saves.

In his senior season, Johnson made 25 appearances out of the bullpen, toss-ing 44.1 innings with a 5-4 overall record with one save while boasting a career-best 2.84 ERA. He fi nished the season ranked fi fth in the SoCon with 21 games fi nished. The hard-throwing right-hander struck out 41 batters while limiting op-ponents to a career-low .215 batting average, allowing just seven extra base hits and recorded at least one out in all 25 appearances on the season with at least one strikeout in all but six outings.

Johnson made a career-high 33 appearances as a junior with each one coming out of the bullpen as a primary set-up hurler and later as the closer for the WCU pitching staff. He ranked tied for fi rst on the team with nine victories and two saves, posting a team-low 2.89 ERA. He fi nished the season with seven wins and two saves over his next 18 appear-ances, fanning 50 batters.

Perhaps the best work of his junior season came in the 2010 Southern Conference Baseball Championship. Johnson picked up two wins out of the bullpen, throwing seven innings with a 1.29 ERA and six strikeouts in the league fi nale. He kept the College of Charleston off the board in four in-nings of relief work to allow the squad to rally from a 6-0 defi cit, winning 7-6 in 12 innings. Again managed to shutdown Appalachian State in the tourney, only allowing one run as the Catamounts eliminated ASU, 7-6, in the semifi nals. For his efforts, Johnson was named the relief pitcher on the SoCon All-Tournament team.

Johnson got engaged to Sarah Sw-enson on Dec. 13, 2012 with the wed-ding date set for Oct. 13, 2013.

K Y L E D E E S EUndergraduate Assistant Coach – 1st Season

(Western Carolina)

B R A N D O N J O H N S O NVolunteer Assistant Coach – 2nd Season




Daniel Hooker is amidst his ninth season working in the Western Carolina Athletics Department, and his seventh season as the primary sport contact for Catamount Baseball.

In addition to overseeing the day-to-day op-erations of the WCU Media Relations Offi ce, Hooker serves as the primary sport contact for Catamount football, men’s basketball, baseball and men’s & women’s golf.

Prior to returning to Cullowhee in 2004, Hooker spent four years in Charleston, S.C., working for two minor league sports franchises. He got his start in the Lowcountry with the Charleston Swamp Foxes arenafootball2 team, serving as the Director of Media & Public Relations for three years. He also worked one season for the Charleston Lowgators of the National Basketball Development League

(NBDL) as an Account Executive and Game Day Administrative Assistant.

He got his start working a pair internships, fi rst with the Thomasville Hi-Toms – a Coastal Plain League summer wooden bat baseball team based in central North Carolina. He also worked as the Public Affairs Assistant with the Southern Conference for the 2001-02 season where he was the primary contact for women’s soccer, volleyball and wrestling, while also assisting with football and men’s basketball.

Hooker also delivers play-by-play during Catamount baseball season, while also aiding in the coverage of Catamount football and men’s basketball. His radio experience began in 1997 as a student announcer on WWCU-FM in Cullowhee where he served as an on-air personality for daily shifts, as well as helped start a weekly, interactive sports talk show which covered Catamount athletics. He continued that role with “In the Litterbox,” on WWCU through the spring of 2009.

His sportscasting experience also includes broadcasting Lady Catamount basketball, a season as the play-by-play announcer for the Thomasville Hi-Toms and two seasons as a color analyst for the Charleston Swamp Foxes. He also spent one season on the sidelines during the Catamount Sports Network’s coverage of Catamount football in 2001.

Hooker got his start in Sports Information in the mid-1990s by doing statistics for East-ern Randolph High School football and baseball, while also working as a sports stringer for his hometown newspaper, the Liberty News.

While a student at Western Carolina, Hooker served as the sports editor for the school newspaper, the “Western Carolinian”, for two years after two years as the assistant. He also served as a student assistant with the WCU Sports Information Offi ce all four years.

Hooker is a 2001 cum laude graduate of Western Carolina University where he earned a BS in Communications, while pursuing a double-major in Sport Management with a concen-tration in Sports Information.

David Pryor is amidst his second season as the primary athletic trainer for the Catamount base-ball team after joining the Western Carolina ath-letic training staff in January of 2011. In addition to working with the baseball team, Pryor also works with the Catamount Football team.

Prior to coming to WCU, Pryor spent two and a half years as an athletic trainer at West Liberty Uni-versity in West Virginia where he worked with foot-ball, men’s basketball as well as oversaw all day-to-day operations of the program. He was also an approved clinical instructor at Wheeling Jesuit Uni-versity where educated athletic training students.

Pryor earned his undergraduate degree in ath-letic training from Slippery Rock University in Slip-pery Rock, Penn., in May of 2006. He received his Master’s of Science in Athletic Training from West

Virginia University in May of 2008.While pursuing his Master’s degree, Pryor worked as an athletic trainer for HealthWorks

Rehab & Fitness, as well as a graduate assistant at West Virginia Univ. During the same time, he worked at North Marion High School where he oversaw injury prevention, treatment and rehabilitation for the student-athletes.

In addition to his athletic training experience, Pryor has also volunteered as a fi refi ghter and EMT while in West Liberty, W.Va.

Currently pursuing his undergraduate degree in Sport Management at Western Carolina, Nick Stenger is in his second season with the title of Di-rector of Baseball Operations and his third working with the Catamount baseball team. He is also do-ing a focus in athletic administration with a minor in economics.

Among his many duties, Stenger’s numerous du-ties include managing the team’s equipment and uniforms, overseeing the laundry operations, as well as coordinating the team video. He also assists the Catamount coaching staff with in-offi ce duties.

Stenger is originally from Olmsted Falls, Ohio, which is about 30 minutes southwest of Cleveland. He is a 2008 graduate of Olmsted Falls High School where he wrestled and was on the school’s tennis team. He is the son of Larry and Kathy Stenger with his mother currently residing in Hendersonville, N.C.

Stenger additionally completed the requirements for an Eagle Scout in early 2008.His brother, Matt, competes in the pole vault for the WCU track & fi eld team.

D A N I E L H O O K E RAssistant AD for Media Relations


D A V I D P R Y O RAssistant Athletic Trainer(Western Carolina, 2004)

N I C K S T E N G E RDirector of Baseball Operations





NOTES:Named second team preseason All-Southern Conference at shortstop by the league’s head coaches prior to the 2012 season.

2012 (SOPHOMORE):One of just three Catamounts to start all 56 seasonal games, doing so as the starting shortstop - only one of two players to start every game at the same position ... Hit .302 on the season

after spending the fi rst 14 games of the season over the .400 plateau ... Batted .319 (23-of-72) against left-handed pitching ... Was a part of turning 36 double plays ... Ranked tied for second on the team with 75 hits on the year, 11 of which going for extra bases including 10 doubles and a lead-off home run at Gardner-Webb (April 17) ... Set a school-record with fi ve doubles in a perfect 6-for-6 showing at the plate in a home win over Iona (March 3) ... His six hits rank tied for second in school history ... Finished with 18 multiple hit games including a team-best two, fi ve-or-more hit games, and seven multiple RBI games ... Was second on the squad with 16 two-out RBI ... Hit as WCU’s leadoff batter in 52 of the 56 games - bat-ted .309 (34-for-110) as a leadoff batter ... Recorded a career-long, 14-game hitting streak ... at shortstop; Summer League: Played for the Thomasville Hi-Toms in the Coastal Plain League during the summer of 2012 ... Started 44 of the 45 games in which he saw action ... Finished with a .177 batting average, collecting 29 hits including seven doubles and two home runs with 12 RBI ... Stole nine bases in 11 attempts ... Amassed 114 fi elding assists and 64 putouts along the infi eld.

2011 (FRESHMAN):Was the only Catamount to both play in and start all 55 games on the season ... Made 54 starts at shortstop with one start at second base ... Hit .293 as a freshman with 10 of his 58 hits going for extra bases including eight doubles ... Finished with 14 multiple hit games including six, three-hit outings, while also tallying six multiple RBI games ... Had two, fi ve-game hitting streaks that bookended his rookie season ... Hit .720 (18-of-25) with a runner on third base and batted .489 (22-of-45) when leading off an inning at the plate ... Drew two-or-more walks in seven games during the season ... Recorded nine stolen bases in 11 attempts ... Posted a .945 fi elding percentage ... Belted a two-run homerun in his fi rst col-legiate at bat as a part of a 3-for-4 showing against Morehead State, driving in a career-high

2012 (FRESHMAN):Played in 55 of WCU’s 56 games, making 46 starts at third base ... Finished with a .303 batting average with 12 of his 54 hits going for extra base hits ... Led the team with three triples ... Re-corded 16 multiple hit games and fi ve multiple RBI outings ... Drove in 24 runs on the season including a team-high tying 21 in Southern Conference play ... Batted .333 (34-for-102) in league play and hit .336 against right-handed pitching ... Was 4-for-8

(.500) with the bases loaded ... Added eight stolen bases (8-of-11) ... Named to the SoCon’s All-Freshman team ... Tripled to right center fi eld in his fi rst collegiate at bat, driving in the season’s fi rst run in the home-opener against Fordham (February 17) ... Posted a perfect 4-for-4 outing with a double and three RBI at home against UNC Greensboro (March 24) ... Had a nine-game hitting streak from April 7 through April 25, posting a 12-for-37 (.324) ... Hit his fi rst career home run to straight-away centerfi eld at Samford (April 21); Played for the league-champion West Virginia Miners in the Prospect League during the summer of 2012 ... Ranked third on the team - and fi fth in the league - with a .359 batting average (78-of-217) with 17 extra base hits including 10 doubles, six triples and a home run ... Drove in 37 runs and scored 57 runs ... Stole a Prospect League-leading 29 bases in 35 attempts ... Named a starter for the East Division in the Prospect League All-Star game.

PRIOR TO WESTERN CAROLINA:Played for his father, Brad, as the head coach of Richlands HS baseball team where he earned three All-Southwest Dis-trict honors and was the Virginia Player of the Year in 2011 when hit a career-best .524 with a career-best 11 home runs ... Was a two-time All-State player and earned All-Region three times ... Set school career records for hits (134) - including a single-season best 48; batting average (.525); triples (24); home runs (19) and stolen bases (40) ... Is the fi rst student-athlete from his high school to sign a scholarship to play NCAA Division I baseball ... Received a scholarship from the Allstate Foundation at teh VHSL Achievement Award Luncheon ... Was also a three-year starter on his high school football team, twice earning All-State honors at defensive back, wide receiver and return specialist ... Set the school record for career interceptions while also becoming the program’s fi rst-ever, two-year captain.

PERSONAL:Full name is Bradley Stuart Strong ... Is the son of Brad and Mary Ann Strong ... Has a young-er brother, Reece, who was a freshman on the 2013 Catamount baseball team.

Aaron ATTAWAY

Bradley STRONG

5-8 170 Jr. INF R/RMorganton, N.C. Patton HS

5-8 165 So. INF L/RRichlands, Va. Richlands HS

2

1

S T RO N G ’ S C A R E E R O F F E N S I V E S TAT I S T I C SYEAR AVG GP GS AB R H 2B 3B HR RBI BB SO SB ATT2012 .303 55 46 178 27 54 8 3 1 24 4 31 8 11



2012 (SOPHOMORE):Played in 53 of the 56 games on the season, making 44 appear-ances in the starting lineup ... Posted a career-best .331 bat-ting average, tallying 53 hits including 12 for extra bases with eight doubles, a triple and three home runs ... Had 16 multiple hit games and three multiple RBI outings ... Finished with a .353 on-base percentage and a .450 slugging percentage ... Ranked second on the team with 12 stolen bases coming in 15 attempts

... Led the team with 18 bunt attempts including a team-best 10 successful sacrifi ce bunts and fi ve for base hits ... Belted his fi rst career home run in the top of the ninth inning at Ken-nesaw State (March 28) - skirting the fence in right center fi eld to tie the game and forcing extra innings allowing the Catamounts to win, 7-6, in 10 innings ... Also homered at Wofford (April 7) and close to his hometown at Gardner-Webb (April 17) ... Drove in a career-high three runs at Samford (April 22); Summer League: Played for the Waynesboro Generals of the Valley League during the summer of 2012 ... Led the Valley League with a .419 batting average on the summer with 24 extra base hits including 14 doubles, three triples and seven home runs ... Finished 15-of-18 in stolen bases ... Started 40 of the 44 games in which he saw action ... Ridings was the Generals’ player of the week twice ... Named to the midseason All-Star team in the Valley League ... Tabbed as the top prospect out of the Valley League by Perfect Game.

Julian RIDINGS6-2 170 Jr. OF L/RShelby, N.C. Crest HS

4

AT TAWAY ’ S C A R E E R O F F E N S I V E S TAT I S T I C SYEAR AVG GP GS AB R H 2B 3B HR RBI BB SO SB ATT2011 .293 55 55 198 38 58 8 1 1 31 26 44 9 112012 .302 56 56 248 37 75 10 0 1 32 23 39 7 10TOTAL .298 111 111 446 75 133 18 1 2 63 49 83 16 21

R I D I N G S ’ C A R E E R O F F E N S I V E S TAT I S T I C SYEAR AVG GP GS AB R H 2B 3B HR RBI BB SO SB ATT2011 .293 55 55 198 38 58 8 1 1 31 26 44 9 112012 .331 53 44 160 24 53 8 1 3 21 5 25 12 15TOTAL .304 78 62 227 30 69 12 1 3 24 8 44 15 21

four RBI ... Matched a SoCon Tournament record with teammate Ross Heffl ey with a career-high 10 at bats in the epic 20-inning game against Elon in the conference championship event.

PRIOR TO WESTERN CAROLINA:Selected All-South Mountain Athletic Conference (SMAC) during his senior season, hitting over .430 with over 30 RBI as Patton HS advanced into the state playoffs ... High school head coach was Brandon Scott ... Was named the 2009 Catawba Valley Athletic conference Player of the Year after hitting .437 with eight home runs and 32 RBI as a junior ... Only struck out 12 times in 114 at bats in 2009 ... Was selected to play in the Region 7 State Games ... Played summer baseball for the Burke Legion team and with the South Charlotte Panthers during the fall ... Played on the 2004 Morganton Little League All-Star team that fi nished third in the United States and seventh in the world.

PERSONAL:Full name is Aaron Tyler Attaway ... Is the son of Mark and Cynthia Attaway ... His brother, Austin, played collegiate baseball at Mars Hill.

2011 (FRESHMAN):Appeared in 25 games for the Catamounts including 18 starts including 15 in centerfi eld, twice in left and once in right fi eld ... Was sidelined several times during his rookie campaign due to a variety of injuries and ailments, missing the fi nal 16 games of the season due to a back injury ... Earned his fi rst career start in centerfi eld in his fi rst career game ... Finished with six multiple hit games ... Struggled the second half of the season, recording just one hit in his fi nal 18 at bats of the season with his batting average dropping 67 points ... Collected his fi rst career base hit in his third at bat in the season-opener against Morehead State (2/18), singling to right fi eld on the fi rst pitch ... Tallied a career-high three base hits includ-ing a pair of doubles in a 3-for-5 showing against Elon (3/18).

PRIOR TO WESTERN CAROLINA:Was twice named All-Big South Conference, garnering the league’s Player of the Year honor as a senior after hitting .432 with eight home runs and 22 RBI in his fi nal season ... Added 28 runs scored and 10 stolen bases, while playing errorless defense in the outfi eld for the Big South 3A Conference champion, fi nishing with a 19-5 record and a third round state 3A playoffs appearance ... Earned All-Region honors both as a junior and senior in high school ... Batted .400 with eight home runs and 38 RBI in American Legion baseball in the summer of 2009, hitting .409 for the Shelby Legion team during the summer of 2008.

PERSONAL:Full name is Julian Taylor Ridings ... Is the son of David and Lisa Ridings ... Has a younger sibling, Madison

2012 (SOPHOMORE):Played in 37 games including seven starts as the designated hitter ... Hit .327 collectively on the season with 17 hits, all singles, and scored 11 runs ... Had four multiple-hit games and three, two-RBI outings, recording eight RBI on the season ... Was WCU’s most-used pinch hitter, fi nishing 6-for-21 with a .286 batting average coming off the bench ... Batted .341 (15-of-44) against right-handed pitching ... Reached base safely in

fi ve-straight games for his season-long streak ... Finished 3-for-3 in stolen bases ... Scored a career-best three times in the second home win over Iona (March 3), walking twice and twice being hit by a pitch ... Collected a career-high three hits in a 3-for-4 outing against Clemson (March 14), driving in a pair of runs in the 8-4 home win; Played for the Lake Nor-man Copperheads in the Southern Collegiate League during the summer of 2012 ... Batted .266 (17-for-64), seeing action in 23 games ... Legged out three doubles ... Drove in 11 runs ... Walked and was plunked fi ve times ... Was named a North Division Midseason All-Star.

2011 (FRESHMAN):Played in 41 games making 17 starts including eight in left fi eld, eight as the designated hitter and once in right fi eld ... Posted a .318 batting average with 27 hits including eight for extra bases with 11 RBI ... Finished with six, two-hit games and two multi-RBI outings ... Hit .333 (7-of-21) as a pinch hitter and .323 (10-of-31) with the bases loaded in his rookie campaign ... After recording a hit, his batting average did not dip below .292 (3/29) the remainder of the season ... Recorded a career-long, six-game hitting streak through the fi rst

Luke GRAGG5-6 160 Jr. C/OF L/RMoravian Falls, N.C. Wilkes Central HS

5



G R AG G ’ S C A R E E R O F F E N S I V E S TAT I S T I C SYEAR AVG GP GS AB R H 2B 3B HR RBI BB SO SB ATT2011 .318 41 17 85 17 27 6 1 1 11 10 17 2 32012 .327 37 7 52 11 17 0 0 0 8 12 12 3 3TOTAL .321 78 24 137 28 44 6 1 1 19 22 29 5 6

two weeks of May ... Picked up his fi rst collegiate base hit in his fourth at bat, doubling down the right fi eld line in a pinch hit role on Feb. 27 against Manhattan ... Belted his fi rst career home run against archrival Appalachian State, blasting a two-run home run down the right fi eld line as a part of a career-best three RBI performance.

PRIOR TO WESTERN CAROLINA:Was named the Mountain Valley 2-A/1-A Conference Player of the Year as a senior, also earning 2-A All-State honors during his fi nal season as a prep by the North Carolina Baseball Coaches Association (NCBCA) ... Led all hitters in the state of North Carolina in 2010 by hit-ting .667 as a senior with 48 total hits ... His .667 batting average tied the North Carolina High School Athletic Association’s (NCHSAA) single-season record previously held by Alex Hill of Vance HS in 2007 ... Finished with 13 doubles (9th) and 48 RBI which ranked fourth in the state ... Played for head coach Terry Johnson at Wilkes Central HS ... Earned All-MVC honors during his junior season while also collecting honoorable mention All-MVC in 2008 as a sophomore.

PERSONAL:Full name is Jon Lucas Gragg, but prefers to go by Luke ... Son of Leslie and Debra Gragg.

2012 (SOPHOMORE):Sat out due to NCAA transfer rules; Summer League: Played for the Forest City Owls in the Coastal Plain League during the sum-mer of 2012 ... Made 13 appearances including three starts, posting a 1-1 overall record with one save ... Finished with a 3.56 ERA through 30.1 innings pitched, surrendering 17 runs with 12

Bryce DANIELSON6-1 165 R-So. LHP L/L

Etowah, N.C. Wingate / West Henderson HS

6

earned on 27 hits - only fi ve going for extra bases ... Recorded 22 strikeouts against 28 walks.

PRIOR TO WESTERN CAROLINA:Transferred from Wingate to WCU prior to the fall of 2011 At Wingate: Posted a 6.35 ERA in 16 relief appearances for the Bull-dogs, fi nishing with a 3-1 record ... Tossed 17.0 innings, fanning 15 against nine walks; At West Henderson HS: Was a two-time all-conference selection his sopho-more and senior years, missing his junior year due to Tommy John surgery ... Hit .325 as a senior in high school ... Also lettered in football as a senior.

PERSONAL:Full name is Jonathan Bryce Danielson ... Is the son of Rob and Beverly Danielson ... Has one younger sibling, Chandler.

NOTES ENTERING 2013:Was one of four players selected as team captains after fall drills in December, 2011 ... Selected as the third “Leggett No. 7 Legacy” recipient.

2012 (REDSHIRT JUNIOR):Made 15 appearances on the mound - all in the starting role -

posting a 6-3 overall record ... His six victories were tied for the team high ... Worked 84.1 innings with 68 strikeouts against 41 walks ... Recorded at least two strikeouts in all but one start, posting fi ve-or-more K’s seven times ... Held left-handed batters to a .203 batting av-erage against (12-of-59) ... Recorded 88 fl y ball outs and 84 ground ball outs including six double plays ... In just his second career start at WCU, struck out nine batters in six innings of work in the second game of the season-opening doubleheader against Fordham (Febru-ary 17) ... Struck out a career-high 10 in 6.1 innings of work in game two of a twin bill against Davidson (March 31) ... Twice worked into the ninth inning but only scored one victory: held the College of Charleston (April 28) to just three hits through eight innings before coming out in the top of the ninth inning with a 7-1 lead; WCU had to hold on for a 7-6 win ... Scat-tered seven hits through eight innings against No. 24 Appalachian State (May 18), shutting out the Mountaineers until an inherited run was allowed to score in the 5-4 loss ... Was touched up for fi ve runs – only two of which were earned – on four hits with a walk, recording just a third of an inning in the start against 8th-seeded Furman in the SoCon Championship.

2011 (REDSHIRT SOPHOMORE):Ranked second on the WCU pitching staff with 26 appearances, but only offi cially tossed 9.1 innings on the season as a leftie specialist out of the bullpen ... Tossed double-digit pitches just 11 times on the season ... Made 18 scoreless appearances ... Only surrendered four extra base hits out of the 15 hits allowed ... Finished with an 8.68 ERA ... Struck out 14 against nine walks on the year ... Tossed an inning three times including twice against the College of Charleston and once against Elon ... Fanned his then career-best of two twice - at Eastern Kentucky (March 1) and at College of Charleston (April 1) ... Made his fi rst start against Clemson (April 27) but was touched up for three runs on two hits with one walk without recording an out.

Morgan McKINNEY6-3 200 R-Sr. LHP L/LGainesville, Fla. Santa Fe CC / Buchholz HS

7



M C K I N N E Y ’ S C A R E E R P I T C H I N G S TAT I S T I C SYEAR ERA W L APP GS CG SHO SV IP H R ER BB SO WP2011 8.68 0 1 26 1 0 0 0 9.1 15 10 9 9 14 02012 3.74 6 3 15 15 0 0 0 84.1 76 45 35 41 68 7TOTAL 4.23 6 4 41 16 0 0 0 93.2 91 55 44 50 82 7

PRIOR TO WESTERN CAROLINA:Recorded a 2-1 record with 27 strikeouts in 22 innings pitched as a freshman for Santa Fe CC, helping the squad to a Florida State Championship and a national runner-up fi nish at the Junior College World Series ... Finished his senior season with a 10-1 overall record with 100 K’s in 52 innings pitched, garnering fi rst team All-State plaudits.

PERSONAL:Full name is Morgan Andrew McKinney ... Is the son of David and Terri McKinney ... Has two siblings – older sister Lauren and younger brother, Brennan.

2012 (FRESHMAN):Played in 31 games with 11 starts including seven as the desig-nated hitter and four in left fi eld ... Batted .308 as a true fresh-man, collecting 23 hits including seven for extra bases with 11 RBI ... Had two multiple hit games and three multiple RBI outings ... Recorded a pair of four-game hitting streaks ... Was a .267 batter as a pinch hitter (4-for-15) ... Collected his fi rst collegiate

base hit in his fi rst career start as the designated hitter against Iona (March 2), leading off the fi fth inning with a double to center fi eld in what was his fourth career at bat ... Drove in two runs in the fi nal game of the Iona (March 4) series ... Hit his fi rst home run to right center

Dale URQUHART Jr.5-10 220 So. OF R/R

Hope Mills, N.C. Southview HS

8

fi eld in a road win over The Citadel (March 11) ... Had a career day with a 3-for-4 out-ing at Elon (May 5), belting a double and a home run and driving in a career-best three runs; Summer League: Played part of the summer with the Fayetteville SwampDogs of the Coastal Plain League.

PRIOR TO WESTERN CAROLINA:A four-year letterwinner, hit .357 during his career with 31 doubles, eight triples and 12 home runs, driving in 76 ... Was a two-time, fi rst-team all-conference selection and twice garnered All-Region honors includ-ing fi rst team as a senior ... Recorded 16 victories on themound with a 3.28 ERA over 118.2 innings pitched, striking out 129 ... Was named his school’s Male Athlete of the Year following his senior season.

PERSONAL:Is the son of Dale and Tammy Urquhart ... Has a sister, Destiny Jacobs, and brother, Bradley Turner.

U R Q U H A R T, J R . ’ S C A R E E R O F F E N S I V E S TAT I S T I C SYEAR AVG GP GS AB R H 2B 3B HR RBI BB SO SB ATT2012 .308 31 11 52 8 16 4 0 3 11 8 17 1 2

2012 (SOPHOMORE):Saw action in all 56 games, making 53 appearances in the starting lineup ... Was behind the plate for 41 starts during the season while also starting six times in left fi eld, four times as the designated hitter and twice at fi rst base ... Finished the year batting .281 with 54 hits including nine doubles, two triples and seven home runs, second on the squad ... Batted .296 when starting as the catcher, and was .311 on the season with run-

ners aboard ... Tallied 11 two-out RBI ... Had a season-long, eight-game hitting streak with a stretch of reaching base safely in 11-consecutive games ... Drove in 33 runs with nine multiple RBI games, third on the team ... Only committed three errors behind the plate all season, boasting a fi elding percentage of .991 with just three passed balls ... Was also a threat behind the dish, throwing out 16 of the 44 would-be base stealers (.363) ... Doubled twice in the second game of a season-opening doubleheader against Fordham (February 17) ... Collected a career-high four hits including a home run in game three against Furman (April 15); Summer League: Played for the St. Cloud Rox in St. Cloud, Minn., in the Northwoods League during the summer of 2012 ... Finished the summer hitting .258 with eight extra base hits including six doubles and two home runs as a part of a .358 slugging percentage ... Drove in 13 runs with one stolen base.

2011 (FRESHMAN):Played in 40 games as a true freshman making 35 starts including 27 games as the catcher, six as the designated hitter and twice at fi rst base ... Missed nearly two weeks at the end of the regular season due to a high ankle sprain, returning for the Southern Conference tourna-ment ... Finished the year with a .291 batting average, driving in 24 runs ... Of his 39 base

Adam MARTIN6-2 235 Jr. C R/RMarietta, Ga. Harrison HS

11



NOTES ENTERING 2013:Prior to the season, was one of four players selected as a team captain - the lone junior recognized by his teammates.

2012 (SOPHOMORE):Started 50 of the 53 games in which he saw action including 40-straight games to end the season ... Made 38 starts in right fi eld and a dozen in center fi eld ... Hit .312 on the year with eight

of his 62 seasonal hits going for extra bases including fi ve doubles ... Batted in eight of the nine slots in the batting order - the most on the team - hitting in every spot except the lead-off ... Hit .328 (20-of-61) against left-handed pitching ... Ranked tied for second on the team with 22 multiple hit games and had four multiple RBI performances ... Drove in 23 runs on the season ... Was selected second team All-SoCon in the outfi eld by College Sports Madness ... Belted an extra-inning, go-ahead home run in the loss to UNC Ashe-ville (March 21) at McCormick Field ... Had two, eight-game hitting streaks from mid-March through mid-April - all told, secured hits in 19-of-21 games during the month and a half at

Cody JONES6-1 185 Jr. OF L/LChandler, N.C. Enka HS

12

mid-season ... Slumped down the stretch, collecting just four hits including a double in his fi nal 10 games as a part of a 4-for-33 (.121) fi nish; Summer League: Played for the Gastonia Grizzlies of the Coastal Plain League during the summer of 2012 ... Finished the summer batting .284, third on the team ... Started 48 of the 50 games in which he saw action ... Recorded 54 hits in 190 at bats including seven doubles and drove in 18 runs ... Was 11-of-15 in stolen bases.

2011 (FRESHMAN):Played in 35 games making 10 starts including six as the designated hitter, three in right fi eld and once in left ... Ranked second on the team with 17 pinch hit opportunities ... Re-corded a .273 batting average on the season with 15 base hits including three for extra bases in 55 at bats ... Finished with three multiple hit games and had two multi-RBI outings ... Collected both his fi rst collegiate base hit and RBI with a pinch hit single through the right side in the fi fth inning of the second game of the season against Morehead State (2/19) ... Swiped a career-best two stolen bases at Kennesaw State (3/15) ... Tripled at the College of Charleston (4/3) for his fi rst extra base hit ... Drove in what proved to be the game-winning runs with a two-out, two RBI single to right fi eld in the 16 inning victory over Furman (5/13).

PRIOR TO WESTERN CAROLINA:Was a two-time North Carolina State Games Region 8 participant ... Earned All-Northwest 4-A Conference accolades three times including garnering the conference’s Player of the Year accolades as a senior ... Named All-Western North Carolina and to the All-State base-ball team ... Holds the Enka HS school record for hits in a career ... Hit .490 as a senior with eight doubles and a career-best 12 home runs, driving in 36 runs ... As a junior, hit .423 with eight doubles and 19 RBI, stealing eight bases ... Played summer and fall baseball for the Diamond Mine.

PERSONAL:Full name is Cody Patrick Jones ... Is the son of Eddie Jones and Tammy Hess ... Has fi ve siblings; Erin Jones, Caitlyn Hess, Jordan Hess, Austin Dunbey and Justin Dunbey.

J O N E S ’ C A R E E R O F F E N S I V E S TAT I S T I C SYEAR AVG GP GS AB R H 2B 3B HR RBI BB SO SB ATT2011 .273 35 10 55 6 15 2 1 0 12 8 13 4 42012 .312 53 50 199 40 62 5 0 3 23 18 36 11 17TOTAL .303 88 60 254 46 77 7 1 3 35 26 49 15 21

M A R T I N ’ S C A R E E R O F F E N S I V E S TAT I S T I C SYEAR AVG GP GS AB R H 2B 3B HR RBI BB SO SB ATT2011 .291 40 35 134 22 39 7 1 5 24 16 35 1 32012 .281 56 53 192 35 54 9 2 7 33 25 40 2 4TOTAL .285 96 88 326 57 93 16 3 12 57 41 75 3 7

hits, 13 were for extra bases with seven doubles and fi ve homeruns ... Threw out 11 would-be base stealers to rank tied for eighth in the SoCon ... Picked up his fi rst collegiate base hit in his second career game - fi rst career start - belting a seventh-inning home run against More-head State (February 19) ... Tied for the team’s second-longest hitting streak with a career-best 11-game hitting streak ... Collected a career-best three hits in a 3-for-5 outing against Samford (April 10) ... Doubled twice in the fi rst game of a twin bill at Davidson (March 27), driving in four runs ... Blasted his fi rst career grand slam homerun, amassing a career-high tying four RBI against San Diego State (April 30) ... Played in the wooden bat summer league in Alaska for the Matsu Miners ... Claimed the summer league’s home run derby title.

PRIOR TO WESTERN CAROLINA:Was a part of the Harrison HS State Championship team as a senior, earning fi rst team All-County honors ... Named second team Southeast All-Region by Perfect Game USA ... Hit .378 as a junior with seven doubles and three home runs with 26 RBI for Harrison HS ... Was the 40th ranked baseball recruit in the state of Georgia and ranked 446th overall in the entire nation by PGCrosschecker ... Was named to the 2008 PG Crosschecker Southeast Top Prospect team and the 2008 PG National Underclass Top Prospect Team ... Played summer baseball with the East Cobb Astros.

PERSONAL:Full name is Adam B. Martin ... Is the son of Gary and Joann Martin ... Has a younger sister, Allison ... His father played football at Georgia Tech.



2012 (SOPHOMORE):Saw action in 55 of WCU’s 56 games on the season, making 39 starts including 33 in left fi eld and six in right fi eld ... Posted a .254 batting average with 36 hits including 17 for extra bases with 12 doubles and fi ve home runs, third on the team ... Fin-ished tied for fourth on the team with 11 two-out RBI ... Hit .277 against right-handed pitching on the year ... Was a .500 (12-for-24) hitter as a non-starter with six extra base hits including

four home runs - recording a 1.083 slugging percentage ... Tallied three outfi eld assists ... Drove in 27 runs on the year including a career-best fi ve in a home win over UNC Greensboro (March 24) ... Tied for the team-lead with 21 RBI in SoCon ... Hit three home runs in the home double-header against UNCG, belting two including an 11th inning walk-off, game-winner in the fi rst game of the twin bill ... Doubled twice in the home win over Fordham (Feb. 18) and again at Gardner-Webb (April 17) ... Broke the game’s only tie with a two-out, three-run home run over the fence in right fi eld as WCU won the series over No. 24 Appalachian State (May 19); Summer League: Played for the Forest City Owls of the Coastal Plain League during the summer of 2012 ... Started 32 of the 36 games in which he say action, fi nishing with a .196 batting average ... Collected 21 hits including six doubles and a home run, driving in eight ... Was a perfect 4-for-4 in stolen bases ... Walked 13 times and was plunked eight times.

2011 (FRESHMAN):Played in 37 games making 19 starts as a true freshman including 13 in leftfi eld and three apiece at fi rst base and as the designated hitter ... Finished with a .209 batting average with 14 hits - half going for extra bases - in 67 at bats ... Posted a .286 (2-for-7) average as a pinch hitter ... Had three multiple-hit games and two multi-RBI outings ... Scored two runs despite not getting a base hit, walking and scoring twice in the season-opener against More-head State (Feb. 18) ... Struggled through his fi rst eight games, starting his career 0-for-17 before collecting both his fi rst career hit and fi rst career extra base hit at the same time with a double down the right fi eld line in the second inning in a road win at Eastern Kentucky (March 2) ... Posted two hits at EKU for his fi rst career multiple-hit game ... Drove in his career RBI on his fi rst career home run, belting a solo shot over the right fi eld fence at UNC Greensboro (March 11) ... Had a career-best day with a 3-for-5 showing at home against Georgia Southern (April 17) ... Hit a three-run home run at College of Charleston (April 2).

Dykota SPIESS6-2 200 Jr. OF R/RMorganton, N.C. Patton HS

14

S P I E S S ’ C A R E E R O F F E N S I V E S TAT I S T I C SYEAR AVG GP GS AB R H 2B 3B HR RBI BB SO SB ATT2011 .209 37 19 67 9 14 5 0 2 8 9 15 1 12012 .254 55 39 142 28 36 12 0 5 27 21 34 1 2TOTAL .239 92 58 209 37 50 17 0 7 35 30 49 2 3

PRIOR TO WESTERN CAROLINA:Garnered All-South Mountain Athletic Conference honors following his senior season, also picking up all-conference accolades following his sophomore season in 2008 ... Hit .414 with over 30 RBI’s and an on-base percentage of .514 as a junior, helping Patton HS to the North Carolina 2-A State Championship game ... Ranked 15th in the state of North Carolina among baseball recruits and was No. 414 in the nation according to PG Crosschecker ... Was a part of the 2004 Morganton Little League All-Star team that fi nished third in the U.S. and seventh in the world ... Played summer league baseball with the Burke Legion team and played for the Dirtbags in the fall.

PERSONAL:Full name is Dykota Brandon Spiess ... Is the son of Jason and Heidi Spiess ... Has one sibling, Brittney.

2012 (FRESHMAN):Made four relief appearances, tossing three scoreless innings out of the WCU bullpen ... Only allowed one single on the year ... Recorded two strikeouts in three of his four seasonal appear-ances, tallying six through the three innings of work ... Made his collegiate debut against eventual Big Ten Conference champion, Purdue (February 26), fanning two batters in an inning of work

at the Keith LeClair Classic; Summer League: Played for the Lake Norman Copperheads in the Southern Collegiate League during the summer of 2012 ... Made two relief appear-ances, combining to toss two innings with a 4.50 ERA ... Allowed one earned run on two hits, working around two walks with three strikeouts.

PRIOR TO WESTERN CAROLINA:Was a three-time All-CISAA conference selection including tallying the league’s Player of the Year honor as a senior ... Was also an honorable mention in the Rawling’s All-American ... Twice earned All-State ac-colades during both his sophomore and senior seasons ... Was tabbed his squads MVP three times.

PERSONAL:Full name is William Allen Frazier ... Is the son of Brad and Kay Frazier ... Has one sis-ter, Meredith.

William FRAZIER5-10 155 So. LHP L/L

Charlotte, N.C. Charlotte Country Day

17

F R A Z I E R ’ S C A R E E R P I T C H I N G S TAT I S T I C SYEAR ERA W L APP GS CG SHO SV IP H R ER BB SO WP2012 0.00 0 0 4 0 0 0 0 3.0 1 0 0 0 6 0



CAREER NOTES:Enters his fi nal season having been hit by 28 pitches, tied for ninth in the school record book ... Ranks just off the WCU career chart with 37 career doubles, six shy of tying for 21st all-time ... Was one of four players selected as team captains after fall drills in December, 2011 ... Named Preseason second team All-Southern Conference at fi rst base – but is expected to transition to third base this season.

2012 (JUNIOR):One of only three players to start all 56 games, making 47 starts at fi rst and nine at third base ... Led the team with both a .354 batting average and 16 doubles ... Was tied for sec-ond with 22 multiple hit games and was fourth with eight multiple RBI outings ... Finished with nine three-or-more hit games, the most on the team ... Was 4-for-5 (.800) with the bases loaded ... Hit by nine pitches to pace the squad ... Posted a .987 fi elding percentage at fi rst base, committing just six errors in 459 seasonal chances ... Was a part of turning 44 double plays ... Had a pair of season-long, eight-game hitting streaks, the second of which was a part of reaching base safely in a team-long 21-straight games from March 27 through May 5 ... Twice drove in a career-high tying four RBI, collecting three hits including a double against Fordham (February 18) and four in a 3-for-4 outing with a home run against Furman (April 14) ... Matched a career-high with three walks against Fairfi eld (March 18) in Jacksonville, Fla. ... Was named to the second team All-SoCon as selected by the staff of College Sports Madness; Summer League: Returned to the Gastonia Grizzlies of the Coastal Plain League during the summer of 2012 ... Led Gastonia with a .319 batting average, good enough for seventh in the Coastal Plain League ... Started 50 of the 51 games in which he saw action ... Finished the summer 61-of-191 with 13 doubles and fi ve homeruns, driving in 38 runs ... Named the CPL Hitter of the Week in Week 9 ... Walked 29 times with fi ve HBP’s

Tyler WHITE5-11 220 Sr. Inf R/RForest City, N.C. Chase HS

20

S C H N E I D E R ’ S C A R E E R P I T C H I N G S TAT I S T I C SYEAR ERA W L APP GS CG SHO SV IP H R ER BB SO WP2012 13.50 0 0 2 0 0 0 0 0.2 1 1 1 2 0 0

2012 (FRESHMAN):Appeared in two games as a true freshman, totaling two thirds of an inning pitched ... Finished with an overall ERA of 13.50 as a rookie in limited time on the hill ... Made his collegiate debut at Winthrop (February 21) allowing one run on a home run, throw-ing six pitches ... Faced two batters in relief at East Tennessee State (April 25), issuing a pair of walks ... WCU won both games

in which he saw action; Summer League: Pitched for the 6-4-3 Cougars out of Atlanta, Ga.

PRIOR TO WESTERN CAROLINA:A four-year varsity letterwinner who hit a school-record .407 over his career with 30 doubles, seven triples and 11 home runs - another school benchmark ... Earned his team’s Offensive MVP honor twice ... Drove in 89 RBI including a career-best 39 as a senior ... On the mound, fi nished with a 10-13 overall record with four saves and an ERA around fi ve ... Posted 56 strikeouts in 50 innings pitched ... Lettered in three varsity sports for all four years as a prep.

PERSONAL:Full name is Daniel E. Schneider ... Is the son of Dan and Ana Schneider.

Danny SCHNEIDER6-5 220 So. RHP R/R

Roswell, Ga. Mount Pisgah Christian

19

to go along with his .419 on-base percentage ... Named a midseason All-Star and the Of-fensive MVP of the All-Star game.

2011 (SOPHOMORE):Started 50 of the 54 games in which he played making 48 starts at fi rst base and one apiece at second and third base ... Finished the season with a career-best .289 batting average with 57 base hits including 12 for extra bases with 10 doubles and two home runs ... Re-corded 15 multiple hit games including 10, two-hit outings while also recording six multi-RBI games ... Matched a career-long, 11-game hitting streak, raising his seasonal batting average 64 points during the run ... He had six multi-hit games during his 11-game streak ... Stole a career-high 10 bases in his second season to rank fourth on the team ... Also ranked fourth on the team with 10, two-out RBI ... Tied with teammate Cameron Dullnig for the sev-enth place on the single-season HBP chart after being plunked 15 times, a mar which tied him for fourth in the SoCon on the season ... Posted a stellar .996 fi elding percentage (4th in SoCon), committing just two errors with a combined 451 chances (8th in SoCon), tallying 421 putouts (6th in SoCon) and 28 assists on the season ... Was a part of 38 double plays at fi rst base ranking him tied for sixth in the SoCon ... Was hit by three pitches at High Point (April 26) ... Recorded a career-best six base hits - one shy of tying the school single-game record – in the epic 20-inning game against Elon (May 25) in the conference championship event, fi nishing 6-for-7 with a double.

2010 (FRESHMAN):Started 55 of the 59 games with 54 starts coming at fi rst base and one at third ... Tallied 17 multiple-hit games and 10 multiple RBI outings, tied for fourth on the team ... Posted a career-best 11-game hitting streak while also hitting in 10-straight early in the year ... Recorded four base hits with the bases loaded but also grounded into a team-leading 10 double plays during his rookie season ... Recorded 515 putouts with eight assists at fi rst base with just eight errors for a .985 fi elding percentage ... Was twice the hero during WCU’s Southern Conference Tournament run, driving in the two game-tying runs in the ninth inning of the come-from-behind, 12-inning upset of second-seeded College of Charleston ... Also drove in the game-winning run with a walk-off single in the second semifi nal meeting with Appalachian State, eliminating the Mountaineers ... Played summer ball with WCU team-mates Austin Schultz and Matt Benedict with the Haymarket Senators of the Valley League.



W H I T E ’ S C A R E E R O F F E N S I V E S TAT I S T I C SYEAR AVG GP GS AB R H 2B 3B HR RBI BB SO SB ATT2010 .288 59 55 222 28 64 11 1 3 36 21 24 0 02011 .289 54 50 197 32 57 10 0 2 27 20 27 10 122012 .354 56 56 212 41 75 16 0 1 30 29 21 3 9TOTAL .311 169 161 631 101 196 37 1 6 93 70 72 13 21

PRIOR TO WESTERN CAROLINA:Three-year varsity member as an infi elder and catcher at Chase High School in Forest City, N.C. ... Three year Southwestern 2A-3A All-Conference and All-County award winner ... Named to the All-State team his senior year ... Career .407 hitter with 73 total hits, 35 extra-base hits and 54 RBIs ... Helped lead Chase to the Southwestern 2A-3A conference championship his senior season.

PERSONAL:Full name is Brian Tyler White ... Son of Brian and Heather White ... Has one sibling, Blair, who attends USC Upstate.

2012 (FRESHMAN):Made 22 appearances - the fourth-most on the squad - all coming in relief out of the bullpen ... Threw 16.0 innings with six strikeouts against eight walks, fi nishing with an 0-3 record ... Allowed runs in just 10 of his 22 appearances, working 10 hitless outings ... Suffered three losses after throwing only a combined 27 pitches - including taking the loss against Davison

(March 31) after throwing only two pitches ... Recorded 17 fl y ball outs and 21 ground outs including three double plays ... Tossed a career-high 2.1 innings out of the bullpen in WCU’s win over East Tennessee State (March 7) ... Took the loss at home against Kennesaw State after three seeing-eye singles set the table ... WCU scored the win in 11 of the 22 games in which he saw action; Summer League: Played for the Gastonia Grizzlies of the Coastal Plain League ... Made 17 appearances including two starts, tossing 27 innings on the summer ... Finished with an 8.67 ERA with 26 of the 28 runs allowed being earned ... Struck out 18 against 23 walks ... Only seven of the 30 hits allowed went for extra bases.

PRIOR TO WESTERN CAROLINA:Helped Myers Park HS win 45 games over three seasons including a conference tour-nament championship as a sophomore and runner-up fi nish as a senior ... Was a team captain as a senior ... Selected to the All-South Charlotte team ... Was drafted by the Texas Rangers in the 46th round of the 2011 Major League Baseball First-Year Player Draft ... Captained his junior varsity baseball team as a freshman ... Addition-ally played two years of varsity basketball.

PERSONAL:Full name is Tyler William White Powell ... Is the son of Bill and Patty Powell ... Has two siblings – Brooke Castelloe and Casey Powell.

Tyler POWELL6-5 210 So. RHP R/R

Charlotte, N.C. Myers Park HS

26

P O W E L L’ S C A R E E R P I T C H I N G S TAT I S T I C SYEAR ERA W L APP GS CG SHO SV IP H R ER BB SO WP2012 9.56 0 3 22 0 0 0 0 16.0 22 21 17 8 6 2

2012 (FRESHMAN):Played in 52 games, making 47 starts including 33 as the des-ignated hitter, seven in right fi eld and seven at fi rst base ... Led the team with 45 RBI on the year, racing out of the gates with 30 runs driven in through the fi rst 19 games before an oblique strain slowed his pace ... Finished with a .308 collective batting average, collecting 18 extra base hits among the 57 on the sea-

son ... His batting average did not dip below .306 all season, recording hits in all but 16 of the 52 games he played ... Was second on the team with 14 doubles ... Paced the squad with six sacrifi ce fl ies ... Named second team All-Southern Conference as a designated hitter, while also being tabbed to the SoCon All-Freshman Team by the league’s head coaches ... Was additionally selected second team All-SoCon by College Sports Madness ... Named to the Louisville Slugger Freshman All-America team as selected and announced by Collegiate Baseball Newspaper ... Made two appearances on the mound, tossing two-thirds of an in-ning offi cially with two walks and a wild pitch ... In his fi rst collegiate game, fi nished 4-for-5 with a home run and two doubles including one in his fi rst career at-bat with three RBI in the win over Fordham (February 17) ... Drove in a career-best fi ve runs in the home win over Duke (March 6) on a 3-for-5 outing with two doubles; Summer League: Played with the Waynes-boro Generals of the Valley League during the summer of 2012 ... Finished ranked third on the team with a .348 (56-of-161) batting average with 19 extra base hits in-cluding 11 doubles and a triple and seven home runs ... Had a .559 slugging percent-age ... Drove in 38 RBI ... Also made 11 pitching appearances for a combined 14 innings with a 2-1 record and a 1.29 ERA ... Walked 12 against 22 strikeouts giving up three runs, two of which were earned ... Was selected as the Generals’ player of the week ... Named to the midseason All-Star team in the Valley League ... Named by Per-fect Game as the 14th best prospect out of the Valley League.

PRIOR TO WESTERN CAROLINA:Was a three-time All-Northwestern 3A/4A Conference selection, garnering the honor each of his fi nal three seasons as a prep ... Posted a career .457 batting average with 91 hits including 27 doubles, four triples and 10 home runs ... Drove in 59 runs with a career slugging percentage of .784 ... Tossed a no-hitter against Watauga for St. Stephen High ... Picked up all-tournament team plaudits following a Easter weekend tournament as a junior ... Named an all-star for Hickory Post 48 in American Legion baseball during the summer months, hitting .425 with 12 doubles, a triple and 10 home runs ... As a pitcher, posted a 9-1 record with four saves in legion ball ... Also lettered in swimming as a sophomore, plac-ing in the state 3-A Championships.

PERSONAL:Full name is Jacob Edwin Hoyle ... Is the son of Terry and Jean Hoyle ... Has a sister, Katie.

Jacob HOYLE6-2 250 So. 1B/LHP L/L

Hickory, N.C. St. Stephen HS

27

H O Y L E ’ S C A R E E R O F F E N S I V E S TAT I S T I C SYEAR AVG GP GS AB R H 2B 3B HR RBI BB SO SB ATT2012 .308 52 47 185 22 57 14 0 4 45 16 41 2 2



S M I T H ’ S C A R E E R P I T C H I N G S TAT I S T I C SYEAR ERA W L APP GS CG SHO SV IP H R ER BB SO WP2011 5.29 6 7 14 14 2 2 0 80.0 89 57 47 26 61 12012 3.48 4 5 16 15 1 1 2 95.2 91 40 37 45 78 7TOTAL 4.30 10 12 30 29 3 3 3 175.2 180 97 84 71 139 8

2012 (SOPHOMORE):Made 16 appearances including 15 starts ... Led the team with both 95.2 innings pitched - averaging a team-best 5.98 innings per appearance ... Finished with 78 strikeouts, tallying at least three strikeouts in every start ... Finished with a 4-5 overall record and a 3.48 earned run average, limiting foes to a .257 batting average against ... On the season, induced 110 ground

ball outs including nine double plays, with 76 fl y ball outs ... Threw 7.1 scoreless innings against Iona (March 2) to pick up his fi rst victory of the season ... Struck out a career-high 11 in eight innings, scoring the victory in game one of a double-header over UNC Greensboro (March 24) ... Threw one inning of relief out of the bullpen against Clemson (April 4) in a mid-week road victory ... Earned Southern Conference Pitcher of the Week honors after tossing a complete-game, fi ve-hit shutout in the road win over Georgia Southern (May 11) ... In a weather-shortened start against No. 24 Appalachian State (May 17), held the Mountaineers hitless through the fi rst fi ve innings, fi nishing with three hits through six frames before the game was halted ... Threw over 100 pitches in nine games on the year; Summer League: Pitched for the Cotuit Kettleers in the prestigious Cape Cod League in the summer of 2012 ... Made nine appearances on the summer including four starts, tossing 27.2 innings ... Fin-ished with a 2-3 overall record and a 6.83 ERA ... Posted 21 strikeouts against just six walks.

2011 (FRESHMAN):Started all 14 appearances he made on the mound including two complete game shutout victories ... His team-leading two CG’s were the most for a freshman Catamount pitcher since 1999 ... Posted a 6-7 overall record and a 5.29 ERA ... Was second on the team with 61 strikeouts while leading the squad with a 2.3 strikeout-to-walk ratio ... Ranked tied for 10th in the SoCon with 26 strikeouts looking ... Limited opponents to a .280 batting average against ... Induced six double plays, second on the team ... Made his fi rst career start, scat-tering two hits in fi ve scoreless innings in a win over Morehead State (February 19), striking out fi ve against three walks ... Struck out a career-best nine in eight, four-hit innings at Da-vidson (March 27) in scoring his fi rst Southern Conference victory ... Picked up his fi rst-ever complete game shutout, tossing a four-hitter against Wofford (April 23), striking out eight ... Scattered 10 base hits to earn a second complete game shutout against The Citadel (May

Jordan SMITH6-1 210 Jr. RHP R/RLiberty, N.C. Providence Grove HS

28

20), striking out seven ... Did struggle in two starts on the season, being lifted in the second inning at the College of Charleston (April 2) and at Appalachian State (May 8) ... Tossed over 100 pitches in a game six times on the season.

PRIOR TO WESTERN CAROLINA:Was the 16th-ranked baseball recruit in the state of North Carolina by PG Crosschecker, and ranks 331st in the nation by the same group ... Was selected to play for the North Carolina squad in the South Atlantic Border Battle ... Was a member of the 2009 Oakland Athletics Area Code Baseball team in Long Beach, Calif. ... Played summer baseball with NCBA Gold-en Spikes ... Named WCU’s Most Outstanding Pitcher from the team’s Fall World Series.

PERSONAL:Full name is Jordan Mark Smith ... Is the sone of Mark and Jodie Smith ... Has two siblings, Whitney and Connor.

NOTES ENTERING 2013:Named to the Louisville Slugger Preseason All-America team as selected and released by Collegiate Baseball ... Was one of four players selected as team captains after fall drills in Dec., 2011.

2012 (JUNIOR):Made a team-high 29 appearances out of the WCU bullpen as the closer, tossing 52.0 innings to rank fourth on the squad ...

Finished with a 1.73 ERA on the year, only allowing 18 runs - 10 of which were earned ... Seven of the 42 hits he allowed went for extra bases ... Recorded 55 strikeouts on the year, tallying at least one punch-out in all but three outings (26-of-29) and three-or-more K’s nine times ... Worked 60 ground ball outs and 27 fl y outs ... Matched the team-high with six wins, fi nishing 6-2 with a career-best 10 saves ... His 10 saves ranked him tied for second in the WCU single-season record books ... Named to the fi rst team All-Southern Conference as a relief pitcher by both the league’s head coaches and voting media ... Was additionally selected second team All-SoCon as a reliever by College Sports Madness ... Named to the 2012 University Division All-State Baseball Team by the Collegiate Sports Information As-sociation (NCCSIA) ... Earned the fi rst victory of the season in the opener against Fordham (February 17), throwing the fi nal two innings in a 9-8 win ... Later on opening day, picked up his fi rst save against the Rams, striking out one in an inning and a third of two-hit, one-run relief in the 12-9 win ... Tallied the save against No. 8 Georgia (February 29), fanning two in an 1.2 innings of hitless, scoreless relief ... Struck out a season-high fi ve in a long of fi ve innings of work against UNC Greensboro (March 24) to score his fourth victory of the season ... In late April, was among 45 pitchers named to the offi cial watch list for the 2012 National Collegiate Baseball Writers Association (NCBWA) Stopper of the Year Award ... Earned the win over No. 24 Appalachian State (May 17) for his sixth seasonal tally, tossing 2.1 innings with a pair of strikeouts against the Mountaineers ... Suffered the loss in two of the fi nal three games of the year including the fi nale in the conference tournament against eighth-seeded Furman (May 24); Summer League: Played for the Yarmouth-Dennis Red Sox in the Cape Cod Baseball League during the summer of 2012 ... Joined the squad later in the sum-mer ... Made 14 relief appearances, tossing 15.0 innings with a 3.00 ERA and an 0-1 record ... Struck out 18 batters against eight walks on the summer.

Preston HATCHER6-2 210 Sr. RHP R/RAtlanta, Ga. Roswell HS

30



H AT C H E R ’ S C A R E E R P I T C H I N G S TAT I S T I C SYEAR ERA W L APP GS CG SHO SV IP H R ER BB SO WP2010 8.06 1 2 13 5 0 1 0 22.1 27 29 20 20 12 12011 7.15 2 2 13 4 0 1 0 34.0 37 29 27 23 17 22012 1.73 6 2 29 0 0 2 10 52.0 46 18 10 22 55 5TOTAL 4.74 9 6 55 9 0 4 10 108.1 110 76 57 65 84 8

2011 (SOPHOMORE):Appeared in 13 games on the season making four starts on the mound with a 2-2 record ... Allowed 37 runs, only 29 of which were earned with a 7.15 ERA ... Opponents recorded a .291 batting average against ... Struck out 17 batters while issuing 23 walks on the year ... Just 10 of the 37 hits he allowed on the year went for extra bases ... Earned the starting nod on Sunday of the season-opening series against Morehead State (February 2) ... Took his fi rst loss of the season in relief at Eastern Kentucky (March 1) after giving up two runs on two hits with a pair of strikeouts ... Scored his fi rst win of the year with fi ve strong score-less, three-hit innings against High Point (March 29) ... It was his second victory over HPU in his fi rst two seasons ... Struck out a season-high four in three and two-thirds innings relief against Georgia Southern (April 16).

2012 (FRESHMAN):Pitched in 13 games including fi ve starts on the season, tossing 22.1 innings with 12 strike-outs against 20 walks with an 8.06 ERA and 1-2 record ... Tossed two thirds of an inning in relief in the 14-11 road win over Georgia Southern, entering the game after an injury to Daniel Ottone ... Earned his fi rst career start against UNC Greensboro, throwing three and a third and suffering his fi rst collegiate defeat ... Garnered his fi rst college victory at High Point, throwing fi ve and a third against the potent Panther offense, limiting HPU to fi ve runs - only one of which was earned - on fi ve hits ... Started against OVC Champion, Tennessee Tech, striking out a career-high six in four innings but suffered the road loss ... Only eight of the 27 hits allowed on the season went for extra bases, holding foes to a .287 seasonal bat-ting average ... WCU won nine of the 13 games in which he pitched ... Pitched for the Atlanta Astros of the Sunbelt Summer League.

PRIOR TO WESTERN CAROLINA:Spent four years as a varsity pitcher at Roswell High School in Roswell, Ga. ... Held a 2.50 ERA with a 6-1 record during his senior season ... Threw a career-high 62 strikeouts during his junior campaign, adding 50 during his senior year ... Earned All-Southeastern honors from Rawlings and Perfect Game ... Named a Rawlings All-American Honorable Mention.

PERSONAL:Full name is Preston James Hatcher ... Son of Thomas and Sharon Hatcher.

NOTE:Brister assisted neighbors in his hometown of Pleasant Grove, Ala., following a series of devastating tornadoes on April 27, 2011. Brister drove to nearby Hueytown and walked more than three miles to reach his home. “It was like a war zone,” Brister told the Asheville Citizen-Times. “Everything was completely

torn apart.” To remember the event, he writes the numbers “427” in the mound each time he pitches ... His story was named a fi nalist for the Tom Walter College Baseball Inspira-tion Award ... The Tom Walter College Baseball Inspiration Award recognizes examples of inspiration in baseball at the collegiate level and is named for Tom Walter, the head coach at Wake Forest who donated a kidney to freshman outfi elder Kevin Jordan prior to the 2011 season.

2012 (JUNIOR):Used primarily as a left-handed specialist, made 26 appearances on the season to rank third on the WCU pitching staff, offi cially tossing just 11.1 innings with a 6.35 ERA ... Re-corded 11 strikeouts against six walks, fanning two batters three times ... Made his Cata-mount debut in the second game of the season against Fordham (February 18) ... Held the opposition scoreless in 18 of his appearances with 14 hitless outings ... Four of the 17 hits he allowed on the season went for extra bases; Summer League: Started the summer with the Smokey Mountain Big Train in the Carolina-Virginia Collegiate League ... Left the Ten-nessee Big Train to join Rockbridge in the Valley League ... Three of his four appearances with Tennessee were starts, posting a 2-1 record ... With the Rapids, made six relief ap-pearances for a combined 4.2 innings ... Finished with a 13.50 ERA, allowing seven runs on seven hits, only one for extra bases ... Struck out three against four walks.

PRIOR TO WESTERN CAROLINA:AT GADSDEN STATE: Posted an 8-7 overall record with one save for head coach Josh John-son ... Tossed a combined 118 innings with 86 strikeouts against 44 walks in this freshman and sophomore seasons ... Was a part of a 32-9 region champion squad in 2010 and a 2011 team that fi nished 30-11, again winning the region championship ... During the sum-mer prior to enrolling at WCU, posted a 5-2 record with a 2.25 ERA for the Smoky Mountain Big Train squad in the Carolina-Virginia League; IN HIGH SCHOOL: Recorded a 13-4 overall record and one save in his fi nal two seasons as a prep, tossing 88.1 innings with 76 strike-outs against 23 walks ... Was named the West region Pitcher of the Year and was fi rst team All-State.

PERSONAL:Full name is Garrett Hunter Brister ... Is the son of Rusty and Danata Brister ... Was born in Birmingham, Ala

Hunter BRISTER6-0 190 Sr. LHP L/L

Pleasant Grove, Ala. Gadsden State /

Pleasant Grove HS

32

B R I S T E R ’ S C A R E E R P I T C H I N G S TAT I S T I C SYEAR ERA W L APP GS CG SHO SV IP H R ER BB SO WP2012 6.35 0 0 26 0 0 0 0 11.1 17 9 8 6 11 1



PRIOR TO WESTERN CAROLINA:Was a three-time, fi rst-team All-County se-lection, hitting .510 for his prep career ... Amassed 49 career doubles, 16 triples and 23 home runs during high school, driving in 112 runs in three seasons ... Earned All-State plaudits both as a junior and a senior, also picking up Gatorade Player of the Year honors in the latter.

PERSONAL:Full name is Austin Michael Neary ... Is the son of Mike and Lisa Neary ... He was born in Rock Hill, S.C. ... Has a younger brother, Doug ... Both of his parents are former ACC Track & Field Champions at Clemson – his mother was all-conference in the discus and javelin, while his father excelled in the hammer and weight throws.

2012 (JUNIOR):Made 16 appearances on the mound including three starts, posting a 4-2 overall record ... Pitched 36.2 innings on the season with a 4.91 ERA, fi nishing with 24 strikeouts against only eight walks ... Went 1-1 as a starting pitcher with an ERA of 4.24, striking out 12 batters with just two walks ... Only al-lowed two extra base hits as a starting pitcher ... Finished 3-1

as a reliever with 13 appearances out of the bullpen ... Made his fi rst career start at WCU in the home win over East Tennessee State (March 7), limiting the Bucs to two runs on six hits with a career-high six strikeouts in a career-high tying six innings of work ... Matched his career-long with six innings at home against UNC Greensboro (March 25), scattering eight hits and fi ve runs in the loss ... Scored both wins as WCU took the conference road series at Elon, throwing two-thirds of a frame to win on May 5 and two and a third innings on May 6, holding the Phoenix to two runs on two hits with a pair of walks and a strikeout.

PRIOR TO WESTERN CAROLINA:Earned fi rst team all-conference accolades as a sophomore while also being dubbed fi rst team All-Northern California ... Recorded 45 strikeouts in 77.2 innings pitched with a 4-2 overall record and one save ... In two seasons of junior college, only allowed one extrabase hit; At Petaloma HS: Was a three-time All-League selection during his fi nal three years of high school, also picking up All-Empire honors during the same span.

PERSONAL:Full name is Jonathan Joseph Nadale ... Is the son of Marc and Cindy Nadale ... His father was an All-American baseball player at San Francisco State ... Has a younger sister, Allison.

Jon NADALE5-11 210 Sr. LHP L/L

Petaloma, Calif. Santa Rosa JC / Petaloma HS

34

2012 (FRESHMAN):Saw limited action as a true freshman, coming off of off-season shoulder surgery ... Only played in four games including two starts, making his collegiate debut against eventual Big Ten champion, Purdue (February 26) at the Keith LeClair Classic as the designated hitter ... Finished 2-for-9 (.222) at the plate ... Secured his fi rst collegiate base hit at home against Iona (March

3) with a pinch hit RBI single down the left fi eld line in the sixth inning ... Made his fi rst-ever start in the fi eld in the fi nal game of the Jacksonville, Fla., trip, starting at third base against Fairfi eld (March 18); Summer League: Played for the Wisconsin Rapids Rafters in the Northwoods League ... Finished second on the team with a .306 batting average (57-of-186) including 18 extra base hits with 11 doubles, one triple and six home runs ... Scored 24 runs ... Stole nine bases in 14 attempts.

Austin NEARY6-3 210 So. INF R/R

Baltimore, Md. Archbishop Spalding HS

33

N E A R Y ’ S C A R E E R O F F E N S I V E S TAT I S T I C SYEAR AVG GP GS AB R H 2B 3B HR RBI BB SO SB ATT2012 .222 4 2 9 1 2 0 0 0 1 0 1 0 0

N A DA L E ’ S C A R E E R P I T C H I N G S TAT I S T I C SYEAR ERA W L APP GS CG SHO SV IP H R ER BB SO WP2012 4.91 4 2 16 3 0 0 0 36.2 50 27 20 8 24 0



2012 (JUNIOR):Saw action in 16 games including starting nine games mid-week for the Catamounts, posting a 5-2 record - all but two of his decisions on the year came as a starter ... His fi ve wins were third on the team in 2012 ... Threw 50.1 innings on the season to rank fi fth on the squad, fi nishing with a 4.65 ERA ... Struck out 26 batters against 23 walks and four hit batters ... Limited op-ponents to just a .290 batting average against ... Posted a 4-1

record as a starter, striking out 18 batters with a 4.06 ERA ... Scored a mid-week victory over eighth-ranked Georgia (February 29), tossing 6.2 innings with three walks and two strike-outs in the 5-3 road win in Athens ... In his very next start, scored the home win over Duke (March 6) by tossing a career-long seven innings and striking out a career-best fi ve ... Picked up his fourth victory of the year in relief as a part of WCU’s three-game sweep of Furman (April 15), striking out four in 3.1 relief innings; Summer League: Played for the Waynesboro Generals in the Valley League during the summer of 2012 ... Made eight starts on the sea-son, tossing 46.1 innings ... Finished with a 4.08 ERA and a 3-1 record ... Struck out 27 bat-ters against 14 walks ... Only nine of the 51 hits allowed on the summer were for extra bases.

2011 (SOPHOMORE):Pitched in 12 games on the season including fi ve starts with seven relief appearances ... Tossed 21.1 innings on the year fi nishing with a 1-4 overall record and a 9.70 ERA ... Struck out 13 batters against 10 walks ... Pitched a career-long 6.2 innings in scoring his fi rst vic-tory of the year at Kennesaw State (3/15), striking out a career-best four ... Scattered seven base hits through 6.2 innings while limiting the Owls to one run in the win ... Five of his fi rst six appearances on the year were in the starting role while the fi nal six times he threw came out of the bullpen.

2010 (FRESHMAN):Appeared 11 times out of the WCU bullpen, tossing a combined seven innings with a 2-0 record and an overall ERA of 9.00 ... Made his collegiate debut at Gardner-Webb, allow-

Adam CURTIS6-0 185 Sr. LHP L/LArden, N.C. T.C. Roberson HS

40

ing a double to his fi rst batter faced ... Bounced back to throw a career-long 2.2 innings against SIU-Edwardsville, scattering three runs on six hits with a walk in picking up his fi rst collegiate victory ... Tallied his fi rst career strikeout at Appalachian State ... Twice fanned a career-best two, both coming against SoCon foes at home, Wofford and Furman ... WCU won seven of the 11 games in which he appeared ... Played summer baseball with the Lake Nor-man Copperheads of the Southern Collegiate League, joining classmate Bryant Noteboom.

PRIOR TO WESTERN CAROLINA:Earned numerous awards at T.C. Roberson High School under coach Donnie Suttles in Ar-den, N.C. ... Named three-time Mountain Athletic Conference Player of the Year after help-ing lead T.C. Roberson to two conference titles and three playoff apperances ... Earned two Conference Pitcher of the Year honors at T.C. Roberson.

PERSONAL:Full name is Adam Franklin Curtis ... Son of Frank and Mary Curtis.

C U R T I S ’ C A R E E R P I T C H I N G S TAT I S T I C SYEAR ERA W L APP GS CG SHO SV IP H R ER BB SO WP2010 9.00 2 0 11 0 0 0 0 7.0 14 8 7 4 5 02011 9.70 1 4 12 5 0 0 0 21.1 34 24 23 10 13 22012 4.65 5 2 16 9 0 0 0 50.1 58 32 26 23 26 1TOTAL 6.41 8 6 39 14 0 0 0 78.2 106 64 56 37 44 3



2012 (JUNIOR):Suffered a shoulder injury during off-season drills in the fall of 2011 ... Missed the 2012 season after undergoing shoulder sur-gery ... Took a medical redshirt.

2011 (SOPHOMORE):Appeared in 19 games - fi fth on the team - including six starts (3rd) and 13 relief appearances out of the bullpen ... Tossed 43.2 innings on the season with a 2-3 overall record and an

8.86 ERA ... Ranked fourth on the team with 40 strikeouts, fanning at least one in 12 of his 19 appearances including four-or-more K’s six times ... 17 of his strikeouts were looking ... Picked off two runners on the season ... Opened the season as a weekend starter with his fi rst three starts coming on the weekend for WCU before being relegated to the bullpen ... Scored the victory in the season-opener against Morehead State (2/18), striking out fi ve in fi ve innings of three-hit, scoreless work ... Twice matched his career-high of six strikeouts in the start at UNC Asheville (4/12) and in relief at home against ACC-foe, Clemson (4/27) ... Picked up his fi rst career save by tossing two-thirds of an inning out of the bullpen as WCU downed Furman (5/13) in 16 innings ... Threw the fi nal inning and a third, striking out one for the Catamounts in picking up the victory in the epic 20-inning game against Elon (5/25) in the conference championship event ... Pitched in the prestigious Cape Cod Baseball League during the summer.

2010 (FRESHMAN):Pitched in 12 games including starting nine times, the most among WCU’s freshmen hurl-ers ... Tossed 50.1 innings with a 5.19 ERA, striking out 24 against 30 walks ... Moved from

Taylor SANDEFUR6-1 225 R-Jr. RHP R/RMechanicsville, Va. Atlee HS

452012 (JUNIOR):Saw action in a career-best 40 games including 21 appearances in the starting lineup ... Made 13 starts in left fi eld, fi ve in right fi eld and three as the designated hitter ... Hit .303 on the sea-son including a mark of .429 when playing as a non-starter ... Posted a .308 batting average as a pinch hitter, fi nishing 4-for-13, and was .326 against left-handed pitching ... Recorded fi ve

multiple hit games and two multiple RBI outings ... Had a pair of career-long, four-game hitting streaks ... Hit his fi rst collegiate home run against Iona (March 3), delivering a solo shot in the eighth inning as a part of a two extra base hit game, also doubling ... Belted two doubles as a part of a 2-for-2 pinch hit performance in the home win over East Tennessee State (March 7) ... Started a string of six-straight games from March 10 through March 24 ... Hit his second career home run on a solo shot over the fence in left-center at Elon (May 6); Summer League: Played in 17 games, making 55 at bats with West Virginia in the Pros-pect League before leaving the squad ... Was batting .218 with three doubles ... Joined the Coastal Plain League team and the Wilson Tobs ... Started nine of the 12 games in which he saw action, hitting .256 with four doubles, two homeruns and six RBI.

2011 (SOPHOMORE):Played in 24 games including three starts as the designated hitter ... Hit .250 on the year with half of his hits (6) coming as doubles (3) ... Also drew fi ve walks on the year ... A total of 15 of his 24 at bats on the season came as a pinch hitter, posting a .333 batting average in that role (5-of-15) ... Raised his seasonal batting average over 100 points in his fi nal eight games played ... Had one multiple RBI game with two driven in off a pinch hit double down the left-fi eld line against Furman (May 13) ... During the summer of 2011, was named to the Carolina-Virginia Collegiate League All-Star game.

Bryant NOTEBOOM

6-1 220 Sr. OF R/RSmithfield, N.C. Smithfield-Selma HS

44

N O T E BO O M ’ S C A R E E R O F F E N S I V E S TAT I S T I C SYEAR AVG GP GS AB R H 2B 3B HR RBI BB SO SB ATT2010 .385 15 9 26 6 10 1 0 0 3 4 6 1 12011 .250 24 3 24 3 6 3 0 0 3 5 6 0 02012 .303 40 21 76 14 23 6 0 2 11 9 22 3 3TOTAL .310 79 33 126 23 39 10 0 2 17 18 34 4 4

2010 (FRESHMAN):Played in 15 games including nine starts in right fi eld - seven coming in a row at the end of April through mid-May ... Recorded a .385 batting average with 10 hits in 26 at bats with six runs scored ... Made his fi rst appearance as a defensive substitution at Georgia Southern before tallying his fi rst career start at Georgia on April 28 ... Reached on a walk and scored against Georgia for his fi rst career run scored ... Secured his fi rst collegiate base hit on a single to centerfi eld in the fi fth inning against UNC Greensboro at home on May 1st ... It was also his fi rst career multiple-hit game - one of three in his rookie season ... Legged out his fi rst career double against Furman, a double to right-center to open the fourth inning ... Joined classmate Adam Curtis with the Lake Norman Copperheads of the Southern Col-legiate summer league.

PRIOR TO WESTERN CAROLINA:Four-year letterwinner at Smithfi eld-Selma Senior High School in Smithfi eld, N.C. ... Helped Smithfi eld-Selma with two conference championships ... Earned Greater Neuse River Aca-demic All-Conference and All-Conference honors in three years ... Earned Conference Player of the Year honors during his senior campaign after hitting .494 with 19 extra-base hits and 26 RBIs ... Earned All-State honors during his senior season ... Also, a three year All-Conference honoree in swimming.

PERSONAL:Full name is James Bryant Noteboom ... Nickname is ‘Boomer’ ... Son of Roger and Carlene Wood.



S A N D E F U R ’ S C A R E E R P I T C H I N G S TAT I S T I C SYEAR ERA W L APP GS CG SHO SV IP H R ER BB SO WP2010 5.19 1 2 12 9 0 0 0 50.1 58 39 29 30 24 52011 8.86 2 3 19 6 0 1 1 43.2 68 51 43 26 40 42012 DID NOT SEE GAME ACTION / INJURED – TOOK A MEDICAL REDSHIRTCareer 6.89 3 5 31 15 0 1 1 94.0 126 90 72 56 64 9

a mid-week starter and bullpen pitcher into the Friday night starter role, making six-con-secutive starts down the stretch in the season ... Made his fi rst collegiate appearance at Gardner-Webb, surrendering one run on three hits with a pair of walks in two-thirds of an inning ... Made his fi rst collegiate start against SIU-Edwardsville, walking three and strik-ing out two in three innings of one-hit, three-run work in a no-decision ... Garnered his fi rst collegiate career win after working fi ve innings against High Point, limiting the Panthers to four runs on seven this with two strikeouts ... Twice fanned a career-best six including at Georgia Southern and in his fi nal regular season start against Davidson ... Tossed a career-long 7.1 innings in the Southern Conference Tournament semifi nals against Appalachian State, striking out on against two walks, only surrendering two runs on six hits ... WCU won eight of the 12 games in which he appeared including six of his starts ... Pitched alongside teammate Andrew Blackwell with the Waynesboro Generals of the Valley League during the summer ... Earned the Cy Young Award for most outstanding pitcher in the Valley League.

PRIOR TO WESTERN CAROLINA:Four year varsity member at Atlee High School in Mechanicsville, Va. ... Earned All-Academic honors during his four years at Atlee High School ... Earned All-District honors as a fi rst baseman, utility player and pitcher during his three years at Atlee High School. Earned hon-orable mention all-region during his junior and senior seasons.

PERSONAL:Full name is Taylor Kirkwood Sandefur ... Son of David and Donna Sandefur ... Father David played football at Lees-McRae College ... Brother, Ryan, played baseball at the University of Virginia.

N U L L’ S C A R E E R P I T C H I N G S TAT I S T I C SYEAR ERA W L APP GS CG SHO SV IP H R ER BB SO WP2012 5.05 4 4 17 14 0 0 0 0 73.0 77 49 41 28 63

2012 (FRESHMAN):Made 17 appearances including 14 starts as the third weekend starting pitcher ... Finished the season with an overall record of 4-4 and a 5.05 ERA, tossing 73.0 innings with 63 strikeouts and 28 walks ... As a starter, had a 5.27 ERA with 58 K’s and 26 walks ... Posted a 2.84 ERA in three appearances out of the bull-pen, striking out fi ve against two walks in 6.1 innings of work ...

Recorded at least one strikeout in every start of his rookie season ... Named to the Southern Conference All-Freshman team ... Struck out a career-high eight batters in his col-legiate debut, scoring the victory over Ford-ham (February 18) after tossing fi ve and a third in the starting role ... Matched his career-best with eight K’s in the fi rst four innings against the College of Charleston (April 29), fi nishing with six innings of work while holding the Cougars to three runs on six hits ... Tossed a career-long seven innings in the starting role against David-son (April 1), fanning six to open his career at 4-0 ... Threw fi ve innings in relief in the Southern Conference tournament, holding eighth-seeded Furman (May 24) to two runs on six hits with three strikeouts.

PRIOR TO WESTERN CAROLINA:A two-time, All-Catawba Valley Athletic Conference selection as both a junior and senior, also garnering All-Region and All-Observer accolades ... Was named a Lou-isville Slugger High School All-American as a senior ... Was drafted by the Seattle Mariners in the 37th round of the 2011 Major League Baseball Draft.

PERSONAL:Is the son of Stephen and Michelle Null ... Has a sister, Haley.

Jeremy NULL6-8 230 So. RHP R/R

Claremont, N.C. Bunker Hill HS

46



PRIOR TO WESTERN CAROLINA:Played high school baseball at Cutherbertson HS for head coach Travis Little ... Was an All-Rocky River Conference selection three times, earning honorable mention in 2010 ... Was a part of the Cuthbertson High baseball program that accumulated a 73-11 record over its fi rst three years of existence, winning the league tournament title each year.

PERSONAL:Is the son of Jeff and Cathy Long ... His father, Jeff, was a two-sport student-athlete at Lenior-Rhyne, playing both football and baseball ... Was born in Orange Park, Fla.

PRIOR TO WESTERN CAROLINA:Started his prep career at shortstop, but was asked to move be-hind the plate ... Played prep baseball at Robert B. Glenn HS ... Also played basketball as a prep, earning All-County honors as a sophomore ... Suffered a torn ACL on the fi rst day of basketball practice his senior season ... Is expected to sit out the 2013 sea-son with a medical redshirt.

PERSONAL:Full name is Jason Caswell Smith ... Is the son of Mike and Debbie Smith ... Has on sibling, Casey ... Comes from a baseball family as his father, Mike; his grandfather played for the Cleveland Indians organization and his great grandfather was a part of three World Series with the New York Yankees.

PRIOR TO WESTERN CAROLINA:Played prep baseball for his father, Brad Strong, at Richlands HS ... Named to the West squad in the Virginia High School Coaches Association (VHSCA) All-Star game played at War Memorial Sta-dium in Hampton, Va. ... Collected two hits and drove in a run ... As a junior, hit .529 en route to earning second-time All-Group AA status. He was a fi rst-team All-Southwest District and Region IV selection ... As a sophomore, earned fi rst-team All Southwest

District and second team All-Region IV honors at second base ... Played AAU baseball dur-ing the summer for the Canes Delmarva program ... Also played football as a prep, splitting time under center and handling kicker/punter duties ... Threw for over 2,000 yards as a senior while setting school records for the most points by a kicker and longest fi eld goals in Richlands High history.

PERSONAL:Is the son of Brad and Mary Ann Strong ... Is a teammate with his older brother, Bradley.

PRIOR TO WESTERN CAROLINA:Played prep baseball at Panther Creek HS for head coach David Hall ... Was the fi rst-ever Panther Creek High baseball player to commit to a Division I baseball program ... Hit .382 as a junior, striking out just four times in 68 at bats ... Played with the Cary Independent baseball team that fi nished runner-up in the Cen-tral Carolina Scholastic Summer Baseball League during the summerm prior to his senior season.

PERSONAL:Is the son of Charlie and Becky Young ... Has two siblings - Chick and Tricia Young ... His father, Charlie, played collegiate baseball at the Univ. of Alabama.

PRIOR TO WESTERN CAROLINA:A four-year varsity team member, played high school baseball at Forsyth Central HS for head coach Kevin McCollum ... Earned All-Region and All-County accolades behind the plate ... Was the Forsyth Central team MVP fi nal three seasons as a prep ... Tagged as a “top prospect” by the BaseballFactory.com ... Listed among “Other Top Players” in the ESPNHS All-State baseball team.

PERSONAL:Full name is Daniel Alejandro Bermudez ... Is the son of Jose Bermudez and Lorena Fran-cis ... Was born in Caracas, Venezuela ... Has three siblings - Dayhana, Dayhali and David Bermudez.

PRIOR TO WESTERN CAROLINA:Finished his prep career by posting a 5-2 record on the mound with a 0.44 ERA, helping Commerce High to a 21-8 record and advancing to the second round of the Class A state playoffs ... Tallied 88 strikeouts as a senior ... Additionally hit .468 with four home runs and 36 RBIs ... Named to the Athens Banner-Herald All-Area team ... As a junior,

named the Region 8-A Pitcher of the Year after leading the Tigers to the playoffs with a 6-3 record ... Recorded 98 strikeouts and a 2.19 ERA while batting .420 with 30 RBI.

PERSONAL:Is the son of Conrad and Allison Davis ... Has one sibling, Madison.

J.D. LONG

Jason SMITH

Reece STRONG

Thomas YOUNG

Danny BERMUDEZ

Colton DAVIS

5-9 165 Fr. INF R/RWaxhaw, N.C. Cuthbertson HS

5-11 210 Fr. C / INF R/RKernersville, N.C. Glenn HS

5-8 170 Fr. INF L/RRichlands, Va. Richlands HS

6-4 165 Fr. RHP L/RCary, N.C. Panther Creek HS

5-11 205 Fr. C R/RCumming, Ga. Forsyth Central HS

5-11 210 Fr. C / INF R/RKernersville, N.C. Glenn HS

3

15

18

29

21

16

2013 WESTERN CAROLINA BASEBALL NEWCOMERS2013 WESTERN CAROLINA BASEBALL NEWCOMERS



PRIOR TO WESTERN CAROLINA:Attended USC Lancaster in Lancaster, S.C., out of high school ... As a sophomore at USCL, pitched 40 innings in 13 appear-ances, striking out 25 ... Posted a 4.73 ERA and a 6-1 overall record ... As a freshman in the spring of 2011, tossed 3.2 in-nings with fi ve strikouts against fi ve walks with a 2.45 ERA ...

Was an Academic All-America selection at USC-Lancaster.High School: Was an All-Rocky River Conference honorable mention as a junior and all-conference selection as a senior at Albemarle HS.

PERSONAL:Full name is John Crockett McClure ... Is the son of George and Janet McClure ... Has one sibling, Kathryn ... Was born in Fayetteville, N.C. ... Majoring in Sport Management prior to his transfer to WCU.

John McCLURE6-5 210 Jr. LHP L/LAlbemarle, N.C. USC Lancaster /Albemarle HS

312013 WESTERN CAROLINA BASEBALL NEWCOMERS2013 WESTERN CAROLINA BASEBALL NEWCOMERS

PRIOR TO WESTERN CAROLINA:Played high school baseball at Starmount HS for head coach Mike McCann ... Scouted as a big-bodied southpaw that sports a fastball in the 90s ... Ranked by Impact Baseball as one of North Carolina’s top 50 players ... Represented Region 7 in the North Carolina State Games ... Is coming off a knee injury suf-fered during basketball season of his senior year.

PERSONAL:Full name is Alex Dane Barr ... Is the son of Darwin and Lisa Barr ... Has two siblings - Jake and Erin ... Was born in Elkin, N.C. ... His grandfather played professional baseball in the Boston Red Sox organization.

PRIOR TO WESTERN CAROLINA:A three-year varsity letter winner, was a two-time All-Greater Neuse Conference selection as a junior and senior after posting back-to-back 5-3 records with fi ve complete games ... Addition-ally named Academic All-Conference in his fi nal two seasons as a prep ... Made the North Carolina State Games twice including after his senior season ... Also played basketball as a prep.

PERSONAL:Full name is Jonathan Lee Waszak ... Is the son of Donna Waszak ... Has one sibling, Caitlin.

Alex BARR

Jonathan WASZAK

6-1 235 Fr. LHP L/LHamptonville, N.C. Starmount HS

6-6 245 Fr. RHP R/RWendell, N.C. East Wake HS

36

47

NOTE:Is expected to redshirt in 2013, coming off an injury during his senior year of high school.

PRIOR TO WESTERN CAROLINA:Was a left-handed pitcher and fi rst baseman at Starmount HS, helping lead the Rams to the Mountain Valley Conference tour-nament title and No. 2 2-A seeding ... As a junior, compiled a

.284 batting average with three homeruns, fi ve doubles and 13 runs while also tossing 56.2 innings and allowing just 16 earned runs ... Finished with 85 strikeouts with a 1.98 ERA and a 4-5 record ... Played for the West All-Star team in the 2012 Powerade State Games of North Carolina held at Gene Hooks Field, the home of Wake Forest baseball ... Made relief appearances on the mound in the fi rst game and pinch hit in the second game ... Also played for his high school head coach Mike McCann in the State Games in 2011 as a junior ... Also played football as a prep where he was an All-Area selection as a lineman in 2010 and 2011. ... Was a high school teammate of fellow Catamount, Alex Barr.

Dillon BRAY5-11 200 Fr. LHP L/LHamptonville, N.C. Starmount HS

39







2 0 1 2 W E S T E R N C A R O L I N A B A S E B A L L – S E A S O N I N R E V I E W N O T E S

– Western Carolina fi nished the 2012 season with a 32-24 overall ... WCU secured its 24th 30-win season since 1984 (24, 30-win seasons in 29 years);

– In the 2012 Southern Conference tournament, WCU’s league-leading offense was stymied by four Bulldog pitch-ers as fourth-seeded Samford handed the Catamounts a 7-0 loss at Fluor Field ... Furman’s Alex Abrams chopped a 1-1 pitch through the middle of the infi eld to score Will Muzika from second base as eighth-seeded Furman elimi-nated WCU with a 9-8, walk-off win;

– Aaron Attaway set a WCU school-record by recording FIVE doubles as a part of a 6-for-6 showing against Iona at home on March 3 ... Previous record was three accomplished 17 times, most recent in 2009;

– For the fi rst-time ever in school history, Western Carolina took both ends of a home-and-home with perennial power, Clemson ... WCU won at home, 8-4, over the 24th-ranked Tigers before winning on the road, 13-8;

– WCU scored four wins over ranked opponents in 2012:Feb. 25 ...... at #20 East Carolina.................... L, 3-1Feb. 29 ...... at #8 Georgia ............................. W, 5-3March 14 ... vs. #23 Clemson ........................ W, 8-4May 17 ....... vs. #24 Appalachian State .......... W, 8-6May 18 ...... vs. #24 Appalachian State ........... L, 5-4May 19 ...... vs. #24 Appalachian State .......... W, 9-7

– Western Carolina played 13, one-run games fi nishing the regular season with a 7-5 overall record and 0-1 in the So-Con tournament ... the Catamounts have also played three extra inning games going 2-1 when playing “free baseball”;

– Western Carolina led the Southern Conference in team batting average, ending the regular season at .310 ... the Catamounts also paced the league with 30 sacrifi ce fl ies ... WCU’s pitching staff allowed a league-low 76 doubles;

– During the 56 games of the season, the Catamounts re-corded double-digit hits as a team 33 times and had nine-or-more hits a combined 39 times;

– A combined 34-percent of WCU’s RBI’s have come with two outs on the season ... the Catamounts have 109 two-out RBI of the 319 runs driven in on the year.

ROSS HEFFLEY IN WCU BASEBALL RECORD BOOKS: WCU senior Ross Heffl ey moved atop the school’s all-time career base hits ledger at Elon ... the Snellville, Ga., native fi nished his WCU career with 354 base hits, moving past previous school record holder, Barrett Shaft (336 from 2005-08) ... At the time of his graduation, ranked fourth in Southern Conference history all-time ... Additionally ranked on numerous WCU offensive career charts: at bats (933, 1st); career on-base percentage (.452, 1st); career batting average (.379, 3rd); total bases (532, 3rd); RBI (222, 3rd-t); doubles (51, 13th); sacrifi ce fl ies (12, 5th-t); home runs (35, 11th); base on balls (119, 11th) ... In the fi eld, his 513 career assists at second rank him fi fth in program history;

CLOSING THE ‘HATCH’ – RHP PRESTON HATCHER: – Preston Hatcher fi nished with 10 saves on the season to rank tied for second in the school’s single-season record books in the category – tying current Kansas City Royals closer, Greg Holland (2007);

FIVE CATAMOUNTS NAMED POST-SEASON ALL-SOCON: Five Catamount baseball players were honored on Mon-day as the Southern Conference unveiled its coaches’ all-conference teams. Senior ROSS HEFFLEY and junior reliever PRESTON HATCHER captured fi rst team All-SoCon honors with rookie DH JACOB HOYLE landing on the second team.

– Ross Heffl ey became one of three Catamounts to earn So-Con Player of the Week honors three times during their play-ing career ... Heffl ey joined Alan Beck (three times, 2001-03) and Grant Brittain (three times, 1990) to earn weekly plaudits three times in a career ... Heffl ey is one of four to have garnered three-or-more as Donovan Minero (2001-02) was a four-time weekly Player of the Week honoree;

HEFFLEY NAMED SOCON PLAYER OF WEEK (3/12): Senior infi elder Ross Heffl ey was named the SoCon’s Player of the Week as selected and released by the conference offi ce on March 12. Heffl ey led the Catamounts to a 4-1 record on the week including two home victories over non-conference foes Duke and East Tennessee State, as well as winning the league-opening series at The Citadel.

Heffl ey led the Catamounts with a .611 batting average last week, recording 11 hits in 18 at bats with a pair of dou-bles, amassing a .722 slugging percentage while scoring a team-high nine runs. He added to his team and SoCon-lead-ing 17 walks with six on the week including an intentional pass against the Bulldogs to boast a .708 on-base percent-age. He added three stolen bases (3-for-3) to stretch his team-lead to seven on the season - already matching his single-season career best from his previous three years. The preseason All-American at second base was perfect in the fi eld with 10 put outs and 10 assists.

In WCU’s home win over Atlantic Coast Conference (ACC) foe, Duke, Heffl ey fi nished a perfect 4-for-4 before closing

out the week with a 2-for-3 showing in the series clincher against The Citadel with three walks including the inten-tional pass and two stolen bags.

SMITH NAMED SOCON PITCHER OF WEEK (5/14): Following his complete game, fi ve-hit shutout, Western Carolina sophomore RHP Jordan Smith was named the Southern Conference’s Pitcher of the Week for all games from May 7-13.

A native of Liberty, N.C., Smith held Georgia Southern off the board and limited the Eagles to just fi ve hits as West-ern Carolina took the fi rst game of its three-game series in Statesboro, Ga. GSU’s fi ve hits were all singles while al-lowing just only one runner to reach second base in the 4-0 Catamount victory.

Smith retired the fi rst eight batters of the game before allowing the fi rst hit. He then sat down a string of seven-straight to open the contest recording out son 15 of the game’s fi rst 17 batters. Smith struck out four against one walk with one hit by pitch, and for the contest, limited Geor-gia Southern to a .167 batting average while improving to 4-4 on the season.

The complete game shutout was the third CG tossed by Smith in his young WCU career. Last season, Smith struck out eight in a complete game, four-hitter in an 11-0 victory over Wofford (April 23, 2011) and then later in the season, scattered 10 hits in a complete-game shutout victory over The Citadel (May 20, 2011).

WESTERN CAROLINA 2012 SoCon PLAYER OF THE WEEK NOTES:

Hoyle and classmates JEREMY NULL and BRADLEY STRONG were all named to the SoCon’s All-Freshman team following Monday’s vote.

HOYLE TABBED FRESHMAN ALL-AMERICAN: Jacob Hoyle was named to the Louisville Slugger Freshman All-America team as selected and announced by Collegiate Baseball Newspaper. Hoyle, who was selected as a desig-nated hitter, was a second team All-Southern Conference selection at the same position and was named to the So-Con’s All-Freshman team by the league’s head coaches fol-lowing the 2012 season;

– Hoyle spent the majority of the season as the DH, while also seeing time both at fi rst base and in the outfi eld for the Catamounts as well as two appearances on the mound. He played in 52 of WCU’s 56 games making 47 appearances among the starting lineup.

– Hoyle batted .308 during his rookie campaign with a .449 slugging percentage, collecting 57 hits including 14 doubles to rank second on the squad and four home runs. He led Western Carolina with 45 runs driven in on the year - eighth in the SoCon - despite being slowed at mid-season with an oblique strain. He also had a team-high six sacrifi ce fl ies.

ROSS HEFFLEY DRAFTED BY THE ATLANTA BRAVES: Western Carolina’s Ross Heffl ey (pictured above) was se-lected in the 18th round of the 2012 Major League Baseball First-Year Player Draft by the Atlanta Braves ... He was the 569th overall pick ... Heffl ey became the sixth WCU base-ball player drafted by Atlanta all-time joining Chris Mas-ters (11th round, 2009); Ryan Basner (7th round, 2003); Charles Thomas (19th round, 2000); Dave Piela (54th round, 1988); and Ron Huntington (39th round, 1986).



Overall Record: 32-24 Home: 19-7 Away: 12-14 Neutral: 1-3 SoCon: 16-14

WCU OPP OVERALL SOCON DATE OPPONENT SCORE R–H–E R–H–E INNINGS RECORD RECORD PITCHER OF RECORD ATTEND TIME

Feb 17, 2012 FORDHAM W 9-8 9-16-1 8-11-1 9 1-0-0 0-0-0 Hatcher (W 1-0) 679 3:19 Feb 17, 2012 FORDHAM W 6-1 6-9-1 1-4-2 9 2-0-0 0-0-0 McKinney (W 1-0) 489 2:41 Feb 18, 2012 FORDHAM W 12-9 12-16-4 9-8-3 9 3-0-0 0-0-0 Null (W 1-0) 476 3:28 Feb 21, 2012 at Winthrop W 13-3 13-16-1 3-3-1 9 4-0-0 0-0-0 Curtis (W 1-0) 443 2:38 Feb 25, 2012 vs. Maryland % 0-3 L 0-4-3 3-6-0 9 4-1-0 0-0-0 Jo. Smith (L 0-1) 0 2:28 Feb 25, 2012 at East Carolina % 1-3 L 1-4-0 3-9-1 9 4-2-0 0-0-0 McKinney (L 1-1) 0 2:10 Feb 26, 2012 vs. Purdue % 7-14 L 7-8-1 14-18-3 9 4-3-0 0-0-0 Powell (L 0-1) 0 3:15 Feb 29, 2012 at Georgia W 5-3 5-5-0 3-7-1 9 5-3-0 0-0-0 Curtis (W 2-0) 1319 2:44 March 02, 2012 IONA W 2-0 2-9-1 0-8-1 9 6-3-0 0-0-0 Jo. Smith (W 1-1) 119 2:15 March 03, 2012 IONA W 22-2 22-18-1 2-3-4 9 7-3-0 0-0-0 McKinney (W 2-1) 127 3:00 March 04, 2012 IONA W 8-4 8-11-0 4-11-0 9 8-3-0 0-0-0 Null (W 2-0) 0 March 06, 2012 DUKE W 12-4 12-14-0 4-8-2 9 9-3-0 0-0-0 Curtis (W 3-0) 427 2:41 March 07, 2012 EAST TENNESSEE STATE W 7-3 7-11-2 3-9-1 9 10-3-0 0-0-0 Nadale (W 1-1) 257 2:30 March 09, 2012 at The Citadel * 2-4 L 2-8-2 4-9-0 9 10-4-0 0-1-0 Jo. Smith (L 1-2) 218 3:12 March 10, 2012 at The Citadel * W 11-4 11-15-1 4-8-2 9 11-4-0 1-1-0 McKinney (W 3-1) 433 3:35 March 11, 2012 at The Citadel * W 6-5 6-11-1 5-8-2 9 12-4-0 2-1-0 Hatcher (W 2-0) 382 3:14 March 14, 2012 CLEMSON W 8-4 8-14-4 4-7-2 9 13-4-0 2-1-0 Nadale (W 2-0) 1627 2:40 March 16, 2012 at Jacksonville ! 2-5 L 2-5-2 5-7-1 9 13-5-0 2-1-0 Jo. Smith (L 1-3) 577 2:40 March 17, 2012 at Jacksonville ! W 2-1 2-7-0 1-4-2 9 14-5-0 2-1-0 Hatcher (W 3-0) 367 2:18 March 18, 2012 vs. Fairfi eld ! W 10-3 10-11-2 3-6-2 9 15-5-0 2-1-0 Null (W 3-0) 454 2:42 March 21, 2012 at UNC Asheville @ 1-3 L 1-12-1 3-11-2 (12) 15-6-0 2-1-0 Nadale (L 2-1) 659 3:49 March 24, 2012 UNC GREENSBORO * W 16-2 16-19-1 2-8-3 9 16-6-0 3-1-0 Jo. Smith (W 2-3) 235 3:09 March 24, 2012 UNC GREENSBORO * W 6-5 6-15-3 5-12-1 (11) 17-6-0 4-1-0 Hatcher (W 4-0) 442 3:35 March 25, 2012 UNC GREENSBORO * 1-5 L 1-7-1 5-8-0 9 17-7-0 4-2-0 Nadale (L 2-3) 328 2:39 March 27, 2012 KENNESAW STATE 9-11 L 9-16-3 11-13-1 9 17-8-0 4-2-0 Powell (L 0-2) 492 4:00 March 28, 2012 at Kennesaw State W 7-6 7-13-0 6-9-1 (10) 18-8-0 4-2-0 Hatcher (W 5-0) 263 4:04 March 31, 2012 DAVIDSON * W 12-6 12-14-1 6-11-0 9 19-8-0 5-2-0 Sluder (W 1-0) 173 3:10 March 31, 2012 DAVIDSON * 5-7 L 5-11-4 7-5-2 9 19-9-0 5-3-0 Powell (L 0-3) 128 2:55 April 01, 2012 DAVIDSON * W 5-3 5-14-0 3-6-2 9 20-9-0 6-3-0 Null (W 4-0) 117 2:29 April 04, 2012 at Clemson W 13-8 13-22-1 8-13-4 9 21-9-0 6-3-0 Blackwell (W 1-0) 3437 3:39 April 06, 2012 at Wofford * 0-2 L 0-9-0 2-9-1 9 21-10-0 6-4-0 Jo. Smith (L 2-4) 278 2:33 April 07, 2012 at Wofford * W 4-2 4-7-0 2-6-1 9 22-10-0 7-4-0 McKinney (W 4-1) - 2:46 April 07, 2012 at Wofford * 5-6 L 5-9-4 6-8-0 9 22-11-0 7-5-0 Null (L 4-1) 412 2:35 April 13, 2012 FURMAN * W 3-0 3-8-0 0-8-2 9 23-11-0 8-5-0 Jo. Smith (W 3-4) 217 2:31 April 14, 2012 FURMAN * W 9-2 9-14-0 2-12-3 9 24-11-0 9-5-0 McKinney (W 5-1) 503 3:02 April 15, 2012 FURMAN * W 11-5 11-16-3 5-8-4 9 25-11-0 10-5-0 Curtis (W 4-0) 284 2:55 April 17, 2012 at Gardner-Webb 4-6 L 4-11-1 6-12-0 9 25-12-0 10-5-0 Sluder (L 1-1) 225 2:52 April 20, 2012 at Samford * 3-6 L 3-8-1 6-9-0 9 25-13-0 10-6-0 Sluder (L 1-2) 422 2:44 April 21, 2012 at Samford * 2-4 L 2-10-1 4-7-0 9 25-14-0 10-7-0 McKinney (L 5-2) 873 2:32 April 22, 2012 at Samford * 9-10 L 9-15-0 10-13-0 9 25-15-0 10-8-0 Curtis (L 4-1) 417 3:08 April 25, 2012 at East Tennessee State W 6-1 6-7-1 1-4-0 9 26-15-0 10-8-0 Curtis (W 5-1) 211 2:30 April 27, 2012 COL. OF CHARLESTON * 4-5 L 4-8-0 5-9-1 9 26-16-0 10-9-0 Chavis (L 0-1) 321 2:20 April 28, 2012 COL. OF CHARLESTON * W 7-6 7-14-1 6-5-0 9 27-16-0 11-9-0 McKinney (W 6-2) 387 2:32 April 29, 2012 COL. OF CHARLESTON * 2-6 L 2-7-2 6-8-2 9 27-17-0 11-10-0 Null (L 4-2) 381 3:00 May 05, 2012 at Elon * W 6-5 6-13-0 5-8-2 9 28-17-0 12-10-0 Nadale (W 3-2) 303 3:14 May 06, 2012 at Elon * W 11-9 11-15-1 9-15-4 9 29-17-0 13-10-0 Nadale (W 4-2) 323 3:28 May 07, 2012 at Elon * 4-11 L 4-7-5 11-8-0 9 29-18-0 13-11-0 Null (L 4-3) 175 2:53 May 11, 2012 at Georgia Southern * W 4-0 4-13-0 0-5-0 9 30-18-0 14-11-0 Jo. Smith (W 4-4) 1103 2:47 May 12, 2012 at Georgia Southern * 4-16 L 4-11-4 16-18-1 9 30-19-0 14-12-0 McKinney (L 6-3) 1062 3:22 May 13, 2012 at Georgia Southern * 1-2 L 1-3-0 2-9-0 9 30-20-0 14-13-0 Null (L 4-4) 914 2:19 May 15, 2012 WINTHROP 5-11 L 5-9-2 11-20-2 9 30-21-0 14-13-0 Curtis (L 5-2) 53 2:52 May 17, 2012 APPALACHIAN STATE * W 8-6 8-9-1 6-9-1 9 31-21-0 15-13-0 Hatcher (W 6-0) 571 2:31 May 18, 2012 APPALACHIAN STATE * 4-5 L 4-11-3 5-12-3 9 31-22-0 15-14-0 Hatcher (L 6-1) 482 3:03 May 19, 2012 APPALACHIAN STATE * W 9-7 9-11-2 7-8-1 9 32-22-0 16-14-0 Blackwell (W 2-0) 515 2:54 May 23, 2012 vs. Samford ^ 0-7 L 0-4-4 7-13-0 9 32-23-0 16-14-0 Jo. Smith (L 4-5) 1628 2:56 May 24, 2012 at Furman ^ 8-9 L 8-16-2 9-14-1 9 32-24-0 16-14-0 Hatcher (L 6-2) 1132 3:26

* = Southern Conference game | % = Keith LeClair Classic (Greenville, N.C.) | ! = Game played at Sessions Stadium (Jacksonville, Fla.@ = Game played at McCormimck Field (Asheville, N.C.) | ^ = Southern Conference Tournament (Fluor Field in Greenville, S.C.) | () extra inning game

2 0 1 2 W E S T E R N C A R O L I N A B A S E B A L L – R E S U LT S



Overall Record: 32-24 Home: 19-7 Away: 12-14 Neutral: 1-3 SoCon: 16-14

## NAME AVG GP GS AB R H 2B 3B HR RBI TB SLG% BB HBP SO GDP OB% SF SH SB–SBA PO A E FLD%

20 Tyler White .354 56 56 212 41 75 16 0 1 30 94 .443 29 9 21 6 .445 4 4 3 9 414 39 6 .987 2 Ross Heffl ey .346 56 56 231 47 80 12 1 9 43 121 .524 35 4 14 2 .436 3 0 16 18 118 166 6 .979 4 Julian Ridings .331 53 44 160 24 53 8 1 3 21 72 .450 5 1 25 0 .353 1 10 12 15 97 4 5 .953 12 Cody Jones .312 53 50 199 40 62 5 0 3 23 76 .382 18 1 36 2 .367 3 3 11 17 119 2 3 .976 27 Jacob Hoyle .308 52 47 185 22 57 14 0 4 45 83 .449 16 3 41 2 .362 6 0 2 2 69 4 1 .986 1 Bradley Strong .303 55 46 178 27 54 8 3 1 24 71 .399 4 2 31 1 .324 1 5 8 11 22 96 13 .901 3 Aaron Attaway .302 56 56 248 37 75 10 0 1 32 88 .355 23 0 39 2 .360 1 1 7 10 89 166 20 .927 11 Adam Martin .281 56 53 192 35 54 9 2 7 33 88 .458 25 7 40 4 .377 4 1 2 4 302 44 3 .991 14 Dykota Spiess .254 55 39 142 28 36 12 0 5 27 63 .444 21 5 34 1 .358 5 1 1 2 69 3 0 1.000

5 Luke Gragg .327 37 7 52 11 17 0 0 0 8 17 .327 12 5 12 2 .479 2 1 3 3 7 0 0 1.000 8 Dale Urquhart Jr. .308 31 11 52 8 16 4 0 3 11 29 .558 8 0 17 0 .400 0 1 1 2 8 0 1 .889 21 Bryant Noteboom .303 40 21 76 14 23 6 0 2 11 35 .461 9 2 22 0 .391 0 0 3 3 37 3 1 .976 36 Connor Andrus .268 32 16 56 8 15 5 0 0 8 20 .357 3 7 6 1 .379 0 2 0 0 101 11 2 .982 33 Austin Neary .222 4 2 9 1 2 0 0 0 1 2 .222 0 0 1 0 .222 0 0 0 0 1 1 1 .667 9 Garrett Brown .167 24 0 6 8 1 0 0 0 2 1 .167 1 0 3 0 .286 0 1 5 6 5 0 1 .833 7 Vance Chavis .000 1 0 0 0 0 0 0 0 0 0 .000 0 0 0 0 .000 0 0 0 0 1 6 2 .778 32 Darron Dotson .000 6 0 0 2 0 0 0 0 0 0 .000 0 0 0 0 .000 0 0 0 0 2 1 0 1.000

Totals .310 56 56 1998 353 620 109 7 39 319 860 .430 209 46 342 23 .383 30 30 74 102 1485 626 80 .963 Opponents .268 56 56 1895 288 507 76 6 32 255 691 .365 237 55 399 45 .362 18 38 38 61 1472 568 76 .964

LOB - Team (488), Opp (470). DPs turned - Team (54), Opp (31). IBB - Team (7), Heffl ey 5, Martin 1, Attaway 1, Opp (11).Picked off - Jones 3, Heffl ey 2, Hoyle 1, B. Strong 1.

(All games Sorted by Earned run avg)

## PLAYER ..................... ERA W L APP GS CG SHO CBO SV IP H R ER BB SO 2B 3B HR AB B/AVG WP HBP BK SFA SHA

28 Jordan Smith ............. 3.48 4 5 16 15 1 1 2 0 95.2 91 40 37 45 78 17 1 6 354 .257 7 12 1 2 6 22 Morgan McKinney ..... 3.74 6 3 15 15 0 0 0 0 84.1 76 45 35 41 68 13 1 4 313 .243 7 13 0 2 11 46 Jeremy Null ............... 5.05 4 4 17 14 0 0 0 0 73.0 77 49 41 28 63 10 2 8 284 .271 8 9 1 5 5

17 William Frazier .......... 0.00 0 0 4 0 0 0 0 0 3.0 1 0 0 0 6 0 0 0 10 .100 0 0 1 0 0 30 Preston Hatcher ........ 1.73 6 2 29 0 0 0 2 10 52.0 46 18 10 22 55 5 0 2 186 .247 5 1 0 1 5 7 Vance Chavis ............. 2.08 0 1 28 0 0 0 0 3 26.0 21 8 6 12 25 2 0 3 97 .216 2 1 0 0 1 32 Darron Dotson ........... 3.45 0 0 18 0 0 0 0 0 15.2 14 6 6 12 15 3 0 1 59 .237 1 2 0 0 0 40 Adam Curtis .............. 4.65 5 2 16 9 0 0 0 0 50.1 58 32 26 23 26 11 0 2 200 .290 1 4 2 3 5 34 Jon Nadale ................ 4.91 4 2 16 3 0 0 0 0 36.2 50 27 20 8 24 5 0 4 156 .321 0 0 1 2 2 6 Hunter Brister............ 6.35 0 0 26 0 0 0 0 0 11.1 17 9 8 6 11 3 1 0 48 .354 1 1 0 0 1 29 Andrew Blackwell ...... 6.60 2 0 14 0 0 0 0 0 15.0 18 15 11 16 10 2 0 0 60 .300 4 4 0 0 1 38 Jeremy Sluder ........... 7.36 1 2 15 0 0 0 0 0 14.2 13 15 12 12 12 2 0 1 56 .232 1 4 0 1 0 26 Tyler Powell ............... 9.56 0 3 22 0 0 0 0 0 16.0 22 21 17 8 6 2 1 0 64 .344 2 4 0 2 1 19 Danny Schneider ....... 13.50 0 0 2 0 0 0 0 0 0.2 1 1 1 2 0 0 0 1 3 .333 0 0 0 0 0 27 Jacob Hoyle ............... 13.50 0 0 2 0 0 0 0 0 0.2 2 2 1 2 0 1 0 0 5 .400 1 0 0 0 0

Totals ........................ 4.20 32 24 56 56 1 3 2 13 495.0 507 288 231 237 399 76 6 32 1895 .268 40 55 6 18 38 Opponents ................ 5.59 24 32 56 56 3 3 2 14 490.2 620 353 305 209 342 109 7 39 1998 .310 60 46 6 30 30

PB - Team (5), Martin 3, Andrus 2, Opp (12). Pickoffs - Team (9), Hatcher 3, Jo. Smith 2, McKinney 1, Sluder 1, Chavis 1, Andrus 1, Opp (7). SBA/ATT - Martin (28-44), Jo. Smith (9-16), Andrus (10-15), Null (9-13), McKinney (7-8), Dotson (4-6), Hatcher (2-6), Nadale (3-3), Chavis (1-3), Blackwell (1-2), Curtis (2-2), Powell (0-1), Brister (0-1).

2 0 1 2 W E S T E R N C A R O L I N A B A S E B A L L – O V E R A L L S TAT I S T I C S



2 0 1 2 W E S T E R N C A R O L I N A B A S E B A L L – G A M E S S U M M A R Y

2 0 1 1 W E S T E R N C A R O L I N A B A S E B A L L – M I S C . S TAT I S T I C S

WIN-LOSS SUMMARY:Total ......................................32-24Conference ............................16-14Non-Conf ...............................16-10Home .......................................19-7Away ......................................12-14Neutral ......................................1-3Day ........................................26-17Night ..........................................6-7vs Left ......................................12-5vs Right ..................................20-191-Run games .............................7-62-Run games .............................7-85+Run games...........................12-5Extra inns ...................................2-1Shutouts ....................................3-3Scoring 0-2 runs.......................2-11Scoring 3-5 runs.........................5-9Scoring 6-9 runs.......................14-4Scoring 10+ runs ......................11-0Opponent 0-2 runs ...................10-2Opponent 3-5 runs ...................13-9Opponent 6-9 runs .....................9-7Opponent 10+ runs ....................0-6Scored in 1st inning ................. 17-7Scores fi rst .............................23-13

INNING-BY-INNING SUMMARY 1 2 3 4 5 6 7 8 9 EX TOTALWESTERN CAROLINA ............ 47 45 39 44 34 60 29 30 22 3 353OPPONENTS ......................... 29 25 25 28 53 48 26 29 22 3 288

Opp. scores fi rst .......................9-11After 6 leading .........................27-3After 6 trailing ..........................4-19After 6 tied .................................1-2After 7 leading .........................26-1After 7 trailing ..........................4-21After 7 tied .................................2-2After 8 leading .........................28-1After 8 trailing ..........................2-21After 8 tied .................................2-2Hit 0 home runs ......................15-13Hit 1 home run .........................11-7Hit 2+ home runs ........................6-4Opponent 0 home runs ...........20-14Opponent 1 home run .................8-6Opponent 2+ HRs .......................4-4Made 0 errors ..........................11-5Made 1 error ............................14-6Made 2+ errors ........................7-13Opp. made 0 errors ..................5-11Opp. made 1 error ....................10-7Opp. made 2+ errors ................ 17-6Out-hit opponent ......................27-7Out-hit by opponent .................1-16Hits are tied ...............................4-1

RECORD WHEN TEAM SCORES:Runs 0 1 2 3 4 5 6 7 8 9 10+W-L 0-3 0-4 2-4 1-1 2-5 2-3 5-0 3-1 3-1 3-2 11-0

RECORD WHEN OPPONENT SCORES:Runs 0 1 2 3 4 5 6 7 8 9 10+W-L 3-0 3-0 4-2 5-3 4-2 4-4 4-4 1-2 2-0 2-1 0-6

RECORD WHEN LEADING AFTER:Inn. 1 2 3 4 5 6 7 8W-L 13-4 19-7 22-6 24-8 25-7 27-3 26-1 28-1

RECORD WHEN TRAILING AFTER:Inn. 1 2 3 4 5 6 7 8W-L 2-9 1-10 2-13 3-14 6-15 4-19 4-21 2-21

RECORD WHEN TIED AFTER:Inn. 1 2 3 4 5 6 7 8W-L 17-11 12-7 8-5 5-2 1-2 1-2 2-2 2-2

GENERAL SUMMARY:Current losing streak ...................... 2Longest winning streak................... 6Longest losing streak ..................... 4

Home attendance ...................9,830 (26 dates average = 378)Away attendance.................. 18,030 (29 dates average = 621)Total attendance ...................27,860 (55 dates average = 506)

MULTIPLE HIT GAMES 2 3 4 5+ Tot

2 Ross Heffl ey 20 6 1 - 27

20 Tyler White 13 7 2 - 22

12 Cody Jones 18 4 - - 22

3 Aaron Attaway 11 4 1 2 18

1 Bradley Strong 12 3 1 - 16

4 Julian Ridings 11 5 - - 16

11 Adam Martin 13 1 1 - 15

27 Jacob Hoyle 10 4 1 - 15

14 Dykota Spiess 3 2 - - 5

21 Bryant Noteboom 5 - - - 5

5 Luke Gragg 3 1 - - 4

36 Connor Andrus 1 1 - - 2

8 Dale Urquhart Jr. 1 1 - - 2

TEAM 121 39 7 2 169

## NAME HITTING STREAKS REACHED STREAKS Long Current Long Current

2 Ross Heffl ey 15 1 16 6

3 Aaron Attaway 14 1 14 1

1 Bradley Strong 9 5 10 5

11 Adam Martin 8 3 11 3

20 Tyler White 8 2 21 7

12 Cody Jones 8 - 8 -

27 Jacob Hoyle 6 1 14 3

4 Julian Ridings 6 1 6 1

21 Bryant Noteboom 5 1 5 1

8 Dale Urquhart Jr. 4 1 7 1

5 Luke Gragg 3 - 5 -

33 Austin Neary 2 2 2 2

36 Connor Andrus 2 - 3 -

9 Garrett Brown 1 - 1 1

MULTIPLE RBI GAMES 2 3 4 5+ Tot

2 Ross Heffl ey 11 - 1 - 12

27 Jacob Hoyle 5 4 - 1 10

11 Adam Martin 6 3 - - 9

20 Tyler White 6 - 2 - 8

3 Aaron Attaway 3 3 - 1 7

1 Bradley Strong 1 4 - - 5

14 Dykota Spiess 2 2 - 1 5

12 Cody Jones 3 1 - - 4

4 Julian Ridings 2 1 - - 3

8 Dale Urquhart Jr. 2 1 - - 3

5 Luke Gragg 3 - - - 3

21 Bryant Noteboom 2 - - - 2

36 Connor Andrus 1 1 - - 2

9 Garrett Brown 1 - - - 1

TEAM 48 20 3 3 74



PLAYERS OF THE WEEKFeb. 20 ................... Saxon Butler (SAM)Feb. 27 .........Thomas Trolestrup (UNCG)March 5 ...................... Will Owens (FUR)March 12 .................Ross Heffl ey (WCU)March 19 ................ Will Callaway (ASU)March 26 ...........Brandon Murray (CofC)April 2 ........................ Alex Swim (ELON)April 9 ...........................Paul Nitto (FUR)April 16 ............ Bradley Goodson (CofC)April 23 ...................... Tyler Tewell (ASU)April 30 ................. Daniel Aldrich (CofC) ............................... Saxon Butler (SAM)May 7 ........................Phillip Ervin (SAM)May 14 .................. Daniel Aldrich (CofC)May 21 .................... Saxon Butler (SAM)

PITCHERS OF THE WEEKFeb. 20 ........................... Eric Eck (WOF)Feb. 27 .................Ryan Arrowood (ASU)March 5 ......................Ryan West (CofC)March 12 .................. Josh Martin (SAM)March 19 ................. Dylan Clark (ELON)March 26 .................... Seth Grant (ASU)April 2 .........................Chris Beck (GSU)April 9 ..................Brandon Yarusi (WOF)April 16 ....................Henry Sisson (DAV)April 23 .................... Cash Collins (WOF)April 30 ...............Specer Medick (ELON)May 7 ...................... Stephen Gary (FUR)May 14 ................... Jordan Smith (WCU)May 21 ..................... Cash Collins (WOF)

COACHES ALL-SOCON TEAMPLAYER OF THE YEAR Marty Gantt, Sr., OF (CofC)PITCHER OF THE YEAR Christian Powell, Jr., RHP (CofC)FRESHMAN OF THE YEAR Chase Griffi n, Fr., C (GSU)COACH OF THE YEAR Chris Pollard (ASU)

FIRST TEAMSP ....... Christian Powell (CofC)SP .............. Josh Martin (SAM)RP ..PRESTON HATCHER (WCU)C ................. Alex Swim (ELON)1B ............ Saxon Butler (SAM)2B ......... ROSS HEFFLEY (WCU)SS .............Will Callaway (ASU)3B ...............Eric Phillips (GSU)OF...............Marty Gantt (CofC)OF...............Phillip Ervin (SAM)OF.......... Brandon Miller (SAM)DH ..........Daniel Kassouf (ASU)

SECOND TEAMSP ..........Ryan Arrowood (ASU)SP ......... Brandon Yarusi (WOF)RP ................... C.K. Irby (SAM)C ..................Brad Moss (SAM)1B .......... Ryan Kinsella (ELON)2B ........... Hector Crespo (ASU)SS ......Bradley Goodson (CofC)3B .. Thomas Troelstrup (UNCG)OF.................Tyler Tewell (ASU)OF................ Tyler Zupcic (ASU)OF........ Brandon Murray (CofC)DH ........... JACOB HOYLE (WCU)

MEDIA ALL-SOCON TEAMPLAYER OF THE YEAR Marty Gantt, Sr., OF (CofC)PITCHER OF THE YEAR Ryan Arrowood, Sr., RHP (ASU)FRESHMAN OF THE YEAR Chase Griffi n, Fr., C (GSU)COACH OF THE YEAR Chris Pollard (ASU)

FIRST TEAMSP ..........Ryan Arrowood (ASU)SP ....... Christian Powell (CofC)RP ..PRESTON HATCHER (WCU)C ................. Alex Swim (ELON)1B ............ Saxon Butler (SAM)2B ......... ROSS HEFFLEY (WCU)SS .............Will Callaway (ASU)3B ...............Eric Phillips (GSU)OF.................Tyler Tewell (ASU)OF...............Marty Gantt (CofC)OF.......... Brandon Miller (SAM)DH ..........Daniel Kassouf (ASU)

SECOND TEAMSP .............. Matt Pegler (CofC)SP .............. Josh Martin (SAM)RP ..............Kyle Owings (CofC)C ..................Brad Moss (SAM)1B .......... Ryan Kinsella (ELON)2B ........... Hector Crespo (ASU)SS ......Bradley Goodson (CofC)3B .............Rob Harding (CofC)OF................ Tyler Zupcic (ASU)OF...............Phillip Ervin (SAM)OF................. Mac Doyle (WOF)DH ................... C.K. Irby (SAM)

PLAYERS OF THE MONTHFebruary.................. Saxon Butler (SAM)March .................. Daniel Kassouf (ASU)April ......................... Marty Gantt (CofC)May ...................... Brandon Miller (SAM)

PITCHERS OF THE MONTHFebruary.................. Rob Marcello (ASU)March ......................... Seth Grant (ASU)April ......................Ryan Arrowood (ASU)May .......................... Josh Martin (SAM)

2012 ALL-CONFERENCE SELECTIONS

May 23 (Wednesday)#7 The Citadel 8, #2 College of Charleston 6 (11 inn.)

#6 Georgia Southern 19, #3 Elon 2#1 Appalachian State 7, #8 Furman 5#4 Samford 7, #5 Western Carolina 0

May 24 (Thursday)#3 Elon 14, #2 College of Charleston 12

#8 Furman 9, #5 Western Carolina 8#6 Gerogia Southern 8, #7 The Citadel 1#4 Samford 12, #1 Appalachian State 7

May 25 (Friday)#3 Elon 7, #7 The Citadel 3

#4 Samford 12, #8 Furman 2May 26 (Saturday)

#6 Georgia Southern 10, #3 Elon 7#4 Samford 12, #8 Furman 2

May 27 (Sunday)#4 Samford 9, #6 Georgia Southern 6 (10 inn.)

2012 ALL-TOURNAMENT TEAMSP - Justin Hess, GSU

SP - Josh Martin, SAM - MOPRP - C.K. Irby, SAM

C - Chase Griffi n, GSU1B - Ryan Kinsella, ELON

2B - Tyler Avera, GSU2B - Zeth Stone, SAM

SS - Austin Allison, SAM3B - Chris Ohmstede, FUROF - Taylor Johnson, FUR

OF - Phillip Ervin, FUROF - Brandon Miller, SAMDH - Garren Palmer, GSU

2012 SOUTHERN CONFERENCE TOURNAMENT RESULTSJoseph P. Riley, Jr. Park, Charleston, S.C.





W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – T E A M Y E A R - B Y - Y E A R H I T T I N G S TAT I S T I C S S I N C E 1 9 6 9

W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – T E A M Y E A R - B Y - Y E A R P I T C H I N G S TAT I S T I C S S I N C E 1 9 6 9

YEAR G W-L SV IP H R ER ERA BB K CG SH

1969 25 11-14 - 67.3 56 26 17 2.27 10 14 - -1970 21 9-12 - 182.0 173 106 74 3.66 92 17 - -1971 31 20-11 5 264.1 168 99 57 1.93 137 320 13 1972 30 15-15 5 259.0 224 116 71 2.46 104 223 - 21973 20 11-9 4 176.2 136 100 60 3.05 100 157 - -1974 25 11-14 3 215.0 197 138 86 3.87 144 177 8 21975 24 15-8 4 198.2 170 108 71 3.21 104 166 8 -1976 31 16-15 3 266.0 231 162 90 3.04 167 212 11 -1977 32 27-5 2 257.0 257 162 128 4.48 181 171 9 -1978 34 20-13 2 266.0 252 195 144 4.87 163 195 19 -1979 28 13-15 1 212.0 223 187 132 5.60 154 135 12 21980 37 22-15 9 298.1 320 228 174 5.25 178 192 9 01981 39 25-14 11 284.2 298 230 153 4.84 203 174 9 21982 40 28-12 10 313.0 332 232 157 4.51 196 186 11 31983 45 25-20 4 347.1 481 360 248 6.43 194 175 13 11984 57 37-20 6 437.0 445 291 213 4.38 231 248 26 21985 72 37-35 9 565.0 646 471 364 5.80 365 382 21 31986 61 33-28 9 473.2 610 460 330 6.27 282 292 14 21987 56 36-20 11 449.2 517 337 244 4.88 239 266 11 01988 62 38-24 11 474.0 571 353 262 4.97 254 291 14 21989 54 23-31 8 429.2 531 390 328 6.87 256 278 10 21990 62 37-25 12 484.2 564 378 260 4.83 251 339 11 3

YEAR G W-L SV IP H R ER ERA BB K CG SH

1991 62 36-26 5 498.2 555 368 278 5.02 228 375 15 51992 66 44-21 12 551.2 598 355 251 4.09 231 446 18 41993 62 34-28 9 509.1 573 388 298 5.27 253 396 10 11994 63 45-18 14 535.2 491 233 177 2.97 244 466 9 41995 56 32-24 7 486.0 553 338 257 4.76 218 408 12 41996 57 32-24 8 482.2 542 380 282 5.26 257 416 11 21997 62 42-20 8 527.0 617 429 377 6.44 284 480 9 11998 60 45-15 15 513.1 522 301 229 4.01 236 499 8 11999 60 36-23 10 511.1 633 406 324 5.70 243 388 9 12000 53 15-38 4 451.2 620 432 338 6.74 212 285 3 02001 56 30-26 11 481.0 621 408 324 6.06 182 325 2 12002 56 33-23 15 482.1 552 318 246 4.59 156 372 2 52003 64 49-21 14 566.1 597 309 237 3.77 177 405 5 62004 59 28-31 9 517.0 679 395 337 5.87 163 374 3 12005 56 33-23 17 491.1 627 380 324 5.93 170 359 3 02006 60 33-27 12 528.0 661 392 323 5.51 184 434 0 32007 62 42-20 15 550.1 653 346 293 4.79 230 425 2 32008 57 29-28 8 504.2 585 428 355 6.33 229 432 1 12009 57 35-22 12 518.0 581 414 325 5.65 241 487 2 32010 59 37-21 12 523.1 570 380 301 5.18 267 451 3 22011 55 23-31 4 501.0 571 380 322 5.78 295 448 2 52012 56 32-24 13 495.0 507 288 231 4.20 237 399 1 3

YEAR G AB R H 2B 3B HR RBI BB SO SB .AVG

1969 25 810 109 183 32 7 6 86 108 196 20 .2271970 21 736 127 186 32 10 11 106 98 141 17 .2521971 31 1079 167 291 55 14 18 149 108 289 74 .2701972 30 985 156 253 44 11 12 139 123 180 58 .2561973 20 668 88 167 25 3 5 75 n/a n/a n/a .2501974 25 836 112 194 36 2 8 95 117 171 31 .2321975 24 798 157 241 39 13 11 132 119 142 56 .3021976 31 1047 190 286 46 12 12 173 159 149 38 .2731977 32 1039 293 35 66 12 37 277 181 114 60 .3221978 34 1083 304 356 70 22 36 283 218 155 77 .3291979 28 828 155 242 39 20 12 147 146 99 47 .2921980 37 1254 251 406 80 18 19 241 166 149 74 .3241981 39 1153 282 346 56 6 46 248 189 151 45 .3001982 40 1268 337 409 77 15 58 309 214 147 52 .3231983 45 1360 329 397 68 12 37 292 273 194 57 .2921984 57 1740 358 515 77 17 44 319 276 22 58 .2961985 72 2360 498 728 123 19 56 434 325 308 75 .3081986 61 2042 497 696 119 16 72 449 280 240 34 .3411987 56 1815 424 567 112 9 73 372 279 267 48 .3121988 62 2082 481 674 119 15 116 448 258 319 65 .3241989 54 1709 311 446 78 8 70 281 264 248 20 .2611990 62 1956 465 615 135 20 65 415 298 312 67 .314

YEAR G AB R H 2B 3B HR RBI BB SO SB .AVG

1991 62 2070 519 684 461 132 12 67 283 319 87 .3301992 66 2246 507 719 125 11 87 449 268 437 84 .3201993 62 2121 452 658 104 13 67 395 190 350 82 .3101994 63 2094 394 617 114 18 45 314 200 403 104 .2951995 56 1910 363 559 105 13 42 325 244 393 94 .2931996 57 1972 403 613 111 13 52 348 202 362 73 .3111997 62 2256 560 792 142 21 100 491 238 360 102 .3511998 60 2083 485 639 122 17 55 428 280 433 153 .3071999 60 2087 502 684 122 20 82 445 255 391 123 .3282000 53 1829 330 522 101 10 23 287 198 337 40 .2852001 56 2012 425 626 143 7 56 378 224 336 45 .3112002 56 2007 429 671 130 10 56 391 223 304 32 .3342003 64 2265 477 694 148 14 58 421 274 389 96 .3062004 59 2082 396 606 137 11 66 360 220 389 45 .2912005 56 1934 375 566 105 14 44 340 228 363 25 .2932006 60 2115 419 641 113 11 65 375 243 394 67 .3032007 62 2242 520 725 148 12 87 471 266 370 69 .3232008 57 2038 462 631 135 10 76 409 279 400 105 .3102009 57 2133 482 708 142 15 67 442 227 451 126 .3322010 59 2127 433 657 120 11 74 397 216 436 114 .3092011 55 2002 377 604 118 10 38 337 241 395 90 .3022012 56 1998 353 620 109 7 39 319 209 342 74 .310



SEASON FIELDING RECORDSChances ...........................606 .........Todd Buchanan ............................. 2003Percentage ....................1.000 .........Kevin Bellomo ............................... 1990

(0 errors in 136 chances)Putouts .............................575 ........ Todd Buchanan ............................. 2003Assists ..............................205 ........ Chris Moore ....................................1997

CAREER FIELDING RECORDSChances ...........................606 .........Todd Buchanan ............................. 2003Chances ........................1,789 .........Todd Buchanan ........................2000-03Pct. (min 500 chances) ... .992 .........Todd Buchanan ........................2000-03

(15 errors in 1789 chances) Putouts ..........................1,691 .........Todd Buchanan ........................2000-03Assists ..............................667 .........Todd Roper ..............................2000-03

W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K

INDIVIDUAL GAME RECORDS – BATTINGCATEGORY RECORD PLAYER OPPONENT, YEARHits ........................................... 7 Mitchell Hatley ..........Eastern Kentucky, 2009 ................................................. 6 Tyler White ........................Elon (SoCon), 2011 ................................................. 6 Danny Sells ............................. Guilford, 1961 ................................................. 6 Bob Ballance ..................North Georgia, 1960Doubles .................................... 5 Aaron Attaway ...............................Iona, 2012Triples ....................................... 2 Achieved 13 timesHome Runs ............................... 4 Skip Nelloms .................. UNC Asheville, 1986RBI ........................................... 9 Donovan Minero .....................N.C. A&T, 2001Total Bases ............................. 17 Skip Nelloms .................. UNC Asheville, 1985

INDIVIDUAL GAME RECORDS – PITCHINGCATEGORY RECORD PLAYER OPPONENT, YEARStrikeouts ...............................20 Wayne McCauley ..........................Allen, 1971Innings Pitched .................... 11.2 Don Bright ......................................VMI, 1971No Hitters.................................... Greg Moore .................Appalachian St., 1983 ................................................... Jeff Mashburn ..............Appalachian St., 1982 ................................................... Rick Adair ........................... The Citadel, 1979 ................................................... Jerry Reed....................West Virginia St., 1976

TEAM GAME RECORDSCATEGORY RECORD OPPONENT, YEARHits .........................................30 .................................Eastern Kentucky, 2009 ...............................................30 ................................................Furman, 1993Hits in an Inning ...................* 12 ......................................................VMI, 1991Runs .......................................32 .............................................. Hartford, 2008Runs in an Inning.....................13 ...................................................... VMI,1991 ...............................................13 ..................................................... VMI, 1999Home Runs .......................... * 10 ...................................... UNC Asheville, 1986Stolen Bases ...........................12 ..............................................Catawba, 1965Strikeouts Pitching ..................20 ........................................Elon (SoCon), 2011 ................................................... ....................................................Allen, 1971Largest Win Margin .................28 ....................................................Allen, 1971Win Margin in a Shutout ............23 ....................................................Allen, 1971

INDIVIDUAL CAREER RECORDS– BATTING –

Games * 242 Matt Raleigh 1989-92Average .402 Keith Ebersole 1977-78At-Bats 875 Todd Roper 2001-04Runs * 251 Matt Raleigh 1989-92Hits 354 Ross Heffl ey 2009-12 336 Barrett Shaft 2005-08Doubles 70 Rod Goldston 2000-03Triples 15 Martin Barrow 1995-98Home Runs * 68 Matt Raleigh 1989-92RBI 254 Chris Moore 1996-99Total Bases 580 Matt Raleigh 1989-92Slugging Percentage .693 Matt Raleigh 1989-92Stolen Bases 84 Wayne Tolleson 1975-78Times Walked 182 Matt Raleigh 1989-92Grand Slams * 5 Todd Buchanan 2000-03

– PITCHING –Wins 34 Mark DiFelice (t-2nd SoCon History) 1995-98W-L Pct. .788 Scott Gay (26-7) 1983-85ERA 1.27 Don Bright 1971-73Saves 22 Ryan Foster 2000-03Appearances 121 Ryan Foster 2000-03Complete Games 22 Rod Rogers 1962-66Shutouts 6 Rick Adair 1977-79 6 Don Bright 1971-73Innings Pitched 363.2 Clark Maxwell 1994-97Strikeouts 374 Clark Maxwell 1994-97

* - Southern Conference Record (through the 2012 season)

INDIVIDUAL SEASON RECORDS– BATTING –

Games * 70 David Hyatt 1985Average .441 Bob Ballance 1960At-Bats 266 Rodney Hennon 1993Runs Scored 83 Eric Johnson 1999Hits 102 Brent Greer 2009 101 Kevin Bellomo 1991 101 Keith LeClair 1988Singles 75 Barrett Shaft 2007 75 Rodney Hennon 1993Doubles 26 Rod Goldston 2003Triples 7 Tracy Biggs 1999Home Runs 26 Steve Harris (t-3rd SoCon History) 1999 25 Matt Raleigh 1992 25 Clint Fairey 1988Grand Slams * 3 Todd Buchanan 2002RBI 84 Kenny Smith 2007 84 Chris Moore 1999Total Bases 189 Kenny Smith 2007Slugging Percentage .776 Matt Raleigh 1991Times Walked 62 Chris Moore 1998Stolen Bases 46 Eric Johnson 1999Sacrifi ce Hits 11 Todd Roper 2003Hitting Streak # 27 Scott Lyman 1993

# - streak began in the 1992 season and carried over the the 1993 season

– PITCHING –Wins 12 Jason Beverlin 1993 12 Scott Gay 1985W-L Pct. 1.000 Scott Gay (10-0) 1984 1.000 Jerry Reed (10-0) 1977ERA 0.85 Dan Kyslinger 1992Saves 14 Mike Manning 1994Appearances 40 Mike Manning 1994Complete Games 12 Harris Pryor 1959Shutouts 3 Rick Adair 1978 3 Don Bright 1973 3 Wayne McCauley 1971Innings Pitched 125.0 Ryan Basner 2003Strikeouts 154 Jason Beverlin 1994

* - Southern Conference Record (through the 2012 season)



KENNYKENNYSMITH, SMITH, 20072007ROSSROSSHEFFLEY, HEFFLEY, 20112011

STEVENSTEVENSTRAUSBAUGH, STRAUSBAUGH, 20032003JAREDJAREDGREENWOOD, GREENWOOD, 20042004

DONOVANDONOVANMINERO, MINERO, 20022002ALEXALEXTOLBERT, TOLBERT, 19961996

WCU TEAM TRIPLE CROWN WINNERSWCU TEAM TRIPLE CROWN WINNERSYEAR PLAYER B AVG. RBI HR1961 Jim Ray .322 22 41962 Ken Morgan .372 21 51967 Roddy Edwards .353 20 41977 Keith Ebersole .423 48 61981 Mel Kinsey .400 50 151985 Mike Carson .363 56 131990 Grant Brittain .428 68 201994 Mike Tidick .376 58 151996 Alex Tolbert .424 66 112002 Donovan Minero .374 62 152004 Jared Greenwood .338 63 212005 Steven Strausbaugh .367 51 122007 Kenny Smith .390 84 202011 Ross Heffl ey .419 65 11

W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – S E A S O N R E C O R D S

SEASON BATTING AVERAGE NAME YEAR H-AB AVG. 1. Bob Balance 1960 N/A .441 2. Kevin Bellomo 1991 101-232 .435 3. Jim Matthews 1957 N/A .431 4. Grant Brittain 1990 77-180 .428 5. Clint Fairey 1986 65-153 .425 6. Alex Tolbert 1996 92-217 .424 7. Keith LeClair 1988 58-209 .423 Keith Ebersole 1977 47-111 .423 9. Brent Greer 2009 102-243 .420 10. Ross Heffl ey 2011 96-229 .419 11. Matt Raleigh 1991 92-223 .413 12. Fred Liner 1955 N/A .409 13. Freddie Hailey 1986 58-209 .407 14. Charles Thomas 1999 99-244 .406 15. Clint Fairey 1987 77-190 .405 Greg Johnson 1983 64-158 .405 17. Jerry Gaines 1975 38-94 .404 18. Jeremy Bruce 1997 99-247 .401 Jody Henson 1995 81-202 .401 20. Mel Kinsey 1981 48-120 .400 Dwight Sherrill 1956 N/A .400

GAMES PLAYED IN A SEASON NAME YEAR NO. 1. David Hyatt 1985 70 2. John Pust 1985 69 3. Matt Raleigh 1992 66 Rodney Hennon 1992 66 Joey Cox 1992 66 Mike Carson 1985 66 7. Brian Tebo 1985 65 Freddie Hailey 1985 65 9. Alan Beck 2003 64 Mike Tidick 1992 64 11. Rod Goldston 2003 63 Wayne Kilmer 2003 63 Mike Tidick 1994 63 Roy Hurst 1994 63 Marc Striker 1994 63 Stephen Pritchard 1994 63 Scott Lyman 1992 63 18. Kenny Smith 2007 62 Jonathan Greene 2007 62 Steven Strausbaugh 2007 62 Todd Buchanan 2003 62 Chris Moore 1997 62 Alex Tolbert 1997 62 Rodney Hennon 1993 62 Matt Raleigh 1991 62 Keith LeClair 1988 62

GAMES STARTED IN A SEASON NAME YEAR NO. 1. Matt Raleigh 1992 66 Rodney Hennon 1992 66 Joey Cox 1992 66 4. Alan Beck 2003 64 Mike Tidwick 1992 64 5. Rod Goldston 2003 63 Wayne Kilmer 2003 63 Mike Tidick 1994 63 Roy Hurst 1994 63 Stephen Pritchard 1994 63 10. Kenny Smith 2007 62 Jonathan Greene 2007 62 Marc Striker 1994 62 Chris Moore 1997 62 Alex Tolbert 1997 62 Rodney Hennon 1993 62 Matt Raleigh 1991 62 17. Blake Murphy 2007 61 John Ingram 2007 61 Steven Strausbaugh 2007 61 Todd Buchanan 2003 61 Todd Roper 2003 61

AT BATS IN A SEASON NAME YEAR NO. 1. Nick Liles 2008 269 2. Rodney Hennon 1993 266 3. Nick Liles 2009 259 4. Wayne Kilmer 2003 258 Eric Johnson 1999 258 6. Chris Moore 1997 257 7. Martin Barrow 1997 256 8. Barrett Shaft 2007 255 9. Martin Barrow 1998 254 10. Todd Roper 2003 253 11. Joey Cox 1992 252

MIKEMIKETIDICK, TIDICK, 19941994

GRANTGRANTBRITTAIN, BRITTAIN, 19901990

12. Rodney Hennon 1992 251 13. David Hyatt 1985 250 14. Kenny Smith 2007 249 Todd Roper 2004 249 Alan Beck 2003 249 17. Rod Goldston 2003 247 Jeremy Bruce 1997 247 19. Roy Hurst 1994 246 20. Tim Hallam 2006 245 21. Barrett Shaft 2006 244 Charles Thomas 1999 244 23. Todd Buchanan 2003 243

RUNS SCORED IN A SEASON NAME YEAR NO. 1. Eric Johnson 1999 83 2. Jeremy Bruce 1997 82 3. Kevin Bellomo 1991 77 Matt Raleigh 1992 77 5. Charles Thomas 1999 76 6. Blake Murphy 2007 73 Rodney Hennon 1992 73 8. Kenny Smith 2007 72 Chris Moore 1999 72 Martin Barrow 1998 72 11. Martin Barrow 1997 71 Alex Tolbert 1997 71 13. Chris Moore 1997 69 14. Barrett Shaft 2006 68 Matt Raleigh 1991 68 Alan Beck 2003 68 17. Grant Brittain 1990 67 Freddie Hailey 1986 67 Freddie Hailey 1987 67 20. Nick Liles 2009 66 Scott Lyman 1992 66 Keith LeClair 1987 66

HITS IN A SEASON NAME YEAR NO. 1. Brent Greer 2009 102 2. Kevin Bellomo 1991 101 Keith LeClair 1988 101 4. Eric Johnson 1999 100 5. Charles Thomas 1999 99 Jeremy Bruce 1997 99 7. Martin Barrow 1997 98 8. Kenny Smith 2007 97 9. Ross Heffl ey 2011 96 Barrett Shaft 2007 96 11. Nick Liles 2009 95 Chris Moore 1997 95 13. Nick Liles 2008 93 14. Ross Heffl ey 2009 92 Alex Tolbert 1996 92 Matt Raleigh 1991 92 Rodney Hennon 1992 92 18. Scott Lyman 1992 91 19. Roy Hurst 1994 89 20. Chris Moore 1999 88 Matt Raleigh 1992 88 22. David Hyatt 1985 87 Joey Cox 1992 87 Rodney Hennon 1993 87

DOUBLES IN A SEASON NAME YEAR NO. 1. Rod Goldston 2003 26 2. Alex Tolbert 1996 25 3. Kenny Smith 2007 24 4. Brent Greer 2009 22 Nick Liles 2009 22 6. Jared Greenwood 2004 21 Jody Henson 1995 21 Joey Cox 1992 21 Freddie Hailey 1987 21 10. Blake Murphy 2007 20 Denver Edick 2004 20 Rod Goldston 2001 20 Alan Beck 2001 20 Roy Hurst 1994 20 Rodney Tesh 1990 20 Mike Carson 1985 20 17. Matt Johns 2010 19 Nick Liles 2008 19 Todd Buchanan 2003 19 Donovan Minero 2002 19 Austin Smithwick 1999 19 Frankie Ward 1997 19 Chris Moore 1996 19 Mike Tidick 1993 19 Scott Lyman 1992 19



NIC

KN

ICK

LILE

SLI

LES


MOST TRIPLES IN A SEASON NAME YEAR NO. 1. Tracy Biggs 1999 7 2. Martin Barrow 1997 6 Freddie Hailey 1984 6 4. Austin Smithwick 1999 5 Martin Barrow 1998 5 Chris Moore 1997 5 Matt Raleigh 1991 5 Jim Eldredge 1985 5 David Ball 1979 5 10. Kenny Smith 2007 4 Blake Murphy 2006 4 Todd Roper 2003 4 John Connolly 1994 4 Marc Striker 1994 4 Mike Tidick 1992 4 Todd Raleigh 1990 4 Keith LeClair 1988 4 Ron Hunington 1986 4 John Pust 1985 4 Willie Carpenter 1979 4 Freddy Brown 1979 4 Mark Reeser 1978 4 Wayne Tolleson 1978 4 Jerry Gaines 1975 4

HOME RUNS IN A SEASON NAME YEAR NO. 1. Steve Harris 1999 26 2. Matt Raleigh 1992 25 Clint Fairey 1988 25 4. Skip Nelloms 1988 22 5. Jared Greenwood 2004 21 Chris Moore 1999 21 7. Kenny Smith 2007 20 Alex Tolbert 1995 20 Grant Brittain 1990 20 10. Alex Tolbert 1997 19 Joey Cox 1992 19 Matt Raleigh 1991 19 Tom Malchesky 1988 19 Clint Fairey 1987 19 15. Alan Beck 2003 18 Keith LeClair 1988 18 17. Steven Strausbaugh 2006 17 Donovan Minero 2001 17 Phillip Grundy 1993 17 Todd Raleigh 1991 17

SEASON RUNS BATTED IN NAME YEAR NO. 1. Kenny Smith 2007 84 Chris Moore 1999 84 3. Todd Raleigh 1991 78 4. Donovan Minero 2001 74 5. Steve Harris 1999 73 Matt Raleigh 1992 73 7. Joey Cox 1992 72 Mike Carson 1986 72 9. Alan Beck 2003 71 10. Skip Nelloms 1987 70 11. Alex Tolbert 1997 69 J.P. Burwell 1997 69 Skip Nelloms 1988 69 14. Grant Brittain 1990 68 15. Matt Raleigh 1991 67 Keith LeClair 1988 67 17. Blake Murphy 2007 66 Chris Moore 1998 66 Alex Tolbert 1996 66 Phillip Grundy 1993 66

TOTAL BASES IN A SEASON NAME YEAR NO. 1. Kenny Smith 2007 189 2. Keith LeClair 1988 179 3. Matt Raleigh 1992 177 4. Matt Raleigh 1991 173 5. Chris Moore 1999 169 6. Joey Cox 1992 167 7. Skip Nelloms 1988 163 8. Steve Harris 1999 162 9. Jared Greenwood 2004 160 10. Eric Johnson 1999 158 11. Jeremy Bruce 1997 157 12. Kevin Bellomo 1991 156 13. Grant Brittain 1990 155 14. Mike Tidick 1994 154 Tom Malechesky 1988 154 16. Brent Greer 2009 152

Chris Moore 1997 152 Alex Tolbert 1996 152 19. Ross Heffl ey 2011 151 Blake Murphy 2007 151 Clint Fairey 1987 151

SLUGGING PERCENTAGE NAME YEAR TB-AB PCT. 1. Mel Kinsey 1981 104-120 .867 2. Grant Brittain 1990 155-180 .861 3. Clint Fairey 1987 151-190 .795 4. Pat Riley 1986 107-137 .781 5. Matt Raleigh 1991 173-223 .776 6. Matt Raleigh 1992 177-229 .773 7. Kenny Smith 2007 189-249 .759 8. Keith LeClair 1988 179-239 .749 9. Chris Moore 1999 169-227 .711 10. Clint Fairey 1988 125-207 .734 11. Jared Greenwood 2004 160-219 .731 12. Steve Harris 1999 162-224 .723 13. Skip Nelloms 1988 163-228 .715 14. Alan Beck 2001 128-179 .715 15. Alex Tolbert 1996 152-217 .700

BASE ON BALLS IN A SEASON NAME YEAR NO. 1. Chris Moore 1998 62 2. Alex Tolbert 1997 59 Matt Raleigh 1992 59 4. Mel Kinsey 1983 55 5. Jared Greenwood 2004 54 6. Blake Murphy 2007 52 7. Blake Murphy 2008 51 8. John Pust 1985 50 9. Grant Brittain 1990 49 10. Alan Beck 2003 47 11. Mike Carson 1985 46 12. Grant Brittain 1989 44 13. Charles Thomas 1999 43 Matt Raleigh 1989 43 Freddie Hailey 1987 43 Freddie Hailey 1986 43 17. David Hyatt 1985 42 18. Alan Beck 2001 41 Chris Moore 1999 41 Matt Raleigh 1990 41 Clint Fairey 1987 41

HIT BY PITCHES IN A SEASON NAME YEAR NO. 1. Cameron Dullnig 2010 25 2. Jonathan Greene 2007 22 3. Tim Hallam 2006 19 4. Chris Davis 2004 18 5. Tim Hallam 2005 17 6. Mitchell Hatley 2009 16 7. Cameron Dullnig 2011 15 Tyler White 2011 15 Ollie Goulder 2010 15 Barrett Shaft 2008 15 Scott Lyman 1993 15 12. Blake Murphy 2008 14 Barrett Shaft 2007 14 14. Austin Schultz 2010 13 Trevor Collias 2009 13 Jason Haynes 2006 13 17. Jared Greenwood 2004 12 Charlie Wands 1999 12 Steve Harris 1999 12 18. Matt Johns 2010 11 SIX OTHERS TIED 11

STRIKE OUTS IN A SEASON NAME YEAR NO. 1. Alex Tolbert 1995 73 2. Matt Raleigh 1992 66 Joey Cox 1992 66 4. Trevor Collias 2010 58 Blake Murphy 2006 58 6. Matt Johns 2010 56 Steve Harris 1999 56 Mike Tidick 1994 56 9. Trevor Collias 2009 55 Dave McKay 1998 55 11. J.C. Lyons 2009 52 Nate Hall 2005 52 Alan Beck 2003 52 Todd Buchanan 2003 52 Tony Horne 1996 52 16. Jonathan Greene 2007 51 Alex Tolbert 1997 51

18. Dylan de Graaf 2010 50 Tyler Kirkpatrick 2010 50 20. Brandon Zollman 2004 49 Matt Raleigh 1990 49

ON BASE PCT. IN A SEASON NAME YEAR NO. 1. Blake Murphy 2008 .531 2. Alan Beck 2001 .515 3. Chris Moore 1995 .512 4. Kevin Bellomo 1991 .509 5. Matt Raleigh 1992 .507 6. Mitchell Hatley 2009 .506 7. Matt Raleigh 1991 .502 8. Charles Thomas 1999 .500 9. Alex Tolbert 1996 .498 10. Blake Murphy 2007 .495 11. Chris Moore 1999 .488 12. Ross Heffl ey 2011 .483 13. Rob Doherty 1991 .482 14. Alex Tolbert 1997 .479 15. Brent Greer 2009 .476 16. Ross Heffl ey 2009 .467 Rodney Hennon 1992 .467 18. Mike Tidick 1994 .463 19. Barrett Shaft 2008 .462 Jared Greenwood 2005 .462 Jeremy Bruce 1997 .462 22. Jody Henson 1995 .461 23. Scott Lyman 1993 .460 24. Joey Cox 1991 .459 Rodney Tesh 1991 .459

SACRIFICE FLIES IN A SEASON NAME YEAR NO. 1. Stephen Notaro 2011 8 2. Barrett Shaft 2006 7 Chris Moore 1999 7 J.P. Burwell 1997 7 Marc Striker 1994 7 Jody Henson 1993 7 7. Jacoby Hoyle 2012 6 Steven Strausbaugh 2007 6 Blake Murphy 2006 6 Jared Greenwood 2004 6 Frankie Ward 1998 6 Alex Tolbert 1997 6 13. Dykota Spiess 2012 5 Ross Heffl ey 2011 5 Aaron Attaway 2011 5 Trevor Collias 2009 5 Kenny Smith 2007 5 Jonathan Greene 2006 5 NINE OTHERS TIED 5

SACRIFICE HITS IN A SEASON NAME YEAR NO. 1. Barrett Shaft 2008 11 Todd Roper 2003 11 Morgan Frazier 1999 11 4. Julian Ridings 2012 10 Stephen Notaro 2011 10 David Hyatt 1985 10 7. Aaron Attaway 2011 9 Cameron Dullnig 2010 9 Matt Thrasher 1981 9 10. Dylan de Graaf 2010 8 Chad Moore 1996 8 Chad Moore 1995 8 Grant Brittain 1990 8 Clint Fairey 1988 8 Mike Carson 1986 8 Jim Eldredge 1985 8 Darryl Rogers 1985 8 Wayne Tolleson 1976 8

STOLEN BASES IN A SEASON Name Year No. 1. Eric Johnson 1999 46 2. Chuck Koone 1998 35 3. Dylan de Graaf 2010 30 Trevor Collias 2009 30 Martin Barrow 1998 30 6. Wayne Tolleson 1978 29 Wayne Tolleson 1977 29 8. Dave McKay 1998 28 9. J.C. Lyons 2009 27 10. Matt Johns 2011 26 Wayne Kilmer 2003 26 12. Jody Henson 1995 25 13. Nick Liles 2009 24 14. Matt Johns 2010 23 Matt Raleigh 1992 23 16. Nick Liles 2008 22 Blake Murphy 2008 22 Chuck Koone 1997 22 19. Mike Tidick 1992 21 David Hill 1982 21

STEVE HARRIS set a Western Carolina record with 26 home runs during the

1999 season – a mark which continues to stand tied for second in

Southern Conference history entering the 2011 season.

BRENT GREER set a Western Carolina single-season record with 102 base hits during the 2009 season for the Catamounts. He was drafted in the 14thround of the 2009 MLB First-Year Player Draft by the Arizona Diamondbacks.

Two-sport standout ERIC JOHNSONset a school-record for runs scored

in a single-season with 83 runsduring the 1999 season.



WAR

DW

ARD

WIT

HR

OW

WIT

HR

OW


STOLEN BASES ATTEMPTED NAME YEAR NO. 1. Eric Johnson 1999 54 2. Chuck Koone 1998 39 3. Trevor Collias 2009 35 Wayne Tolleson 1977 35 5. Dave McKay 1998 34 Wayne Tolleson 1978 34 7. Dylan de Graaf 2010 32 8. Matt Johns 2010 31 J.C. Lyons 2009 31 Wayne Kilmer 2003 31 Martin Barrow 1998 31 12. Nick Liles 2009 30 Jody Henson 1995 30 14. Blake Murphy 2008 28 15. Billy Boyd 1980 27 16. Matt Johns 2011 26 17. Chuck Koone 1997 25 Matt Raleigh 1992 25 David Hill 1983 25

PUTOUTS IN A SEASON NAME YEAR NO. 1. Todd Buchanan 2003 575 2. John Ingram 2007 550 3. Trey McDaniel 2006 543 4. Jared Greenwood 2004 529 5. Marc Striker 1994 525 6. Todd Buchanan 2001 524 7. Tyler White 2010 515 8. Alex Tolbert 1997 508 9. Alex Tolbert 1996 493 10. David Hyatt 1985 486 11. Trey McDaniel 2005 483 12. Todd Buchanan 2002 478 13. David Hyatt 1986 467 14. Alex Tolbert 1995 458 15. Clint Fairey 1988 456 16. Mark Poarch 1990 455 17. Dave McKay 1998 454 18. Charlie Fonville 1984 429 19. Tyler White 2011 421 20. Tyler White 2012 414

ASSISTS IN A SEASON NAME YEAR NO. 1. Chris Moore 1997 205 2. John Pust 1985 202 3. Todd Roper 2003 200 4. Tim Hallam 2006 191 5. Austin Schultz 2010 187 6. Todd Roper 2004 183 7. Wayne Kilmer 2003 182 Rodney Hennon 1993 182 9. Chris Moore 1999 177 10. Matt Raleigh 1992 176 11. Kenny Smith 2007 174 Grant Brittain 1988 174 13. Tim Hallam 2005 171 Stephen Ruchardson 1994 171 15. John Connolly 1994 170

SEASON FIELDING PCT. – MIN 100 CHANCES NAME YEAR PO-A-E PCT. 1. J.C. Lyons 2009 110-3-0 1.000 Mike Tidick 1994 96-5-0 1.000 Marc Striker 1991 86-86-0 1.000 Kevin Bellomo 1990 132-4-0 1.000 5. Keith Ebersole 1978 272-13-1 .997 6. Tyler White 2011 421-28-2 .996 Todd Buchanan 2001 524-28-2 .996 Marc Striker 1994 525-23-2 .996 David Hyatt 1985 486-44-2 .996 Ted Whitworth 1972 245-20-1 .996 Gary Fishel 1972 283-8-1 .996 12. Richie Senn 1989 150-19-1 .994 Matt Ingle 1981 292-19-2 .994 14. Barrett Shaft 2007 128-6-1 .993 Barrett Shaft 2005 125-10-1 .993 J.P. Burwell 1997 245-22-2 .993 17. Trey McDaniel 2005 483-25-4 .992 Todd Buchanan 2003 575-26-5 .992 Todd Buchanan 2002 478-22-4 .992 Austin Smithwick 1998 224-27-2 .992 21. Adam Martin 2012 302-44-3 .991 Brian Sigmon 2003 209-18-2 .991 Mike Tidick 1993 105-5-1 .991 24. Cameron Dullnig 2011 92-8-1 .990 John Ingram 2007 550-32-6 .990 Marc Striker 1992 357-24-4 .990 Clint Fairey 1988 456-39-5 .990 Keith LeClair 1987 374-30-4 .990 Dennis Blake 1976 44-51-1 .990

LOWEST ERA IN A SEASON NAME YEAR NO. 1. Dan Kyslinger 1992 0.85 2. Mike Manning 1994 0.97 3. Don Bright 1972 1.09 4. Ward Withrow 1987 1.32 5. Flip Watson 1976 1.47 Don Bright 1973 1.47 7. Rick Adair 1979 1.59 8. Aaron Kirby 1998 1.63 9. David Robinson 1981 1.70 10. Preston Hatcher 2012 1.73 11. David Robinson 1982 1.77 12. Rick Adair 1977 1.87 13. Jerry Reed 1975 2.01 14. Jerry Reed 1976 2.02 15. Vance Chavis 2012 2.08 16. Scott Gay 1984 2.10 17. Chris Waters 1998 2.11

WINS IN A SEASON NAME YEAR NO. 1. Jason Beverlin 1993 12 Scott Gay 1985 12 3. Mark DiFelice 1998 11 Jason Beverlin 1994 11 Phillip Grundy 1991 11 Jack Kimel 1990 11 7. Derrick Hawk 2003 10 Mark DiFelice 1997 10 Jack Kimel 1992 10 Keith Smith 1986 10 Scott Gay 1984 10 Jerry Reed 1977 10 13. Brandon Johnson 2010 9 Matt Benedict 2010 9 Drew Saberhagen 2007 9 Aaron Kirby 1999 9 Clark Maxwell 1997 9 Phillip Grundy 1992 9 Jack Kimel 1991 9 Tim Sinicki 1988 9 Andy Rickman 1986 9 22. Chris Masters 2008 8 Tyler Sexton 2007 8 Tyler Sexton 2006 8 Ryan Basner 2003 8 Clark Maxwell 1995 8 David Pember 1999 8 Brian Bain 1998 8 Chris Davidson 1998 8 Paul Menhart 1988 8

LOSSES IN A SEASON NAME YEAR NO. 1. Ryan Basner 2001 8 Paul Menhart 1989 8 Stewart Keyes 1989 8 4. Jordan Smith 2011 7 Drew Saberhagen 2008 7 Phillip Grundy 1993 7 7. Mike Tavernier 2009 6 Tyler Sexton 2006 6 Seth Foster 2003 6 Jared Burton 2002 6 Aaron Kirby 2000 6 Mark DiFlelice 1996 6 Clark Maxwell 1995 6 Dale Pilgrim 1995 6 Joe Jack Sellers 1995 6 Paul Menhart 1990 6 Gary Shamp 1986 6 Ken Hare 1984 6 Randy Sims 1979 6

WINNING PCT. IN A SEASONMin 10 decisions

NAME YEAR W-L PCT. 1. Scott Gay 1984 10-0 1.000 Jerry Reed 1977 10-0 1.000 3. Drew Saberhagen 2007 9-1 .900 4. Jason Beverlin 1993 12-2 .857 5. Mark DiFelice 1998 11-2 .846 6. Derrick Hawk 2003 10-2 .833 7. Clark Maxwell 1997 9-2 .818 Andy Rickman 1986 9-2 .818 9. Mark DiFelice 1997 10-3 .769 Jack Kimel 1992 10-3 .769

APPEARANCES IN A SEASON NAME YEAR NO. 1. Mike Manning 1994 40 2. Luke Miller 2005 37 Ryan Foster 2001 37 4. Andrew Chilcoat 2011 34 Andrew Chilcoat 2010 34 6. Brandon Johnson 2010 33 Greg Holland 2007 33 8. Brian McCullen 2006 32 9. Chris Masters 2007 31 Greg Holland 2006 31 11. Brian McCullen 2004 30 Ryan Foster 2000 30 Withrow Ward 1988 30 14. Preston Hatcher 2012 29 Garrett Ozar 2009 29 Brian Barnes 2003 29 Ryan Foster 2002 29 Erik Turnrose 1999 29 Rob Hoover 1999 29 19. Vance Chavis 2012 28 THREE OTHERS TIED 28

Making a WCU single-season record 40 appearances in 1994, relief pitcherMIKE MANNING recorded a school-record 14 saves for the Catamounts in ‘94,recording the school’s second-lowest season ERA at 0.97.

JACK KIMMEL won at least nine games in each of his fi nal

three seasons as a Catamount including ranking tied for third

on the single-season charts with 11 wins during the 1990 season.DAN KYSLINGER recorded the WCU school-record low ERA of 0.85 during the 1992 season,earning nine saves that year – tied for the third-most in a single-season.

CHRIS MOORE recorded 205 assists for the

Catamounts during the 1997 season. Moore was

also WCU’s all-time career hits leader

until 2009, amassing 311 from 1996-99.



PHILLIPG

RU

ND

YG

RU

ND

Y


BR

AND

ON

BR

AND

ON

MMccD

OW

ELLD

OW

ELLD

ANIEL

DAN

IELOTTO

NE

GAMES STARTED IN A SEASON NAME YEAR NO. 1. Ryan Basner 2003 18 Jack Kimmel 1990 18 3. Brad Josey 2004 17 Brad Josey 2003 17 Clark Maxwell 1995 17 6. Drew Saberhagen 2007 16 Tyler Sexton 2007 16 Jason Beverlin 1994 16 Jason Beverlin 1993 16 Phillip Grundy 1992 16 Brian Bain 1997 16 12. Jordan Smith 2012 15 Morgan McKinney 2012 15 Mike Tavernier 2009 15 Drew Saberhagen 2008 15 Tyler Sexton 2006 15 Seth Foster 2003 15 Jared Burton 2002 15 David Pember 1999 15 Chris Davidson 1998 15 Kevin Roxrode 1994 15 Patrick Kendrick 1991 15 Phillip Grundy 1991 15 Jack Kimel 1991 15 Paul Menhart 1990 15 Scott Gay 1985 15 Gary Shamp 1985 15

COMPLETE GAMES IN A SEASON NAME YEAR NO. 1. Phillip Grundy 1991 9 2. Phillip Grundy 1992 8 Jack Kimel 1992 8 Ken Hare 1984 8 Rick Adair 1978 8 Rick Adair 1979 8 7. Scott Gay 1985 7 Scott Gay 1984 7 9. Paul Menhart 1988 6 Clark Maxwell 1995 6 Jeery Reed 1976 6

SHUTOUTS IN A SEASON NAME YEAR NO. 1. Jordan Smith 2011 2 Jared Burton 2002 2 Clark Maxwell 1995 2 Tim Sinicki 1988 2 Jack Kimel 1990 2 Paul Menhart 1989 2 Rick Adair 1979 2

MOST SAVES IN A SEASON NAME YEAR NO. 1. Mike Manning 1994 14 2. Preston Hatcher 2012 10 Greg Holland 2007 10 4. Greg Holland 2006 9 Dan Kyslinger 1992 9 Ward Withrow 1988 9 7. Daniel Ottone 2009 8 David Pember 1998 8 9. Daniel Ottone 2010 7 Ryan Foster 2003 7 Ryan Foster 2001 7 Doug Uzdilla 1990 7 Ward Withrow 1987 7 David Ray Robinson 1982 7 David Ray Robinson 1981 7 16. Clint Ramsey 2005 6 Ryan Foster 2002 6 Mike Manning 1993 6

INNINGS PITCHED IN A SEASON NAME YEAR NO. 1. Ryan Basner 2003 125.0 2. Jason Beverlin 1994 124.1 3. Clark Maxwell 1995 123.1 4. David Pember 1999 119.2 5. Scott Gay 1985 113.1 6. Phillip Grundy 1992 110.1 7. Drew Saberhagen 2007 106.2 8. Jason Beverlin 1993 105.1 9. Brad Josey 2003 104.0 10. Jared Burton 2002 103.0 11. Clark Maxwell 1997 102.2 12. Jack Kimel 1990 101.1 13. Brad Josey 2004 101.0

HITS ALLOWED IN A SEASON NAME YEAR NO. 1. David Pember 1999 153 2. Brad Josey 2004 128 3. Ryan Basner 2003 122 Aaron Kirby 1999 122 5. Jack Kimel 1990 120 6. Jared Burton 2001 119 7. Jack Kimel 1991 116 8. Tyler Sexton 2006 115 9. Drew Saberhagen 2007 114 10. Jack Kimel 1992 11111. Tyler Sexton 2007 110

RUNS ALLOWED IN A SEASON NAME YEAR NO. 1. David Pember 1999 82 2. Brian Bain 1997 78 Keith Smith 1986 78 4. Jack Kimel 1990 77 5. Aaron Kirby 1999 76 6. Chris Davidson 1997 75 7. Mike Tavernier 2009 74 Drew Saberhagen 2008 74 9. Lin Stadler 1983 73 10. Aaron Kirby 2000 72 Ken Hare 1983 72 12. Clark Maxwell 1996 71

EARNED RUNS ALLOWED IN A SEASON NAME YEAR NO. 1. Brian Bain 1997 66 2. Chris Davidson 1997 63 Clark Maxwell 1996 63 4. Drew Saberhagen 2008 62 Aaron Kirby 1999 62 6. Paul Menhart 1989 61 7. Jack Kimel 1990 59 8. David Pember 1999 58 Aaron Kirby 2000 58 10. Jackie Slaughter 1987 54

PHPH

STRIKEOUTS IN A SEASON NAME YEAR NO. 1. Jason Beverlin 1994 154 2. Clark Maxwell 1995 124 3. Scott Gay 1985 118 4. Mark DiFelice 1998 110 5. Jason Beverlin 1993 106 6. Jared Burton 2002 105 7. Clark Maxwell 1997 102 8. Clark Maxwell 1996 101 9. Chris Masters 2009 99 9. Ryan Basner 2003 91 Phillip Grundy 1991 91 11. Phillip Grundy 1992 89 Rick Adair 1977 89 13. Chris Davidson 1998 87 Mark DiFelice 1997 87

WALKS ALLOWED IN A SEASON NAME YEAR NO. 1. Scott Gay 1985 66 2. Clark Maxwell 1996 63 3. Paul Menhart 1989 57 4. Clark Maxwell 1995 56 5. Jason Beverlin 1994 55 Paul Menhart 1990 55 Jason Beverlin 1993 55 8. Clark Maxwell 1997 51 Phillip Grundy 1991 51 10. Brian Bain 1997 50 Bill Donovan 1985 50

ROD GOLDSTON (left), TODD BUCHANAN (middle) and ALAN BECK (right), who played together from

2000-03, led Western Carolina to a 2003 Southern Conference Championship and rank among

the WCU career and single-season record books in numerous categories.

In three seasons at Western Carolina, GREG HOLLAND amassed

19 saves to rank fourth on the career charts. The fi rst-team

All-Southern Conference selection also owns two of the top three

single-season save totals with nine in 2006 and 10 in ‘07.

OPPONENT SEASON BATTING AVG.Min 20 app –or– 200 AB

NAME YEAR H-AB AVG. 1. Daniel Ottone 2010 19-69 .210 2. Brandon Johnson 2011 35-163 .215 3. Vance Chavis 2012 21-97 .216 4. Andrew Chilcoat 2011 26-120 .217 5. Brandon McDowell 2003 54-243 .222 6. Greg Holland 2006 48-213 .225 7. Clark Maxwell 1997 83-432 .226 8. Chris Masters 2008 58-256 .227 Derrick Hawk 2003 51-225 .227 10. Brian Bain 1996 60-298 .228 11. Clark Maxwell 1995 107-540 .231 12. Brandon Johnson 2010 44-190 .232 13. Chris Waters 1998 34-155 .238 14. Daniel Ottone 2009 31-129 .240 15. Morgan McKinney 2012 76-313 .243 Chris Masters 2007 52-214 .243 17. Chris Masters 2009 80-323 .248 18. Brian Bain 1998 87-406 .250 Phillip Grundy 1991 97-388 .250 20. Mark DiFelice 1998 95-421 .252 21. Clark Maxwell 1996 85-405 .254

JARED BURTON ranks seventh on WCU’ssingle-season strikeout list. He was draftedby the Oakland A’s in 2002 and later landedon the Cincinnati Reds active rosterin the 2007 Rule 5 Draft.



W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – C A R E E R R E C O R D S

CAREER BATTING AVERAGEMin. 2 years played and 100 AB

NAME YEARS H-AB AVG. 1. Keith Ebersole 1977-78 98-244 .402 2. Clint Fairey 1986-89 284-737 .385 3. Ross Heffl ey 2009-12 354-933 .379 4. Donovan Minero 2001-02 166-441 .376 5. Keith LeClair 1985-88 247-658 .375 6. Charles Thomas 1998-2000 250-668 .374 7. Chris Moore 1996-99 311-837 .372 8. Greg Johnson 1980-83 107-291 .368 9. Barrett Shaft 2005-08 336-929 .362 Freddie Hailey 1984-87 286-790 .362 11. Matt Raleigh 1989-92 302-837 .361 12. Willie Carpenter 1977-80 168-468 .359 13. Brent Greer 2007-09 216-607 .356 14. Kevin Bellomo 1988-91 246-696 .353 15. Mel Kinsey 1980-83 165-469 .352 16. Alex Tolbert 1994-97 246-701 .351 Jody Henson 1992-95 215-612 .351 18. Nick Liles 2007-09 264-755 .350 Jeremy Bruce 1997-98 151-432 .350 Mike Carson 1984-87 263-752 .350 21. Pat Riley 1985-86 65-187 .348 22. Ryan Schade 2000-02 157-453 .347 23. Skip Nelloms 1985-88 264-762 .346 24. Martin Barrow 1995-98 262-759 .345 Mike Tidick 1990-94 270-782 .345 Billy Boyd 1978-80 1123-357 .345 27. Eric Johnson 1997-99 144-418 .344 28. Scott Lyman 1990-93 208-608 .342 29. Alan Beck 2000-03 285-835 .341

GAMES PLAYED IN A CAREER NAME YEARS NO. 1. Matt Raleigh 1989-92 242 2. Mike Tidick 1990-94 233 Freddie Hailey 1984-87 233 4. Barrett Shaft 2005-08 228 5. Eric Whitson 1992-95 225 6. Todd Roper 2001-04 223 7. Rod Goldston 2000-03 222 8. Ross Heffl ey 2009-12 221 9. Chris Davis 2002-05 220 Alan Beck 2000-03 220 Chris Moore 1996-99 220 Mike Carson 1984-87 220 13. Grant Brittain 1987-90 218 Clint Fairey 1986-89 218 15. Blake Murphy 2004-08 214 Skip Nelloms 1985-88 214 17. Kevin Bellomo 1988-91 213 18. Todd Buchanan 2000-03 212 Rodney Tesh 1988-81 212 20. Martin Barrow 1995-98 211

GAMES STARTED IN A CAREER(Stat not kept until 1991)

NAME YEARS NO. 1. Barrett Shaft 2005-08 226 2. Ross Heffl ey 2009-12 221 3. Chris Moore 1996-99 220 4. Alan Beck 2000-03 215 5. Todd Roper 2001-04 213 Rod Goldston 2000-03 213 7. Todd Buchanan 2000-03 205 8. Blake Murphy 2004-08 204 9. Eric Whitson 1992-95 203 10. Mike Tidick 1990-94 202 11. Martin Barrow 1995-98 192 12. Alex Tolbert 1994-97 187

MOST AT BATS IN A CAREER NAME YEARS NO. 1. Ross Heffl ey 2009-12 933 2. Barrett Shaft 2005-08 929 3. Todd Roper 2001-05 875 4. Rod Goldston 2000-03 848 5. Chris Moore 1996-99 837 Matt Raleigh 1989-92 837 7. Alan Beck 2000-03 835 8. Todd Buchanan 2000-03 801 9. Freddie Hailey 1984-87 790 10. Mike Tidick 1990-94 782 11. Skip Nelloms 1985-88 762 12. Martin Barrow 1995-98 759 13. Blake Murphy 2004-08 757 14. Nick Liles 2007-09 755 15. Mike Carson 1984-87 752

RUNS SCORED IN A CAREER NAME YEARS NO. 1. Matt Raleigh 1989-92 251 2. Chris Moore 1996-99 240 3. Alan Beck 2000-03 216 Freddie Hailey 1984-87 216 5. Martin Barrow 1995-98 207 6. Barrett Shaft 2005-08 204 7. Todd Roper 2001-04 200 8. Rod Goldston 2000-03 197 9. Matt Johns 2008-11 193 Kevin Bellomo 1988-91 193 11. Skip Nelloms 1985-88 192 12. Blake Murphy 2004-08 190 13. Clint Fairey 1986-89 186 14. Mike Tidick 1990-94 185 15. Ross Heffl ey 2009-12 184 16. Alex Tolbert 1994-97 180 17. Todd Buchanan 2000-03 177 18. Keith LeClair 1985-88 175 19. Charles Thomas 1998-2000 169 20. Nick Liles 2007-09 167 21. Steven Strausbaugh 2005-07 166

HITS IN A CAREER NAME YEARS NO. 1. Ross Heffl ey 2009-12 354 2. Barrett Shaft 2005-08 336 3. Chris Moore 1996-99 311 4. Matt Raleigh 1989-92 302 5. Freddie Hailey 1984-87 286 6. Alan Beck 2000-03 285 7. Clint Fairey 1986-89 284 8. Todd Roper 2001-04 271 9. Mike Tidick 1990-94 270 10. Nick Liles 2007-09 264 Skip Nelloms 1985-88 264 12. Mike Carson 1984-87 263 13. Martin Barrow 1995-98 262 14. Rod Goldston 2000-03 261 15. Todd Buchanan 2000-03 258 16. Barrett Shaft 2005-08 253 17. Charles Thomas 1998-2000 250 18. Keith LeClair 1985-88 247 19. Blake Murphy 2004-08 246 Alex Tolbert 1994-97 246 Kevin Bellomo 1988-91 246

DOUBLES IN A CAREER NAME YEARS NO. 1. Rod Goldston 2000-03 70 2. Chris Moore 1996-99 68 3. Ross Heffl ey 2009-12 63 4. Barrett Shaft 2005-08 62 Mike Carson 1984-87 62 6. Blake Murphy 2004-08 60 Alan Beck 2000-03 60 8. Matt Raleigh 1989-92 56 9. Matt Johns 2008-11 55 10. Alex Tolbert 1994-97 54 Mike Tidick 1990-94 54 12. Nick Liles 2007-09 52 Todd Buchanan 2000-03 52 14. Todd Roper 2001-04 50 15. Brent Greer 2007-09 48 Joey Cox 1989-92 48 17. Barrett Shaft 2005-08 46 Steven Strausbaugh 2005-07 46 19. Chris Davis 2002-05 45 20. Kevin Bellomo 1988-91 44 21. Martin Barrow 1995-98 43 Todd Raleigh 1988-91 43 Rodney Tesh 1988-91 43 Freddie Hailey 1984-87 43

MOST TRIPLES IN A CAREER NAME YEARS NO. 1. Martin Barrow 1995-98 15 2. Danny Jones 1964-67 13 3. Freddie Hailey 1984-87 11 4. David Ball 1977-79 10 5. Tracy Biggs 1997-2000 9 Chris Moore 1996-99 9 Skip Nelloms 1985-88 9 John Pust 1982-85 9 Freddy Brown 1976-79 9 Wayne Tolleson 1975-78 9 11. Todd Roper 2001-04 8 Matt Stillwell 1995-98 8 Mike Tidick 1990-94 8 Matt Raleigh 1989-92 8 Kevin Bellomo 1988-91 8 Jim Reinicker 1978-82 8 Willie Carpenter 1977-80 8

MOST HOME RUNS IN A CAREER NAME YEARS NO. 1. Matt Raleigh 1989-92 68 2. Clint Fairey 1986-89 61 3. Alex Tolbert 1994-97 51 4. Chris Moore 1996-99 50 5. Blake Murphy 2004-08 47 Skip Nelloms 1985-88 47 7. Alan Beck 2000-03 45 8. Steven Strausbaugh 2005-07 41 9. Mike Carson 1984-87 40 10. Kevin Bellomo 1988-91 37 11. Ross Heffl ey 2009-12 35 12. Mike Tidick 1990-94 34 13. Jonathan Greene 2005-07 33 14. Donovan Minero 2001-02 32 Grant Brittain 1987-90 32 16. Mark Poarch 1987-90 31 Mel Kinsey 1980-83 31 18. Jared Greenwood 2004-05 29 Steve Harris 1988-89 29 20. Keith LeClair 1985-88 28 21. Matt Johns 2008-11 27 Phillip Grundy 1992-93 27 Charlie Fonville 1981-84 27

RUNS BATTED IN FOR A CAREER NAME YEARS NO. 1. Chris Moore 1996-99 254 2. Matt Raleigh 1989-92 239 3. Ross Heffl ey 2009-12 222 Alan Beck 2000-03 222 5. Skip Nelloms 1985-88 212 6. Blake Murphy 2004-08 205 7. Clint Fairey 1986-89 199 8. Alex Tolbert 1994-97 198 9. Mike Carson 1984-87 197 10. Todd Buchanan 2000-03 181 11. Steven Strausbaugh 2005-07 168 12. Mike Tidick 1990-94 158 13. Freddie Hailey 1984-87 156 Mel Kinsey 1980-83 156 15. Rod Goldston 2000-03 153 16. J.P. Burwell 1994-97 150 17. Matt Johns 2008-11 146 Keith LeClair 1985-88 146 19. Jonathan Greene 2005-07 145 Mark Poarch 1987-90 145

TOTAL BASES IN A CAREER NAME YEARS NO. 1. Matt Raleigh 1989-92 580 2. Chris Moore 1996-99 545 3. Ross Heffl ey 2009-12 532 4. Alan Beck 2000-03 488 5. Clint Fairey 1986-89 484 6. Skip Nelloms 1985-88 462 7. Blake Murphy 2004-08. 331 Alex Tolbert 1994-97 459 9. Mike Carson 1984-87 467 10. Barrett Shaft 2005-08 448 11. Mike Tidick 1990-94 442 12. Kevin Bellomo 1988-91 415 13. Steven Strausbaugh 2005-07 397 14. Todd Buchanan 2000-03 394 15. Matt Johns 2008-11 388 16. Rod Goldston 2000-03 387 17. Keith LeClair 1985-88 383 18. Martin Barrow 1995-98 377 19. Nick Liles 2007-09 366 20. Freddie Hailey 1984-87 354 21. Jonathan Greene 2005-07 345

CAREER SLUGGING PERCENTAGE NAME YEARS TB-AB PCT. 1. Pat Riley 1985-86 139-187 .743 2. Steve Harris 1998-99 196-264 .742 3. Keith Ebersole 1977-78 175-244 .717 4. Matt Raleigh 1989-92 580-873 .693 5. Donovan Minero 2001-02 293-441 .664 6. Clint Fairey 1986-89 484-737 .657 7. Alex Tolbert 1994-97 459-701 .655 8. Chris Moore 1996-99 545-837 .651 9. Phillip Grundy 1992-93 203-319 .636 10. Jared Greenwood 2004-05 255-408 .625 11. Mike Carson 1984-87 457-752 .608 12. Blake Murphy 2004-08 459-757 .606 Skip Nelloms 1985-88 462-762 .606 14. Jim Reinicker 1978-82 158-261 .605 15. Steven Strausbaugh 2005-07 397-665 .597 16. Kevin Bellomo 1988-91 415-696 .596 17. Charlie Fonville 1981-84 286-487 .587

BARRETT SHAFT (2005-08) took over as Western Carolina’s all-time leading hitterin his third plate appearance of a home, 5-3 win over Wofford on May 2, 2008as he poked one into left fi eld to surpass CHRIS MOORE (1996-99).Shaft ended his four-year career tied for eighth all-time in career batting average (.362).

MATT RALEIGH (34) belted a Western Carolina and Southern Conference

record 68 home runs during a four-year career fomr 1989-92 while

also scoring a school record 251 career runs.

CLI

NT

CLI

NTF

AIR

EYFA

IREY

SKIP NELLOMS ranks inside the top 10 of fourWCU career batting categories includingbase hits, home runs, total bases and RBI.




18. Alan Beck 2000-03 488-835 .584 19. Keith LeClair 1985-88 383-658 .582 20. Willie Carpenter 1977-80 268-468 .573

BASE ON BALLS IN A CAREER NAME YEARS NO. 1. Matt Raleigh 1989-92 182 2. Grant Brittain 1987-90 150 3. Blake Murphy 2004-08 146 4. Freddie Hailey 1984-87 142 5. Clint Fairey 1986-89 135 6. Alan Beck 2000-03 132 Rod Goldston 2000-03 132 8. Todd Buchanan 2000-03 130 9. Alex Tolbert 1994-97 124 10. Mel Kinsey 1980-83 120 11. Ross Heffl ey 2009-12 119 12. Chris Moore 1996-99 117 13. Mike Carson 1984-87 108 14. Skip Nelloms 1985-88 107 John Pust 1982-85 107 16. Wayne Tolleson 1975-78 102 17. Brian Tebo 1983-86 100

HIT BY PITCHES IN A CAREER NAME YEARS NO. 1. Barrett Shaft 2005-08 44 2. Jonathan Greene 2005-07 41 3. Cameron Dullnig 2010-11 40 4. Tim Hallam 2005-06 36 5. Brian Sigmon 2001-04 35 6. Blake Murphy 2004-08 34 7. J.P. Burwell 1994-97 33 8. Chris Davis 2002-05 32 9. TYLER WHITE 2010-PRES. 28 Alan Beck 2000-03 28 Scott Lyman 1990-93 28 12. Steven Strausbaugh 2005-07 29 13. Austin Schultz 2010-11 23 Mike Tidick 1990-94 23 15. Chris Moore 1996-99 21 Rod Goldston 2000-03 19 Denver Edick 2003-04 19

STRIKE OUT IN A CAREER NAME YEARS NO. 1. Matt Raleigh 1989-92 201 2. Blake Murphy 2004-08 180 3. Alex Tolbert 1994-97 173 4. Alan Beck 2000-03 165 5. Eric Whitson 1992-95 162 6. Brian Tebo 1983-86 153 7. Matt Stillwell 1995-98 149 8. Mike Tidick 1990-94 140 9. Matt Johns 2008-pres. 137 10. Joey Cox 1989-92 136 11. Todd Buchanan 2000-03 133 12. Dave McKay 1995-98 130 Tony Horne 1993-86 130 Marc Striker 1991-94 130 15. Jonathan Greene 2005-07 126 16. Tyler Kirkpatrick 2007-10 124 17. Martin Barrow 1995-98 121 18. Brent Greer 2007-09 120 Grant Brittain 1987-90 120 20. Chris Moore 1996-99 118

CAREER ON-BASE PERCENTAGESac Flies not kept until 1991

NAME YEARS NO. 1. Ross Heffl ey 2009-12 .452 2. Blake Murphy 2004-08 .449 3. Barrett Shaft 2005-08 .436 4. Brent Greer 2007-09 .432 5. Steven Strausbaugh 2005-07 .421 6. Jonathan Greene 2005-07 .415 7. Nick Liles 2007-09 .407 8. TYLER WHITE 2010-PRES. .398 9. Charles Thomas 1998-2000 .397 10. Donovan Minero 2001-02 .391 Chris Moore 1996-99 .391 12. Scott Lyman 1990-93 .386 13. Eric Johnson 1997-99 .383 14. Tim Hallam 2005-06 .378 15. Steve Harris 1998-99 .377 16. Alan Beck 2000-03 .374 17. Mike Tidick 1990-94 .373 18. Jeremy Bruce 1997-98 .371 19. Chris Davis 2002-05 .370 20. Phillip Grundy 1992-93 .366 21. Martin Barrow 1995-98 .365

SACRIFICE FLIES IN A CAREERSac Flies & Sac Hits were one stat until 1991

NAME YEARS NO. 1. Chris Moore 1996-99 17 2. J.P. Burwell 1994-97 15 3. Alex Tolbert 1994-97 14 4. Steven Strausbaugh 2005-07 13 5. Ross Heffl ey 2009-12 12 Blake Murphy 2004-08 12 7. Stephen Notaro 2008-11 11 Barrett Shaft 2005-08 11 Todd Roper 2001-04 11 10. Jonathan Greene 2005-07 10 Jeff Sziksai 1996-98 10 Marc Striker 1991-94 10 Trevor Collias 2009-10 9 Donovan Minero 2001-02 9 Martin Barrow 1995-98 9 Jody Henson 1992-95 9 Scott Lyman 1990-93 9

SACRIFICE HITS IN A CAREERSac Flies & Sac Hits were one stat until 1991

Name Years No. 1. Todd Roper 2001-04 28 2. Ron Huntington 1983-86 25 3. Barrett Shaft 2005-08 22 4. Stephen Notaro 2008-11 19 Chad Moore 1992-96 19 Grant Brittain 1987-90 19 Mike Carson 1984-87 19 8. Matt Johns 2008-11 18 Clint Fairey 1986-89 18 Skip Nelloms 1985-88 18 11. Robbie Gordon 1985-88 17 12. Dylan de Graaf 2007-10 16 Brent Greer 2007-09 16 Rodney Tesh 1988-91 16 Matt Thrasher 1980-82 16

STOLEN BASES IN A CAREER Name Years No. 1. Wayne Tolleson 1975-78 84 2. Matt Johns 2008-11 64 3. Mike Tidick 1990-94 63 4. Martin Barrow 1995-98 62 5. Eric Johnson 1997-99 59 6. David Hill 1980-83 58 7. Chuck Koone 1997-98 57 8. Dave McKay 1995-98 53 9. Nick Liles 2007-09 51 Jody Henson 1992-95 51 11. Matt Raleigh 1989-92 47 Gary Fishel 1972-75 47 13. Willie Carpenter 1977-80 43 14. Blake Murphy 2004-08 41 15. Freddie Hailey 1984-87 40 16. Charles Thomas 1998-2000 38 17. Billy Boyd 1978-80 37 18. Kevin Bellomo 1988-91 36 19. Chad Moore 1992-96 35 20. Alan Beck 2000-03 33 Matt Stillwell 1995-98 33 22. Trevor Collias 2009-pres. 30 23. Wayne Kilmer 2003-04 29 Eric Whitson 1992-95 29

CAREER STOLEN BASE ATTEMPTS Name Years No. 1. Wayne Tolleson 1975-78 101 2. Matt Johns 2008-11 81 3. Mike Tidick 1990-94 75 4. Martin Barrow 1995-98 74 5. Dave McKay 1995-98 71 6. Eric Johnson 1997-99 69 7. David Hill 1980-83 65 8. Chuck Koone 1997-98 64 9. Jody Henson 1992-95 63 10. Nick Liles 2007-09 61 11. Charles Thomas 1998-2000 52 12. Matt Raleigh 1989-92 51 13. Blake Murphy 2004-08 50 Todd Roper 2001-04 50 Billy Boyd 1978-80 50

PUTOUTS IN A CAREER Name Years No. 1. Todd Buchanan 2000-03 1,691 2. Alex Tolbert 1994-97 1,465 3. Marc Striker 1991-94 1,353 4. J.P. Burwell 1994-97 1,034 5. Trey McDaniel 2005-06 1,026

6. Roy Hurst 1992-94 1,014 7. Don Ingle 1979-80 989 8. Tyler White 2010-PRES. 936 9. Blake Murphy 2004-pres. 867 10. Clint Fairey 1986-89 807 11. Brian Sigmon 2001-04 805 12. Charlie Fonville 1981-84 749 13. Todd Raleigh 1988-91 746 14. Jared Greenwood 2004-05 734

MOST ASSISTS IN A CAREER Name Years No. 1. Todd Roper 2001-04 667 2. Chris Moore 1996-99 631 3. Grant Brittain 1987-90 548 4. Matt Raleigh 1989-92 518 5. Ross Heffl ey 2009-12 513 6. Ron Huntington 1983-86 460 7. John Pust 1982-85 453 8. Robbie Gordon 1985-88 402 9. Rodney Hennon 1990-93 392 10. Chris Davis 2002-05 387 11. Brent Greer 2007-09 385 12. Eric Whitson 1992-95 376 13. Tim Hallam 2005-06 362 14. Nick Liles 2007-09 348 15. Andy Dunn 1988-91 329 16. Jim Eldredge 1984-86 327 17. Wayne Tolleson 1975-78 323 18. Dale Fox 1972-75 317 19. Jeff Sziksai 1996-98 307

ERRORS COMMITTED IN A CAREER Name Years No. 1. Matt Raleigh 1989-92 88 2. Chris Moore 1996-99 87 Eric Whitson 1992-95 87 4. Grant Brittain 1987-90 84 5. Ron Huntington 1983-86 69 6. John Pust 1982-85 58 7. Jim Eldredge 1984-86 54 8. Chet Greeson 1979-82 51 9. Chris Davis 2002-05 49 10. Andy Dunn 1988-91 48 11. Todd Roper 2001-04 45 Chris Rowley 1994-97 45 Rodney Hennon 1990-93 45 Billy Boyd 1978-80 45

FIELDING PCT. IN A CAREERMin. 400 chances

Name Years No. 1. Todd Buchannan 2000-03 .992 2. Marc Striker 1991-94 .991 3. Barrett Shaft 2005-pres. .990 John Ingram 2007 .990 Trey McDaniel 2005-06 .990 6. Keith Ebersole 1977-78 .988 Gary Fishel 1972-75 .988 8. Brian Sigmon 2001-04 .986 Greg Johnson 1980-83 .986 10. Don Ingle 1979-80 .985 11. Jared Greenwood 2004-05 .984 Frankie Ward 1997-98 .984 Todd Raleigh 1988-91 .984

DO

ND

ON

BR

IGH

TB

RIG

HT

g

MAR

CM

ARC

STR

IKER

STR

IKER

MARK DiFELICE compiled a Western Carolina school-record 34

victories on the mound during the 1995-98 seasons, a mark which

ranked second in Southern Conference history entering 2010.

14. Alex Tolbert 1994-97 .983 15. Rodney Tesh 1988-91 .981 Gary Grindstaff 1973-76 .981 17. Austin Smithwick 1997-2000 .980 18. Keith LeClair 1985-88 .980 19. Darryl Rogers 1984-87 .979 Dale Fox 1972-74 .979

CAREER TOTAL DEFENSIVE CHANCES Name Years No. 1. Todd Buchanan 2000-03 1,789 2. Alex Tolbert 1994-97 1,572 3. Marc Striker 1991-94 1,514 4. Blake Murphy 2004-08 1,356 5. J.P. Burwell 1994-97 1,196 6. Roy Hurst 1992-94 1,164 7. Todd Roper 2001-05 1,137 8. Trey McDaniel 2005-06 1,086 9. Don Ingle 1979-80 1,059 10. Grant Brittain 1987-90 1,033 11. Chris Moore 1996-99 1,006 12. Clint Fairey 1986-89 997 13. Brian Sigmon 2001-04 904 14. Todd Raleigh 1988-91 873

LOWEST CAREER ERA 1. Don Bright 1972-73 1.23 2. Rod Rogers 1962-66 2.16 3. Rick Adair 1977-79 2.21 4. Jerry Reed 1974-77 2.37 5. Ward Withrow 1987-88 2.70 6. Lester Wright 1972-75 2.74 7. Noland Smathers 1969-70 2.75 8. Drew Saberhagen 2007-08 2.87 9. Flip Watson 1973-76 3.07 10. Phillip Grundy 1991-93 3.09 11. Glenn Glover 1970-73 3.23 12. Chris Waters 1995-98 3.35 13. Mike Manning 1991-94 3.51 14. David Ray Robinson 1980-83 3.65 15. Greg Moore 1980-83 3.71 16. Jason Beverlin 1992-94 3.79 17. Scott Gay 1983-85 4.03 18. Brad Josey 2002-04 4.07



RICK ADAIR won 19 games on the mound

for the Catamounts in the mid-to-late 1970s,

tying the WCU-record with 21 complete games.


19. Mark DiFelice 1995-98 4.11 20. Brandon Johnson 2008-11 4.18 21. Greg Holland 2005-07 4.22 Paul Menhart 1988-90 4.22

MOST WINS IN A CAREER NAME YEARS NO. 1. Mark DiFelice 1995-98 34 2. Jack Kimel 1989-92 33 3. Clark Maxwell 1994-97 30 4. Jason Beverlin 1992-94 27 5. Scott Gay 1983-85 26 6. Phillip Grundy 1991-93 24 7. Jerry Reed 1974-77 22 8. Tyler Sexton 2006-08 20 Brian Bain 1995-98 20 Ken Hare 1980; 82-84 20 11. Brandon Johnson 2008-11 19 Chris Masters 2007-09 19 Paul Menhart 1988-90 19 Rick Adair 1977-79 19 15. Ryan Basner 2000-03 18 16. Brian McCullen 2004-06 17 Seth Foster 2000-03 17 Chris Davidson 1996-98 17 Stewart Keyes 1986-89 17 Gary Shamp 1974-87 17 21. Tyler Sexton 2006-08 16 Brad Josey 2002-04 16 Aaron Kirby 1998-2000 16 Joe Jack Sellers 1992-95 16

LOSSES IN A CAREER NAME YEARS NO. 1. Ryan Basner 2000-03 19 2. Seth Foster 2000-03 17 Paul Menhart 1988-90 17 Stewart Keyes 1986-89 17 5. Phillip Grundy 1991-93 16 Gary Shamp 1984-87 16 7. Ken Hare 1980; 82-84 15 8. Clark Maxwell 1994-97 14 Jack Kimel 1989-92 14 Lin Stadler 1980-82 14 11. Tyler Sexton 2006-08 13 Jared Burton 2000-02 13 Mark DiFelice 1995-98 13 Dale Pilgrim 1993-96 13 Randy Sims 1979-82 13

CAREER WINNING PERCENTAGE20 decisions or 200 innings

NAME YEARS W-L PCT. 1. Scott Gay 1983-85 26-7 .788 2. Brandon Johnson 2008-11 19-6 .760 3. Jason Beverlin 1992-94 27-9 .750 4. Mark DiFelice 1992-94 34-13 .723 5. Rick Adair 1977-79 19-8 .704 6. Jack Kimel 1989-92 33-14 .702 7. Brian Bain 1995-98 20-9 .690 8. Clark Maxwell 1994-97 30-14 .622 David Ray Robinson 1980-80 15-7 .682 10. Brian McCullen 2004-06 17-8 .680 11. Tim Sinicki 1987-88 14-7 .667 Jerry Reed 1974-77 22-11 .667 13. Chris Davidson 1996-98 17-9 .654 14. Derrick Hawk 2003-05 15-8 .652 15. Brad Josey 2002-04 16-9 .640 16. Keith Smith 1984-86 14-8 .636

APPEARANCES IN A CAREER NAME YEARS NO. 1. Ryan Foster 2000-03 121 2. Brandon Johnson 2008-11 97 3. Joe Camac 2000-03 93 4. Brian Barnes 2002-05 87 5. Mike Manning 1991-94 86 6. Brian McCullen 2004-06 83 7. Greg Holland 2005-07 82 Ryan Basner 2000-03 82 9. Dale Pilgrim 1993-96 81 10. Chris Masters 2007-09 76 11. Rob Hoover 1998-2002 75 Chris Waters 1995-989 75 13. Daniel Ottone 2007-10 73 14. Jack Kimel 1989-92 71 15. Corey Martin 2006-09 70 16. Andrew Chilcoat 2010-11 68 Clark Maxwell 1994-97 68 18. Gary Shamp 1984-87 67 19. Mark DiFelice 1995-98 66 Jeff Stevens 1986-89 66

GAMES STARTED IN A CAREER NAME YEARS NO. 1. Jack Kimel 1989-92 53 2. Clark Maxwell 1994-97 51 3. Seth Foster 2000-03 48 4. Stewart Keyes 1986-89 47 5. Mark DiFelice 1995-98 43 Phillip Grundy 1991-93 43 7. Brad Josey 2002-04 42 Chris Davidson 1996-98 42 9. Brian Bain 1995-98 41 10. Jared Burton 2000-02 40 Jason Beverlin 1992-94 40 12. Ken Hare 1980; 82-84 38 13. Tyler Sexton 2006-08 37 Ryan Basner 2000-03 37 Paul Menhart 1988-90 37

COMPLETE GAMES IN A CAREER NAME YEARS NO. 1. Phillip Grundy 1991-93 21 Rick Adair 1977-79 21 3. Scott Gay 1983-85 17 4. Ken Hare 1980; 82-84 16 5. Jack Kimel 1989-92 14 6. Clark Maxwell 1994-97 13 7. Mark DiFelice 1995-98 12 Paul Menhart 1988-90 12 Jerry Reed 1974-77 12 10. Randy Sims 1979-82 11 11. Stewart Keyes 1986-89 10 12. Jason Beverlin 1992-94 9 13. Brian Bain 1995-98 7 Gary Shamp 1984-87 7 Keith Smith 1984-86 7 Greg Moore 1980-83 7

SHUTOUTS IN A CAREERStat only kept since 1979

NAME YEARS NO. 1. Jack Kimel 1989-92 4 2. Clark Maxwell 1994-97 3 3. JORDAN SMITH 2011-PRES. 2 Jared Burton 2000-02 2 Phillip Grundy 1991-93 2 Paul Menhart 1988-90 2 Tim Sinicki 1987-88 2 Rick Adair 1977-79 2 9. Tyler Sexton 2006-08 1 Brad Josey 2002-04 1 Dan Foley 2001-02 1 Brian Bain 1995-98 1 Joe Jack Sellers 1992-95 1 Mike Thomas 1990-91 1 Gary Shamp 1984-87 1 Keith Smith 1984-86 1 Scott Gay 1983-85 1 Ken Hare 1980; 82-84 1 Greg Moore 1980-83 1 Randy Sims 1979-82 1

MOST SAVES IN A CAREER NAME YEARS NO. 1. Ryan Foster 2000-03 22 2. Mike Manning 1991-94 20 David Ray Robinson 1980-83 20 4. Greg Holland 2005-07 19 5. Ward Withrow 1987-88 16 6. Daniel Ottone 2007-10 15 7. Derrick Hawk 2003-05 10 8. David Pember 1997-99 9 Dan Kyslinger 1992 9 10. Dale Pilgrim 1993-96 8 Doug Uzdilla 1987-90 8 12. Mike Thomas 1989-91 7 Jackie Slaughter 1984-87 7 Doug Mitchell 1980-82 7

CAREER INNINGS PITCHED NAME YEARS NO. 1. Clark Maxwell 1994-97 363.0 2. Jack Kimel 1989-92 348.2 3. Mark DiFelice 1995-98 343.2 4. Phillip Grundy 1991-93 294.1 5. Stewart Keyes 1986-89 289.0 6. Ryan Basner 2000-03 288.1 7. Jason Beverlin 1992-94 285.0 8. Seth Foster 2000-03 273.1 9. Paul Menhart 1988-90 266.1 10. Jerry Reed 1974-77 265.2 11. Brian Bain 1995-98 259.2 12. Brad Josey 2002-04 258.2 13. Tyler Sexton 2006-08 257.2 14. Gary Shamp 1984-87 250.0 15. Scott Gay 1983-85 248.0

MOST HITS ALLOWED IN A CAREER NAME YEARS NO. 1. Jack Kimel 1989-92 410 2. Mark DiFelice 1995-98 381 3. Seth Foster 2000-03 336 4. Ryan Basner 2000-03 335 5. Clark Maxwell 1994-97 331 6. Stewart Keyes 1986-89 327 7. Tyler Sexton 2006-08 311 8. Gary Shamp 1984-87 309 9. Ken Hare 1980; 82-84 305 10. Brad Josey 2002-04 391 11. Jason Beverlin 1992-94 280

RUNS ALLOWED IN A CAREER NAME YEARS NO. 1. Jack Kimel 1989-92 236 2. Clark Maxwell 1994-97 227 3. Seth Foster 2000-03 224 4. Stewart Keyes 1986-89 222 5. Gary Shamp 1984-87 204 6. Ken Hare 1980; 82-84 194 7. Mark DiFelice 1995-98 191 8. Lin Stadler 1980-83 186 9. Brian Bain 1995-98 182 10. Mike Tavernier 2008-09 181 11. Tyler Sexton 2006-08 180

CAREER EARNED RUNS ALLOWED NAME YEARS NO. 1. Clark Maxwell 1994-97 185 2. Jack Kimel 1989-92 181 3. Stewart Keyes 1986-89 173 4. Seth Foster 2000-03 161 5. Mark DiFelice 1995-98 157 6. Corey Martin 2006-09 153 7. Gary Shamp 1984-87 150 Ken Hare 1980; 82-84 150 9. Ryan Basner 2000-03 147 10. Brian Bain 1995-98 146 11. Tyler Sexton 2006-08 142 Chris Davidson 1996-98 142

WALKS ALLOWED IN A CAREER NAME YEARS NO. 1. Clark Maxwell 1994-97 195 2. Paul Menhart 1988-90 158 3. Stewart Keyes 1986-89 153 4. Scott Gay 1983-85 142 5. Jason Beverlin 1992-94 135 6. Brian Bain 1995-98 134 7. Jerry Reed 1974-77 128 8. Randy Sims 1979-82 125 9. Doug Uzdilla 1987-90 123 10. Phillip Grundy 1991-93 121

STRIKEOUTS IN A CAREER NAME YEARS NO. 1. Clark Maxwell 1994-97 374 2. Jason Beverlin 1992-94 306 3. Mark DiFelice 1995-98 301 4. Phillip Grundy 1991-93 263 5. Jack Kimel 1989-92 259 6. Chris Masters 2007-09 241 7. Rick Adair 1977-79 238 8. Brian Bain 1995-98 232 9. Tyler Sexton 2006-08 217 10. Paul Menhart 1988-90 214 11. Scott Gay 1983-85 213 12. Jared Burton 2000-02 212 13. Ryan Basner 2000-03 211 14. Chris Davidson 1996-98 199 15. Jerry Reed 1974-77 184 16. Seth Foster 2000-03 181 17. Joe Jack Sellers 1992-95 178 18. Matt Benedict 2008-11 174 19. Stewart Keyes 1986-89 168 20. Dale Pilgrim 1993-96 166 21. Ken Hare 1980; 82-84 165

CAREER STRIKEOUT-TO-WALK RATIO50 appearances or 150 innings

NAME YEARS K-BB RATIO 1. Luke Miller 2003-05 46-11 4.18 2. Caleb McConnell 2004-06 150-44 3.41 3. Mark DiFelice 1995-98 301-93 3.24 4. Brad Josey 2002-04 155-54 2.87 5. Garrett Ozar 2007-09 126-50 2.52 6. Jared Burton 2000-02 212-85 2.49 7. Ryan Foster 2000-03 129-52 2.48 8. Jack Kimel 1989-92 259-109 2.38 9. Chris Masters 2007-09 241-105 2.30 10. Ryan Basner 2000-03 211-93 2.267 11. Jason Beverlin 1992-94 306-135 2.269 12. Derrick Hawk 2003-05 124-56 2.21 13. Mike Tavernier 2007-09 131-60 2.18

CLA

RK

CLA

RK

MA

XWEL

LM

AXW

ELL

JASON BEVERLIN won 27 games from 1992-94 for the Catamounts. A consensus All-Americaselection, SoCon Pitcher of the Year, SoCon Male Athlete of the Year, and a two-timeAll-Atlantic Region All-Star, he was inducted into the WCU Athletics Hall of Fame in 2008.



W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – A N N U A L C AT E G O R Y L E A D E R S

BATTING AVERAGE LEADERS1952 Dwight Sherrill .................. .2581953 Dwight Sherrill ....................2741954 Ron Swartzel .................... .2881955 Fred Liner ......................... .4091956 Dwight Sherrill .................. .4001957 Jim Matthews ................... .4311958 —not available—1959 Bob Ballance.................... .3101960 Bob Ballance.................... .4411961 Jim Ray ............................ .3321962 Ken Morgan...................... .3721963 Danny Tharpe ................... .3501964 Danny Tharpe .....................3711965 Joe Fraser ......................... .3231966 Cecil Caldwell .................. .3271967 Roddy Edwards ................. .3531968 Eddie Hope ...................... .3651969 Reed Griffi th ..................... .3001970 Bruce West ....................... .3751971 Tommy Hayes ................... .3731972 Dale Fox ........................... .3471973 Gary Fishel ....................... .3301974 Danny Carswell................. .2991975 Jerry Gaines...................... .4041976 Dennis Blake .................... .3821977 Keith Ebersole .................. .4231978 Keith Ebersole .................. .3841979 Billy Boyd ......................... .3931980 Willie Carpenter ............... .3921981 Mel Kinsey ....................... .4001982 Jim Reinicker .................... .3571983 Greg Johnson ................... .4051984 Freddie Hailey .................. .3951985 Mike Carson ..................... .3631986 Clint Fairey ....................... .4251987 Clint Fairey ....................... .4051988 Keith LeClair ..................... .4231989 Clint Fairey ....................... .3691990 Grant Brittain ................... .4281991 Kevin Bellomo .................. .4351992 Scott Lyman ..................... .3891993 Scott Lyman ..................... .3611994 Mike Tidick ....................... .3761995 Jody Henson ..................... .4011996 Alex Tolbert ...................... .4241997 Jeremy Bruce .................... .4011998 Charles Thomas ................ .3641999 Charles Thomas ................ .4062000 Charles Thomas ................ .3492001 Alan Beck ......................... .3852002 Beck/Minero/Roper ..........3742003 Rod Goldston ................... .3482004 Jared Greenwood .............. .3382005 Steven Strausbaugh ......... .3672006 Trey McDaniel ................... .3562007 Kenny Smith ..................... .3902008 Barrett Shaft ......................3742009 Brent Greer...................... .4202010 Ross Heffl ey ..................... .3612011 Ross Heffl ey ..................... .4192012 Tyler White ....................... .354

ANNUAL HITS LEADERS1969 Steve Barkley ...................... 271970 Jim Grove ............................ 441971 Tommy Hayes ...................... 501972 Dale Fox .............................. 341973 Gary Fishel .......................... 291974 Jimmy Stewart ..................... 251976 Buddy Fox ........................... 381977 Keith Ebersole ..................... 471978 Keith Ebersole ......................511979 Billy Boyd ............................ 421980 Willie Carpenter .................. 561981 Mel Kinsey .......................... 481982 K. Carson/D. Hill ................. 421983 Greg Johnson ...................... 641984 Charlie Fonville.................... 641985 David Hyatt .......................... 871986 Freddie Hailey ..................... 851987 Keith LeClair ........................ 871988 Keith LeClair ...................... 1011989 Clint Fairey .......................... 69

1990 Grant Brittain ...................... 771991 Kevin Bellomo ................... 1011992 Rodney Hennon ................... 921993 Rodney Hennon ................... 871994 Roy Hurst ............................ 891995 Jody Hansen ........................ 811996 Alex Tolbert ......................... 921997 Jeremy Bruce ....................... 991998 Martin Barrow ..................... 861999 Eric Johnson ...................... 1002000 Charles Thomas ................... 752001 Donovan Minero .................. 832002 Donovan Minro .................... 832003 Rod Goldston ...................... 862004 C. Davis/T.Roper ................. 752005 Steven Strausbaugh ............ 802006 Barrett Shaft ....................... 862007 Kenny Smith ........................ 972008 Nick Liles ............................ 932009 Brent Greer........................ 1022010 Ross Heffl ey ........................ 862011 Ross Heffl ey ........................ 962012 Ross Heffl ey ........................ 80

ANNUAL RUNS LEADERS1969 Bill Wofford ......................... 151970 Bruce West .......................... 161971 Tommy Hayes ...................... 341972 Eddie Davis ........................ 261973 Dale Fox .............................. 161974 Eddie Davis ......................... 181975 Jerry Gaines......................... 221976 Wayne Tolleson .................... 311977 David Ball ........................... 461978 Wayne Tolleson .................... 461979 Billy Boyd ............................ 261980 Chet Greeson ...................... 331981 Mel Kinsey .......................... 441982 C. Greeson/D. Hill ............... 351983 David Hill ............................ 431984 David Hyatt .......................... 441985 David Hyatt .......................... 651986 Freddie Hailey ..................... 671987 Freddie Hailey ..................... 671988 Keith LeClair ........................ 651989 Matt Raleigh ....................... 531990 Grant Brittain ...................... 671991 Kevin Bellomo ..................... 771992 Matt Raleigh ....................... 771993 Rodney Hennon ................... 651994 Mike Tidick .......................... 621995 Alex Tolbert ......................... 471996 Alex Tolbert ......................... 581997 Jeremy Bruce ....................... 821998 Martin Barrow ..................... 721999 Eric Johnson ........................ 832000 Charles Thomas ................... 442001 Alan Beck ............................ 562002 A. Beck/R. Schade .............. 582003 Alan Beck ............................ 682004 Tood Roper .......................... 602005 Jared Greenwood ................. 572006 Barrett Shaft ....................... 682007 Blake Murphy ...................... 732008 Nick Liles ............................ 582009 Nick Liles ............................ 662010 Matt Johns .......................... 652011 Matt Johns .......................... 552012 Ross Heffl ey ........................ 47

ANNUAL DOUBLES LEADERS1969 Four tied................................ 51970 Bruce West ............................ 71971 Tommy Hayes ...................... 201972 Bruce West ............................ 91973 Bruce West ............................ 51974 J.Stewart/B. Gilmore ............. 61975 Gary Fishel ............................ 91976 Buddy Fox ............................. 71977 David Ball ........................... 121978 Wayne Tolleson .................... 461979 B. Boyd/F. Brown .................. 71980 Willie Carpenter .................. 181981 Mel Kinsey .......................... 11

1982 Mel Kinsey .......................... 101983 Greg Johnson ...................... 131984 Charlie Fonville.................... 161985 Mike Carson ........................ 201986 Mike Carson .........................171987 Freddie Hailey ..................... 211988 Keith LeClair ........................ 151989 Matt Raleigh ....................... 151990 Rodney Tesh ........................ 201991 Joey Cox .............................. 181992 Joey Cox .............................. 211993 Mike Tidick .......................... 191994 Roy Hurst ............................ 201995 Jody Hansen ........................ 211996 Alex Tolbert ......................... 251997 Frankie Ward ....................... 191998 C. Moore/M. Barrow ............ 161999 Austin Smithwick ................. 192000 Morgan Frazier .................... 162001 A. Beck/R. Goldston............ 202002 Donovan Minero .................. 192003 Rod Goldston ...................... 262004 Jared Greenwood ................. 212005 Jared Greenwood ................. 152006 Shaft/Strausbaugh/Murphy 172007 Kenny Smith ........................ 242008 Nick Liles ............................ 192009 B. Greer/N. Liles ................. 222010 Matt Johns .......................... 192011 Ross Heffl ey ........................ 182012 Tyler White ........................... 16

ANNUAL TRIPLES LEADERS1969 Ed Thompson ........................ 31970 Ted Whitworth ....................... 31971 Tommy Hayes ........................ 31972 Eddie Davis ........................... 31973 Gary Rhyne ............................ 21974 G. Rhyne/G. Grindstaff .......... 11975 Jerry Gaines........................... 41976 Four tied................................ 21977 Freddy Brown ........................ 31978 M. Reeser/ W. Tolleson .......... 41979 David Ball ............................. 51980 Three tied .............................. 31981 J. Chamberlain/D. Hill ........... 21982 M. Kinsey/K. Carson ............. 31983 G. Johnson/M. Kinsey............ 31984 Freddie Hailey ....................... 61985 Jim Eldredge.......................... 51986 Ron Huntington ..................... 41987 Clint Fairey ............................ 21988 Keith LeCalir .......................... 21989 Bellomo/Fairey ..................... 21990 Todd Raleigh ......................... 41991 Matt Raleigh ......................... 51992 Mike Tidick ............................ 41993 Stephen Pritchard ................. 31994 J. Connolly/M. Striker ............ 41995 Jody Henson .......................... 31996 M. Barrow/M. Stillwell........... 31997 Martin Barrow ....................... 61998 Martin Barrow ....................... 51999 Tracy Biggs ............................ 72000 Jason Long ............................ 32001 Michael Roane ...................... 22002 Four tied................................ 22003 Todd Roper ............................ 42004 Todd Roper ............................ 32005 Brandon Zollman ................... 32006 Blake Murphy ........................ 42007 Kenny Smith .......................... 42008 Barrett Shaft ......................... 32009 J.C. Lyons .............................. 32010 Four tied................................ 22011 Heffl ey / Johns ...................... 22012 Bradley Strong ...................... 3

ANNUAL HOME RUNS LEADERS1959 Ray Sells ............................... 11960 Jim Ray ................................. 31961 Jim Ray ................................. 41962 Ken Morgan........................... 51963 Ken Morgan........................... 4

1964 Earl Crotts ............................. 31965 Cecil Caldwell ....................... 11966 Roddy Edwards ...................... 51967 Roddy Edwards ...................... 41968 Bill Wofford ........................... 31969 John Booth ............................ 21970 Steve Barkley ........................ 21971 Tommy Hayes ........................ 41972 E. Davis/J. Laughridge ........... 31973 B. Gilmore/G. Grindstaff ....... 21974 Ernie Lasher .......................... 31975 Buddy Fox ............................. 31976 Buddy Fox ............................. 31977 Keith Ebersole ....................... 61978 Keith Ebersole ....................... 91979 Freddy Brown ........................ 51980 Chet Gresson ......................... 41981 Mel Kinsey .......................... 151982 Hill/Reinicker ........................ 81983 Hill/Kinsey ............................ 71984 Charlie Fonville.................... 121985 Mike Carson ........................ 131986 P. Riley/M. Carson .............. 151987 Clint Fairey .......................... 191988 Clint Fairey .......................... 251989 Three Tied ........................... 141990 Grant Brittain ...................... 201991 Matt Raleigh ....................... 191992 Matt Raleigh ....................... 251993 Phillip Grundy .......................171994 Mike Tiddick ........................ 151995 Alex Tolbert ......................... 201996 Alex Tolbert ......................... 111997 Alex Tolbert ......................... 191998 Chris Moore......................... 141999 Steve Harris ......................... 262000 Rod Goldston ........................ 62001 Donovan Minero ...................172002 Donovan Minero .................. 152003 Alan Beck ............................ 182004 Jared Greenwood ................. 212005 Steven Strausbaugh ............ 122006 Steven Strausbaugh .............172007 Kenny Smith ........................ 202008 Blake Murphy ...................... 162009 Stephen Notaro ................... 132010 Trevor Collias ....................... 142011 Ross Heffl ey ........................ 112012 Ross Heffl ey .......................... 9

ANNUAL RBI LEADERS1959 Bob Ballance....................... 181960 Bob Ballance....................... 241961 Jim Ray ............................... 221962 Ken Morgan......................... 211963 Randy Whitaker ................... 161964 Earl Crotts ............................171965 D. Jones/J. Fraser .................171966 Roddy Edwards .................... 281967 Roddy Edwards .................... 281968 Bill Wofford ......................... 181969 Jim Thompson ..................... 141970 S. Barkley/B. West .............. 151971 Bruce West .......................... 251972 Jim Grove ............................ 261973 Bruce West .......................... 121974 Dale Fox ...............................171975 J. Gaines/G. Fishel ...............171976 Buddy Fox ........................... 291977 Keith Ebersole ..................... 481978 Keith Ebersole ..................... 451979 Freddy Brown ...................... 321980 Willie Carpenter .................. 431981 Mel Kinsey .......................... 501982 Mel Kinsey .......................... 441983 Mel Kinsey .......................... 451984 Charlie Fonville.....................511985 Mike Carson ........................ 561986 Mike Carson ........................ 721987 Skip Nelloms ....................... 701988 Skip Nelloms ....................... 691989 Matt Raleigh ....................... 521990 Grant Brittain ...................... 681991 Todd Raleigh ....................... 78



W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – A N N U A L C AT E G O R Y L E A D E R S

1992 Matt Raleigh ....................... 731993 Phillip Grundy ...................... 761994 Mike Tidick .......................... 581995 Alex Tolbert ......................... 551996 Alex Tolbert ......................... 661997 A. Tolbert/J.P. Burwell ......... 691998 Chris Moore......................... 681999 Chris Moore......................... 842000 Rod Goldston ...................... 402001 Donovan Minero ...................742002 Donovan Minero .................. 622003 Alan Beck ............................ 712004 Jared Greenwood ................. 632005 Steven Strausbaugh .............512006 Steven Strausbaugh ............ 642007 Kenny Smith ........................ 842008 Blake Murphy ...................... 572009 J.C. Lyons ............................ 622010 Ross Heffl ey ........................ 632011 Ross Heffl ey ........................ 652012 Jacob Hoyle ......................... 45

ANNUAL AT BATS LEADERS1969 Steve Barkley ...................... 991970 Steve Barkley ...................... 871971 Tommy Hayes .................... 1341972 Gary Fishel ........................ 1151973 Gary Fishel .......................... 881974 Jimmy Stewart ..................... 921975 Wayne Tolleson .................... 961976 Buddy Fox ......................... 1271977 Wayne Tolleson .................. 1281978 Keith Ebersole ................... 1331979 Billy Boyd .......................... 1071980 Chet Greeson .....................1471981 Don Ingle .......................... 1391982 David Hill .......................... 1391983 David Hill .......................... 1641984 Charlie Fonville...................1771985 David Hyatt ........................ 2501986 David Hyatt ........................ 2281987 Keith LeClair ...................... 2261988 Keith LeClair ...................... 2391989 Clint Fairey ........................ 1871990 Kevin Bellomo ................... 2091991 Kevin Bellomo ................... 2321992 Joey Cox ........................... 2521993 Rodney Hennon ................. 2661994 Roy Hurst .......................... 2461995 Alex Tolbert ........................2161996 Alex Tolbert ........................2171997 Chris Moore....................... 2571998 Martin Barrow ................... 2541999 Charles Thomas ................. 2442000 Charles Thomas ................. 2152001 Donovan Minero ................ 2192002 Ryan Schade ..................... 2262003 Wayne Kilmer .................... 2252004 Todd Roper ........................ 2492005 Steven Strausbaugh .......... 2182006 Barrett Shaft ..................... 2442007 Barrett Shaft ..................... 2552008 Nick Liles .......................... 2692009 Nick Liles .......................... 2592010 Ross Heffl ey ...................... 2382011 Ross Heffl ey ...................... 2292012 Ross Heffl ey ...................... 231

ANNUAL STOLEN BASES LEADERS1969 Tommy Hayes ........................ 71970 Steve Weams....................... 131971 Tommy Hayes ...................... 241972 Eddie Davis ......................... 151973 Gary Fishel .......................... 141974 Gary Fishel .......................... 131975 Jerry Gaines......................... 161976 Wayne Tolleson .................... 181977 Wayne Tolleson .................... 291978 Wayne Tolleson .................... 291979 Willie Carpenter .................. 111980 B. Boyd/K. Radford ..............171981 David Hill ............................ 151982 David Hill ............................ 211983 David Hill ............................ 19

1984 Alfred Turner ........................ 121985 David Hyatt .......................... 111986 Freddie Hailey ....................... 81987 Freddie Hailey ..................... 181988 Keith LeClair ........................ 121989 Grant Brittain ........................ 51990 K. Bellomo/G. Brittain ......... 211991 Matt Raleigh ....................... 201992 Matt Raleigh ....................... 231993 Mike Tidick ...........................171994 J. Henson/M. Tidick ............. 201995 Jody Henson ........................ 251996 Chris Moore......................... 151997 Chuck Koone ....................... 221998 Chuck Koone ....................... 351999 Eric Johnson ........................ 462000 Charles Thomas ................... 102001 Donovan Minero .................... 82002 Rod Goldston ........................ 92003 Wayne Kilmer ...................... 262004 Brandon Zollman ................... 72005 Chris Davis ............................ 52006 B. Murphy/G. Gregory ......... 122007 Kenny Smith ........................ 142008 B. Murphy/N. Liles .............. 222009 Trevor Collias ....................... 302010 Dylan de Graaf .................... 302011 Matt Johns .......................... 262012 Ross Heffl ey ........................ 16

ANNUAL ERA LEADERS1969 Noland Smathers ............. 2.051970 Noland Smathers ............. 3.331971 Don Bright ........................ 1.351972 Don Bright ........................ 1.091973 Don Bright ........................ 1.471974 Lester Wright .................... 2.651975 Jerry Reed ........................ 2.011976 Flip Watson ...................... 1.471977 Rick Adair......................... 1.871978 Wayne Harwell .................. 2.981979 Rick Adair......................... 1.591980 Randy Sims ...................... 4.241981 David Robinson ................ 1.701982 Randy Sims ...................... 2.561983 Greg Moore ...................... 3.681984 Scott Gay ......................... 2.101985 Scott Gay ......................... 3.971986 Andy Rickman .................. 4.751987 Ward Withrow ................... 1.321988 Ward Withrow ................... 3.541989 Stewart Keyes .................. 6.251990 Doug Udzilla ..................... 3.121991 Phillip Grundy ................... 3.871992 Dan Kyslinger ................... 0.851993 Phillip Grundy ................... 3.121994 Mike Manning .................. 0.971995 Clark Maxwell ................... 3.431996 Brian Bein ........................ 3.991997 Chris Waters ..................... 3.481998 Aaron Kirby....................... 1.621999 Wes Overbay ..................... 4.252000 Blake Gordon ................... 4.422001 Seth Foster ....................... 4.542002 Jared Burton .................... 3.762003 Derrick Hawk .................... 2.862004 Caleb McConnell .............. 4.392005 Caleb McConnell .............. 3.472006 Greg Holland .................... 2.512007 Drew Saberhagen ............. 2.872008 Chris Masters ................... 4.252009 Jason Sullivan .................. 2.422010 Brandon Johnson ............. 2.892011 Andrew Chilcoat ................2.142012 Preston Hatcher ............... 1.73

ANNUAL WINS LEADERS1969 L. Joyce/R. Miller................... 41970 N. Smathers/G. Glover .......... 31971 Wayne McCauley ................... 71972 Four Tied ............................... 31973 Don Bright ............................. 51974 Lester Wright ......................... 51975 Jerry Reed ............................. 6

1976 Mike Hicks ............................ 61977 Jerry Reed ........................... 101978 Rick Adair.............................. 71979 Rick Adair.............................. 61980 Lin Stadler ............................ 51981 D. Robinson/J. Mashburn ...... 51982 Four Tied ............................... 51983 David Robinson ..................... 71984 Scott Gay ............................ 101985 Scott Gay ............................ 121986 Keith Smith ......................... 101987 S. Keyes/J. Slaughter ............ 71988 Tim Sinicki ............................ 91989 Menhart/Volpe ..................... 51990 Jack Kimel ........................... 111991 Phillip Grundy ...................... 111992 Jack Kimel ........................... 101993 Jason Beverlin ..................... 121994 Jason Beverlin ..................... 111995 Clark Maxwell ........................ 81996 Clark Maxwell ........................ 71997 Mark DiFelice ...................... 101998 Mark DiFelice ...................... 111999 Aaron Kirby............................ 92000 Ryan Basner .......................... 42001 Dan Foley .............................. 72002 J. Burton/S. Foster ................ 72003 Derrick Hawk ....................... 102004 Brad Josey ............................. 52005 Brian McCullen...................... 72006 Tyler Sexton ........................... 82007 Drew Saberhagen .................. 92008 Chris Masters ........................ 82009 Tavernier/Martin ................... 72010 Johnson/Benedict ................. 92011 Jordan Smith ......................... 62012 M. McKinney/P. Hatcher ........ 6

ANNUAL K’S LEADERS1969 Roger Miller......................... 621970 Noland Smathers .................511971 Wayne McCauley ............... 1061972 Don Bright ........................... 801973 Don Bright ........................... 431974 Lester Wright ....................... 581975 Jerry Reed ........................... 601976 Flip Watson ......................... 651977 Rick Adair............................ 891978 Rick Adair.............................741979 Rick Adair............................ 751980 Randy Sims ..........................511981 Randy Sims ......................... 601982 Lin Stadler .......................... 421983 Ken Hare ............................. 501984 Scott Gay ............................ 691985 Scott Gay .......................... 1181986 Keith Smith ......................... 541987 Stewart Keyes ..................... 571988 Paul Menhart ...................... 681989 Paul Menhart ...................... 641990 Paul Menhart ...................... 821991 Phillip Grundy ...................... 911992 Phillip Grundy ...................... 891993 Jason Beverlin ................... 1061994 Jason Beverlin ................... 1541995 Clark Maxwell .................... 1241996 Clark Maxwell .................... 1011997 Clark Maxwell .................... 1021998 Mark DiFelice .................... 1101999 David Pember ...................... 762000 Ryan Basner ........................ 452001 Jared Burton ..................... 2672002 Jared Burton ..................... 1022003 Ryan Basner ........................ 912004 Brad Josey ........................... 662005 Caleb McConnell ................. 532006 Tyler Sexton ......................... 792007 Tyler Sexton ......................... 832008 Chris Masters ...................... 802009 Chris Masters ...................... 992010 Kyle Stewart ........................ 712011 Matt Benedict ..................... 702012 Jordan Smith ....................... 78

ANNUAL COMPLETE GMS LEADERS1974 Lester Wright ......................... 51975 M. Hicks/J. Reed ................... 31976 Jerry Reed ............................. 61977 Rick Adair.............................. 51978 Rick Adair.............................. 81979 Rick Adair.............................. 81980 Randy Sims ........................... 31981 Randy Sims ........................... 51982 Jeff Mashburn ....................... 31983 K. Hare/G. Moore .................. 51984 Ken Hare ............................... 41985 Scott Gay .............................. 71986 Keith Smith ........................... 51987 Jackie Slaughter .................... 51988 Paul Menhart ........................ 61989 Stewart Keyes ....................... 41990 Jack Kimel ............................ 41991 Phillip Grundy ........................ 91992 P. Grundy/J. Kimel ................. 81993 Phillip Grundy ........................ 41994 Jason Beverlin ....................... 41995 Clark Maxwell ........................ 61996 Mark DiFelice ........................ 41997 Clark Maxwell ........................ 41998 Mark DiFelice ........................ 41999 Pember/Overbay ................... 42000 Jared Burton ......................... 22001 J. Burton/D. Foley ................. 12002 Jared Burton ......................... 22003 R. Basner/B. Josey ................ 22004 Caleb McConnell ................... 22005 Caleb McConnell ................... 22006 N/A ....................................... 02007 Tyler Sexton ........................... 22008 Mike Tavernier ....................... 12009 Taverner/Masters .................. 12010 Jason Sullivan ....................... 22011 Jordan Smith ......................... 22012 Jordan Smith ......................... 1

ANNUAL INNINGS PITCHED LEADERS1972 Don Bright ........................ 72.01973 Glen Glover ...................... 48.01974 Lester Wright .................... 64.31975 Jerry Reed ........................ 72.01976 Jerry Reed ........................ 89.01977 Rick Adair..........................77.01978 Rick Adair......................... 72.01979 Rick Adair......................... 79.11980 Lin Stadler ....................... 66.11981 Randy Sims ...................... 75.11982 Greg Moore ...................... 62.01983 Ken Hare .......................... 75.01984 Ken Hare .......................... 93.11985 Scott Gay ....................... 113.11986 Keith Smith ...................... 84.21987 Jackie Slaughter ............... 81.21988 Paul Menhart ................... 84.11989 Paul Menhart ................... 86.11990 Jack Kimel .......................101.11991 Phillip Grundy ................. 100.11992 Phillip Grundy ..................110.11993 Jason Beverlin ................ 105.11994 Jason Beverlin ................ 124.11995 Clark Maxwell ................. 123.11996 Clark Maxwell ................... 85.01997 Clark Maxwell ................. 102.21998 Mark DiFelice ................... 98.01999 David Pember ................. 119.22000 Aaron Kirby....................... 68.12001 Jared Burton .................... 93.12002 Jared Burton .................. 103.02003 Ryan Basner ................... 125.02004 Brad Josey ...................... 101.02005 Brain Barnes .................... 58.02006 Tyler Sexton .......................91.12007 Drew Saberhagen ........... 106.22008 Drew Saberhagen ............. 79.22009 Chris Masters ................... 83.22010 Matt Benedict .................. 92.22011 Matt Benedict .................. 85.12012 Jordan Smith .................... 95.2



W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – H O N O R S

SOUTHERN CONFERENCEPLAYER OF THE YEAR

1978 ........................Wayne Tolleson 1981 ...............................Mel Kinsey 1985 .................................Scott Gay 1987 .............................. Clint Fairey 1988 .............................. Clint Fairey 1989 .............................. Clint Fairey 1990 .......................... Grant Brittain 1991 ......................... Kevin Bellomo 1992 ............................Matt Raleigh 1994 ..............................Mike Tidick 1997 ..............................Alex Tolbert 1998 ......................... Martin Barrow 1999 .............................Chris Moore 2002 ...................... Donovan Minero 2003 ................................ Alan Beck 2007 ............................ Kenny Smith

SOUTHERN CONFERENCEPITCHER OF THE YEAR

Awarded since 1989

1994 ......................... Jason Beverlin 1998 .......................... Mark DiFelice

SOUTHERN CONFERENCECOACH OF THE YEAR

1981 ............................Bill Haywood 1987 ............................ Jack Leggett 1992 ............................Keith LeClair 1994 ............................Keith LeClair 1997 ............................Keith LeClair 2002 ............................Todd Raleigh 2007 ............................Todd Raleigh

SOUTHERN CONFERENCEFRESHMAN OF THE YEAR

1983 ............................... Brian Tebo 1984 ..........................Freddie Hailey 1989 ............................Matt Raleigh 1990 ............................ Rob Doherty 1991 ..........................Phillip Grundy 2005 ................ Steven Strausbaugh 2009 .............................Ross Heffl ey

CATAMOUNTS ON THESOCON 75TH

ANNIVERSARY TEAM(24 Players Named in 1995)

Wayne Tolleson, Utility ................ 1st Jason Beverlin, P ......................... 1st Matt Raleigh, SS ........................ 2nd Phillip Grundy, 3B ...................... 2nd

ABCAALL-ATLANTIC REGION

1977 Keith Ebersole ................... 1st Jerry Reed ........................ 2nd Wayne Tolleson ................. 2nd1978 Wayne Tolleson .................. 1st Keith Ebersole .................. 2nd1980 Willie Carpenter ................ 1st1986 Pat Riley ........................... 2nd1987 Clint Fairey ........................ 1st1989 Clint Fairey ........................ 1st1990 Grant Brittain .................... 1st1991 Kevin Bellomo ................... 1st Phillip Grundy ................... 2nd Matt Raleigh .................... 2nd1992 Joey Cox ............................ 1st Matt Raleigh ..................... 1st Dan Kyslinger ................... 2nd1993 Phillip Grundy .................... 1st Jason Beverlin .................. 2nd1994 Jason Beverlin ................... 1st Mike Manning ................. 2nd Mike Tidick ....................... 2nd1995 Jody Henson ...................... 1st1996 Alex Tolbert ...................... 2nd1997 Alex Tolbert ....................... 1st Jeremy Bruce .................... 2nd J.P. Burwell ....................... 2nd1998 Martin Barrow .................. 2nd Mark DiFelice ................... 2nd1999 Steve Harris ...................... 2nd Chris Moore ..................... 2nd2001 Donovan Minero ................ 1st2003 Alan Beck ......................... 2nd2004 Jared Greenwood ............... 1st2005 Steven Strausbaugh ......... 2nd2006 Steven Strausbaugh ......... 2nd2007 Kenny Smith ..................... 2nd2012 Ross Heffl ey ..................... 2nd

ATLANTIC REGION COACH OF THE YEAR

1987 ............................ Jack Leggett

ACADEMIC ALL-AMERICA1983 David Hill .......................... 1st Greg Johnson .................... 1st1986 David Hyatt .......................3rd1992 Rodney Hennon ................. 1st Jack Kimel ........................ 2nd1993 Rodney Hennon ................. 1st2002 Ryan Schade ..................... 1st

COLLEGIATE BASEBALL FRESHMAN ALL-AMERICA

1991 ..........................Phillip Grundy 1996 .............................Chris Moore 2005 ................ Steven Strausbaugh 2009 .............................Ross Heffl ey 2012 ............................. Jacob Hoyle

ALL-NORTH CAROLINA1971 ...........................Tommy Hayes ............................. Wayne McCauley

1973 ............................... Don Bright 1975 .............................Jerry Gaines 1977 ......................... Keith Ebersole

........................................Jerry Reed ................................Wayne Tolleson

1978 ......................... Keith Ebersole ................................Wayne Tolleson

NCAA REGIONALALL-TOURNAMENT

1985 ............................... Brian Tebo ...................................Darryl Rogers

1987 ........................... Skip Nelloms 1992 ..........................Phillip Grundy

............................... Rodney Hennon ....................................Matt Raleigh

1993 ..........................Phillip Grundy 2003 .............................. Chris Davis

...................................Rod Goldston .......................... Brandon McDowell ...................................... Todd Roper

2007 .............................John Ingram .........................................Nick Liles ............................ Drew Saberhagen .................................... Kenny Smith ........................ Steven Strausbaugh

SOCON TOURNAMENT MOST VALUABLE

1985 ............................ Mike Carson 1986 ..............................David Hyatt 1987 .............................. Clint Fairey 1988 ............................Keith LeClair 1989 ...........................Paul Menhart 1992 .................................. Joey Cox 1993 ..........................Phillip Grundy 1997 .............................. J.P. Burwell 2003 ...........................Brian Sigmon

ALL-SOCON TOURNAMENT 1990 .......................... Grant Brittain

......................................Mike Hilton .................................... Rodney Tesh

1991 ......................... Kevin Bellomo .......................................... Joey Cox ....................................... Jack Kimel ....................................Matt Raleigh .................................... Rodney Tesh

1992 .................................. Joey Cox .....................................Scott Lyman .................................... Eric Whitson

1993 ......................... Jason Beverlin .................................... Rob Doherty ..................................Phillip Grundy .........................................Roy Hurst ......................................Mike Tidick

1994 .......................... John Connolly ......................................Mike Tidick .....................................Marc Striker

1995 ............................ Eric Whitson 1997 .............................. J.P. Burwell

...................................... Jeff Sziksai 2003 ............................ Ryan Basner

...................................... Chris Davis .....................................Matt Nelson ...................................Brian Sigmon

2004 .............................. Chris Davis 2006 .......................... Trey McDaniel 2009 ..............................Brent Greer 2010 ........................... Ollie Goulder

.......................................Matt Johns .............................Brandon Johnson

MARTIN BARROW (1995-98) was named theSouthern Conference Player of the Year in 1998.

KENNY SMITH is the most recent Catamount to garner top honors from the league, earning SoCon

Player of the Year accolades in 2007.

ALEX TOLBERT (1994-97) was a two-time home run champion and SoCon Player of the Year in 1997.




BRENTBRENTGREERGREER

CHARLESCHARLESTHOMASTHOMASPHILLIPPHILLIPGRUNDYGRUNDY

BLAKEBLAKEMURPHYMURPHYDREWDREWSABERHAGENSABERHAGENJONATHANJONATHANGREENEGREENE

PAULPAULMENHARTMENHART MATTMATT&&TODDTODDRALEIGHRALEIGH

1977 Wayne Tolleson ............. 1st Keith Ebersole .............. 1st1978 Keith Ebersole .............. 1st Wayne Tolleson ............. 1st1979 Willie Carpenter ............ 1st1980 Willie Carpenter ............ 1st Don Ingle ...................... 1st1981 Mel Kinsey .................... 1st1983 Charlie Fonville ............. 1st David Hill ...................... 1st Greg Johnson ................ 1st Brian Tebo, OF ............. 2nd1984 Mike Carson, OF ........... 1st Charlie Fonville, 1B ....... 1st Scott Gay, P .................. 1st David Hyatt, OF ............. 1st Brian Tevo, OF .............. 2nd John Pust, SS ............... 3nd Freddie Hailey, OF ........ 2nd1985 Mike Carson, OF ........... 1st Scott Gay, P .................. 1st Freddie Hailey, OF ......... 1st David Hyatt, OF ............. 1st Skip Nelloms, DH .......... 1st1986 Mike Carson, OF ........... 1st Freddie Hailey, OF ......... 1st Pat Riley, DH ................. 1st

1987 Clint Fairey, DH ............. 1st Freddie Hailey, OF ......... 1st Stewart Keyes, P ........... 1st Skip Nelloms, OF .......... 1st1988 Clint Fairey, 1B ............. 1st Keith LeClair, OF ........... 1st Tom Malchesky, 3B ....... 1st Paul Menhart, P ............ 1st Skip Nelloms, OF .......... 1st1989 Clint Fairey, 1B ............. 1st Mark Poarch, DH........... 1st Matt Raleigh, 3B .......... 2nd1990 Grant Brittain, 2B ......... 1st Matt Raleigh, 3B ........... 1st Jack Kimel, P ............... 2nd Todd Raleigh, C ............ 2nd Kevin Bellomo, OF ........ 2nd1991 Kevin Bellomo, OF ......... 1st Phillip Grundy, P ........... 1st Matt Raleigh, 3B ........... 1st Todd Raleigh, C ............. 1st Rodney Tesh, 1B ........... 1st1992 Joey Cox, OF.................. 1st Matt Raleigh, SS ........... 1st Phillip Grundy, P & DH.. 2nd Rodney Hennon, 2B ..... 2nd Roy Hurst, C ................. 2nd Jack Kimel, P ............... 2nd Scott Lyman, OF ........... 2nd

1993 Jason Beverlin, P ........... 1st Phillip Grundy, DH ......... 1st Rodney Hennon, 2B ...... 1st Scott Lyman, OF ............ 1st1994 Jason Beverlin, P ........... 1st Mike Tidick, OF ............. 1st Mike Manning, P .......... 2nd Roy Hurst, C ................. 2nd Jody Henson, OF .......... 2nd1995 Jody Henson, OF ........... 1st Alex Tolbert, 1B ............ 1st Eric Whitson, 3B ........... 1st J.P. Burwell, C .............. 2nd1996 Brian Bain, P................ 2nd Alex Tolbert, 1B ........... 2nd Chris Moore, 3B ........... 2nd1997 Martin Barrow, OF ......... 1st Alex Tolbert, 1B ............ 1st Mark DiFelice, P........... 2nd J.P. Burwell, C .............. 2nd Jeff Sziksai, 2B ............ 2nd Chris Moore, SS ........... 2nd Jeremy Bruce, 3B ......... 2nd Matt Stillwell, OF ......... 2nd1998 Martin Barrow, OF ......... 1st Mark DiFelice, P............ 1st Chris Moore, SS ............ 1st Frankie Ward, C ........... 2nd

WCU ALL-SOUTHERN CONFERENCE SELECTIONS1999 Chris Moore, SS ............ 1st Eric Johnson, OF ........... 1st Charles Thomas, OF ...... 1st Steve Harris, 1B ........... 2nd2000 Charles, Thomas, OF .... 2nd2001 Alan Beck, OF ............... 1st Donovan Minero, OF ..... 1st2002 Todd Buchanan, 1B ...... 1st Donovan Minero, CF...... 1st Ryan Schade, SS .......... 1st Alan Beck, OF .............. 2nd Chris Davis, DH ............ 2nd2003 Alan Beck, OF ............... 1st Rod Goldston, OF .......... 1st Derrick Hawk, P ............ 1st Todd Buchanan, 1B ..... 2nd Wayne Kilmer, SS ......... 2nd Ryan Basner, P............. 2nd2005 Steven Strausbaugh, OF 2nd2006 Jonathan Greene, 3B .... 1st Steven Strausbaugh, OF 1st Blake Murphy, C .......... 2nd

2007 Greg Holland, P ............. 1st Blake Murphy, C ........... 1st Drew Saberhagen, P ..... 1st Barrett Shaft, CF ........... 1st Kenny Smith, 2B ........... 1st Jonathan Greene, OF ..... 1st John Ingram, 1B........... 2nd Steven Strausbaugh, RF 2nd2008 Blake Murphy, C ........... 1st Nick Liles, 2B............... 2nd Mike Tavernier, P .......... 2nd2009 Brent Greer, SS ............. 1st2010 Matt Benedict, P .......... 2nd Trevor Collias, OF ......... 2nd2011 Ross Heffl ey, 2B ............ 1st Stephen Notaro, DH ...... 1st Austin Schultz, 3B........ 2nd Aaron Attaway ............... Fr. Adam Martin ................. Fr.2012 Ross Heffl ey, 2B ............ 1st Preston Hatcher, P ........ 1st Jacob Hoyle, DH ......2nd, Fr. Jeremy Null, P ................ Fr. Bradley Strong, 3B......... Fr.



1991 PITCHER Phillip Grundy Week 2 PLAYER Kevin Bellomo Week 2 Todd Raleigh Week 31992 PLAYER Joey Cox Week 21993 PLAYER Phillip Grundy Week 1 Rodney Hennon Week 4 Phillip Grundy Week 5 Mike Tidick Week 61994 PITCHER Jason Beverlin Week 1 Jason Beverlin Week 2 PLAYER Roy Hurst Week 5 Mike Tidick Week 71995 PITCHER Dale Pilgrim Week 1 Clark Maxwell Week 4 Clark Maxwell Week 6 Mark DiFelice Week 8 PLAYER Jody Henson Week 1 Jody Henson Week 11996 PITCHER Clark Maxwell Week 4 Brian Bain week 6 PLAYER Alex Tolbert Week 11997 PITCHER Mark DiFelice Week 1 PLAYER Jeremy Barrow Week 5 Martin Barrow Week 61998 PLAYER Chuck Koone Week 1 Charles Thomas Week 21999 PLAYER Charles Thomas Week 7 Eric Johnson Week 102000 PITCHER Jared Burton Week 12001 PITCHER Ryan Basner Week 5 Dan Foley Week 12 Players Alan Beck Week 1 Donovan Minero Week 72002 PITCHER Jared Burton Week 5 PLAYER Ryan Schade Week 1 Donovan Minero Week 7 Todd Roper Week 8 Donovan Minero Week 9 Donovan Minero Week 4

W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – I N T H E S O C O N R E C O R D B O O KS

SOCON WEEKLY AWARD WINNERS2003 PITCHER Ryan Basner Week 4 PLAYER Todd Buchanan co-Week 7 Alan Beck co-Week 7 Rod Goldston Week 9 Alan Beck Week 112004 PITCHER Brian McCullen Week 13 PLAYER Alex Gary Week 32005 PITCHER Brian Barnes Week 72006 PITCHER Tyler Sexton Week 4 Greg Holland Week 12 PLAYER Steven Strausbaugh Week 5 Trey McDaniel Week 6 Jonathan Greene Week 142007 PITCHER Greg Holland Week 11 Chris Masters Week 12 Tyler Sexton Week 13 PLAYER Kenny Smith Week 2 John Ingram Week 5 Barrett Shaft Week 8 Kenny Smith Week 142008 PITHCER Chris Masters Week 6 Chris Masters Week 10 Chris Masters Week 122009 PITCHER Daniel Ottone March 2 Chris Masters March 23 Corey Martin April 13 Chris Masters May 4 PLAYER Stephen Notaro March 232010 PITCHER Jason Sullivan March 8 PLAYER Tyler Kirkpatrick April 122011 PLAYER Ross Heffl ey Feb. 21 Stephen Notaro April 25 Ross Heffl ey May 232012 PLAYER Ross Heffl ey March 12 PITCHER Jordan Smith May 14

SOCON ANNUALINDIVIDUAL

HITTING LEADERSBATTING AVERAGE

1977 Keith Ebersole .4231987 Clint Fairey .4051990 Grant Brittain .4441991 Kevin Bellomo .4351995 Jody Henson .4011996 Akex Tolbert .4241997 Jeremy Bruce .4011999 Charles Thomas .4062011 Ross Heffl ey .419

HOME RUNS1987 Clint Fairey 191988 Clint Fairey 251989 Clint Fairey 14 Mark Poarch 141990 Grant Brittain 201991 Matt Raleigh 191992 Matt Raleigh 251994 Mike Tidick 151995 Alex Tolbert 201997 Alex Tolbert 191999 Steve Harris 262001 Donovan Minero 172002 Donovan Minero 152003 Alan Beck 182004 Jared Greenwood 212006 Steven Strausbaugh 17

RUNS BATTED IN1977 Keith Ebersole 481986 Mike Carson 721987 Skip Nelloms 671988 Skip Nelloms 691991 Todd Raleigh 781992 Todd Raleigh 731993 Phillip Grundy 661994 Mike Tidick 581999 Chris Moore 842003 Alan Beck 712006 Steven Strausbaugh 642007 Kenny Smith 84

DOUBLES1964 Bill Marovic 101978 Fred Brown 141980 Willie Carpenter 181985 Mike Carson 201987 Freddie Hailey 211990 Rodney Tesh 201991 Joey Cox 181992 Joey Cox 211993 Mike Tidick 201994 Roy Hurst 201996 Alex Tolbert 252003 Rod Goldston 26

TRIPLES1984 Freddie Hailey 61985 Jim Eldredge 41986 Ron Huntington 41990 Todd Raleigh 41991 Matt Raleigh 51999 Tracy Biggs 7

SOCON ANNUALINDIVIDUAL

PITCHING LEADERSWINS

1977 Jerry Reed 101985 Scott Gay 121986 Keith Smith 101990 Jack Kimel 101992 Jack Kimel 101993 Jason Beverlin 121994 Jason Beverlin 111997 Mark DiFelice 101998 Mark DiFelice 11

EARNED RUN AVERAGE1988 Paul Menhart 3.552007 Drew Saberhagen 2.87

STRIKEOUTS1984 Scott Gay 621985 Scott Gay 1181989 Paul Menhart 641990 Paul Menhart 821993 Jason Beverlin 1061994 Jason Beverlin 154

SOCON ANNUALTEAM LEADERS

RUNS BATTED IN

1977 .3221980 .3241987 .3141990 .3141991 .3301992 .3201994 .2951997 .3511999 .3282001 .3112002 .334

TOTAL HOME RUNS1977 371984 361988 1121989 701990 651991 671992 871993 671997 1001998 551999 822002 562003 582004 66

FIELDING1986 .9521989 .961

EARNED RUN AVERAGE1988 4.291994 2.971998 4.032007 4.79

STRIKEOUTS1984 2191990 3391991 3751992 4461993 396

CLINT FAIREY led the Southern Conference in home runs forthree-consecutive seasons with 19 in 1987, 25 in 1988 and was

tied with teammate MARK POARCH with 14 in 1989.



W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – A C A D E M I C H O N O R S

RYAN SCHADE (2000-02) earned fi rst team AcademicAll-America thanks to a 3.881 GPA in Sport Management.

TYLER SEXTON (above) and TYLER KIRKPATRICK (below) both earned ESPN the Magazine

Academic All-District III honors

RODNEY HENNON (left) and JACK KIMEL (right) were named GTE Academic

All-Americans during the 1992 season. Hennon, a fi rst team selection, had a 3.79 GPA

in business and Kimel, a second team honoree, had a 3.55 GPA in economics.

W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – A L L - A M E R I C A S E L E C T I O N S

GAINES’ CAREER STATISTICSYear G AB R H 2B 3B HR RBI SB BB SO AVG.1975 24 94 22 38 4 4 1 17 16 13 16 .404TOTALS 24 94 22 38 4 4 1 17 16 13 16 .404

#4 – JERRY GAINES

5-9, 160 lbs., Outfi eldChesapeake, Va. – Western Branch HS

• 1975 ABCA College Division (First Team) •

EBERSOLE’S CAREER STATISTICSYear G AB R H 2B 3B HR RBI SB BB SO AVG.1977 30 111 37 47 11 2 6 48 3 22 9 .4231978 34 133 38 51 11 3 9 45 0 15 17 .384TOTALS 64 244 75 98 22 5 15 93 1 37 26 .401

#15 / 26 – KEITH EBERSOLE

6-2, 188 lbs., First BasemanSarasota, Fla. – Sarasota HS

• 1977 ABCA (Third Team) •

FAIREY’S CAREER STATISTICSYear G AB R H 2B 3B HR RBI SB BB SO AVG.1986 52 153 39 65 9 0 3 30 3 28 6 .4251987 54 190 53 77 13 2 19 60 3 41 10 .4051988 59 207 56 73 7 0 25 64 2 38 16 .3531989 53 187 38 69 10 2 14 45 1 28 9 .369TOTALS 218 737 186 284 39 4 61 199 9 135 41 .385

#37 – CLINT FAIREY

5-10, 210 lbs., Third BaseClemson, S.C. – D.W. Daniel HS

• 1987 ABCA (Second Team) •

BRITTAIN’S CAREER STATISTICSYear G AB R H 2B 3B HR RBI SB BB SO AVG.1987 49 136 32 34 5 1 4 22 2 36 22 .2501988 61 192 31 43 9 0 6 28 3 21 27 .2241989 50 135 30 26 7 1 2 14 5 44 27 .1931990 58 180 67 77 14 2 20 68 21 49 44 .428TOTALS 218 643 160 180 35 4 32 132 31 150 120 .279

#1 – GRANT BRITTAIN

6-0, 173, Second Base/ShortstopHickory, N.C. – Hickory HS

• 1990 ABCA (First Team) •




MINERO’S CAREER STATISTICSYear G AB R H 2B 3B HR RBI SB BB SO AVG.2001 56 219 49 83 12 0 17 74 8 19 34 .3792002 56 222 48 83 19 0 15 62 2 22 25 .374TOTALS 114 441 97 166 31 0 32 136 10 41 60 .376

BELLOMO’S CAREER STATISTICSYear G AB R H 2B 3B HR RBI SB BB SO AVG.1988 43 72 21 26 7 2 3 15 1 7 14 .3561989 54 183 31 49 6 2 8 23 4 24 36 .2681990 56 209 64 70 18 3 12 46 21 35 24 .3351991 60 232 77 101 12 1 14 59 17 22 22 .435TOTALS 123 696 193 246 44 8 37 143 43 88 96 .353

#25 – KEVIN BELLOMO

6-0, 190, Outfi eldRutland, Vt. - Rutland HS


RALEIGH’S CAREER STATISTICSYear G AB R H 2B 3B HR RBI SB BB SO AVG.1989 54 183 53 62 15 0 14 52 0 43 41 .3391990 60 202 53 60 12 3 10 47 4 41 49 .3971991 62 223 68 92 15 5 19 67 20 39 45 .4131992 66 229 77 88 14 0 25 73 23 59 66 .384TOTALS 242 837 251 302 56 8 68 239 47 182 201 .361

#34 – MATT RALEIGH

5-11, 195 lbs., Third BaseSwanton, Vt. - Swanton HS

• 1992 Collegiate Baseball (2nd Team) •

GRUNDY’S CAREER STATISTICSYear G GS CG IP H R ER ERA SO BB W-L PCT.1991 16 15 9 100.1 97 56 43 3.87 91 51 11-4 .7331992 16 16 8 110.1 92 47 29 2.31 89 33 9-5 .6421993 16 12 4 83.2 71 46 29 3.12 83 37 4-7 .363TOTALS 48 28 21 244.1 260 149 101 3.09 180 121 24-16 .600

#21 – PHILLIP GRUNDY

6-2, 190 lbs., Right Handed Pitcher / UtilitySomerset, Ky. - Somerset HS


BEVERLIN’S CAREER STATISTICSYear G GS CG IP H R ER ERA SO BB W-L PCT.1992 14 8 2 55.1 76 50 41 6.67 46 25 4-3 .5711993 18 16 3 105.1 105 59 46 3.93 106 55 12-2 .8571994 17 16 4 124.1 99 37 33 2.39 154 55 11-4 .733Tot. 49 40 9 285.0 280 146 120 3.38 306 135 27-9 .750

#40 – JASON BEVERLIN6-4, 230 lbs., Right Handed Pitcher

Royal Oak, Mich. – Dondero HS

• 1994 ABCA (Second Team) •• 1994 Baseball America (Second Team) •

• 1994 NCBWA (Second Team) •• 1994 Collegiate Baseball (Third Team) •

MOORE’S CAREER STATISTICSYear G AB R H 2B 3B HR RBI SB BB SO AVG.1996 43 166 37 62 19 2 5 39 2 11 24 .3731997 62 257 69 95 17 5 10 65 5 30 29 .3701998 55 187 62 66 16 0 14 66 12 62 34 .3531999 60 227 72 88 16 1 21 84 7 41 31 .388TOTALS 220 837 240 311 68 8 50 254 26 144 118 .372

#9 – CHRIS MOORE

5-11, 185, ShortstopWilmington, N.C. – New Hanover HS

• 1999 Collegiate Baseball (Third Team) •

#4 – DONOVAN MINERO

6-2, 190, Outfi elderSan Jose, Calif. - San Jose State

• 2001 ABCA (Third Team) •

RAL

EIG

HR

ALEI

GH

GR

UN

DY

GR

UN

DY

BEV

ERLI

NB

EVER

LIN

MIN

ERO

MIN

ERO



W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – S O U T H E R N C O N F E R E N C E T O U R N A M E N T

Year Site Opponent W / L WCU OPP

1984 Cullowhee VMI W 10 71984 Cullowhee Appalachian State L 5 91984 Cullowhee The Citadel L 0 8

1985 Boone Appalachian State W 3 21985 Boone Marshall L 2 51985 Boone Davidson W 13 21985 Boone Marshall W 12 61985 Boone Marshall W 13 12

1986 Cullowhee East Tennessee State W 11 21986 Cullowhee Appalachian State W 18 171986 Cullowhee Appalachian State W 11 8

1987 Asheville VMI W 16 41987 Asheville Appalachian State W 8 71987 Asheville VMI W 9 4

1988 Asheville Appalachian State W 18 81988 Asheville The Citadel W 6 21988 Asheville The Citadel W 22 6

1989 Asheville Appalachian State W 7 21989 Asheville Marshall W 4 2

1990 Charleston East Tennessee State W 6 11990 Charleston Marshall L 1 31990 Charleston Appalachian State W 5 41990 Charleston Marshall W 11 31990 Charleston The Citadel L 5 9

1991 Charleston VMI W 18 21991 Charleston East Tennessee State L 4 71991 Charleston The Citadel W 7 31991 Charleston East Tennessee State W 9 41991 Charleston Appalachian State W 4 01991 Charleston Furman L 11 9

1992 Charleston VMI W 3 21992 Charleston The Citadel W 2 11992 Charleston Georgia Southern W 17 101992 Charleston Georgia Southern L 12 141992 Charleston Georgia Southern W 4 3


1993 Charleston Marshall W 7 61993 Charleston The Citadel W 4 21993 Charleston VMI L 3 41993 Charleston Georgia Southern W 6 51993 Charleston VMI W 12 51993 Charleston VMI W 5 1

1994 Charleston Davidson L 1 21994 Charleston East Tennessee State W 4 21994 Charleston Marshall W 8 21994 Charleston Davidson W 13 11994 Charleston VMI W 7 11994 Charleston The Citadel L 2 4

1995 Charleston Appalachian State W 9 51995 Charleston Georgia Southern L 4 101995 Charleston Marshall W 10 31995 Charleston East Tennessee State L 1 6

1996 Charleston VMI L 3 71996 Charleston Furman L 4 7

1997 Charleston VMI W 4 31997 Charleston Furman W 7 11997 Charleston The Citadel W 10 31997 Charleston Furman W (10) 10 9

1998 Charleston Georgia Southern W 6 51998 Charleston The Citadel L 0 51998 Charleston Wofford W 9 41998 Charleston Furman W 2 11998 Charleston UNC Greensboro L 2 4

1999 Charleston Georgia Southern L 5 81999 Charleston VMI W 8 41999 Charleston East Tennessee State W 7 51999 Charleston Furman W 11 41999 Charleston College of Charleston W 3 21999 Charleston The Citadel L 3 6

2001 Charleston UNC Greensboro L 5 72001 Charleston College of Charleston L 7 9

2002 Charleston Wofford W 9 22002 Charleston College of Charleston L 0 32002 Charleston UNC Greensboro L (10) 4 6

IN THE SOCON TOURNAMENT,WCU’S RECORD VS.

Appalachian State .................................10-3The Citadel ............................................8-10College of Charleston ..............................4-6Davidson .................................................4-1East Tennessee State * ............................5-2Elon ........................................................2-1Furman ...................................................6-4Georgia Southern ....................................8-7Marshall * ..............................................7-2Samford..................................................0-1UNC Greensboro......................................0-3VMI * ....................................................10-2Wofford ..................................................2-0

WESTERN CAROLINA’S RECORD AT Site Record Years Titles Asheville 8-0 3 3 Boone 4-1 1 1 Charleston 49-35 20 4 Cullowhee 4-2 2 1 Greenville 1-4 2 0 TOTALS 66-42 28 9

W E S T E R N C A R O L I N A I N S O C O N T O U R N A M E N T R E C O R D B O O K

INDIVIDIUAL GAME BATTINGMost At Bats: ............................................................10 – two tied Aaron Attaway vs. Elon, 2011 Ross Heffl ey vs. Elon, 2011Most Hits: ....................................... 6 – Tyler White vs. Elon, 2011Most Doubles: ............................................................. 3 – fi ve tied Dave Piela vs. The Citadel, 1988Most Triples: .................................................................2 - two tied Matt Raleigh vs. VMI, 1991Most Total Bases: ....................................................... 11 – six tied Jim Eldridge vs. Appalachian State, 1986Most RBI:...................................................................... 6 – six tied Skip Nelloms vs. Appalachian State, 1988Highest Batting Average: .......................................1.000 – two tied John Connolly vs. Davidson (5-for-5), 1994

INDIVIDIUAL GAME PITCHINGFewest Hits (min. 9 inn.): .............................................2 – two tied Derek Cockrell vs. VMI, 1993Fewest Walks (min. 9 inn.): ........................................0 – seven tied Mark DiFelice vs. Furman, 1997 Phillip Grundy vs. The Citadel, 1992

INDIVIDIUAL TOURNAMENT BATTINGMost Doubles: .............................................................5 – two tied Joey Cox, 1991Most Triples: ................................................................. 2 – 13 tied Mike Tidick, 1994 Matt Raleigh, 1991

INDIVIDIUAL TOURNAMENT PITCHINGMost Appearances: ....................................................... 5 – six tied Doug Udzilla, 1990Most Wins: .................................................3, Jason Beverlin, 1993Lowest ERA (min 9 inn.): ........................................... 0.00 – 11 tied Ryan Basner (10 IP), 2003; Andy Rickman (9.1 IP), 1985Fewest Walks (min 9 inn.): ............................................... 0 – 7 tied Brad Josey (10.2 IP), 2004; Mark DiFelice (9.0 IP), 1997 Phillip Grundy, 1992

TEAM GAME BATTINGMost At Bats: ..................................... 78 – vs. Elon, 2011 (20 inn.)Most Hits: ..............................................24 – vs. The Citadel, 1988 Most Runs: ........................................... 22 – vs. The Citadel, 1988Most Doubles: .......................................................... 8 – three tied vs. The Citadel, 1988Most Triples: ............................................................. 3 – three tied vs. VMI, 1991Most Home Runs: .....................................7 – vs. The Citadel, 1988 Most Total Bases: ................................. 54 – vs. The Citadel, 1988Most RBI:................................................................ 21 – three tied vs. The Citadel, 1988

TEAM TOURNAMENT BATTINGMost Walks ........................................... 29 – two tied (WCU, 1985)Most Doubles: .............................................................. 17 in 1991Most Home Runs: ..........................................................14 in 1988Longest Game: ..............................20 innings (WCU vs. Elon, 2011)Largest Defi cit Overcome for Victory: ....9 runs (WCU vs. ASU, 1993)Most Combined Runs Scored: ........... 35 runs (WCU vs. ASU, 1986)


2003 Charleston Davidson W 14 02003 Charleston Furman W 6 02003 Charleston Georgia Southern W 1 02003 Charleston Georgia Southern L 8 42003 Charleston Georgia Southern W (11) 6 5

2004 Charleston College of Charleston W 4 32004 Charleston Elon W 7 62004 Charleston The Citadel W 5 22004 Charleston The Citadel L 2 92004 Charleston The Citadel L 1 8

2005 Charleston The Citadel W 6 12005 Charleston Georgia Southern L 2 72005 Charleston College of Charleston L 4 11

2006 Charleston Furman W 14 12006 Charleston College of Charleston L 0 12006 Charleston Georgia Southern W 13 32006 Charleston The Citadel L 2 4

2007 Charleston The Citadel L 2 72007 Charleston Georgia Southern L 5 6

2008 Charleston Davidson (11) W 11 102008 Charleston College of Charleston L 4 52008 Charleston Appalachian State L 5 10

2009 Greenville College of Charleston W 12 42009 Greenville Elon L 7 152009 Greenville Furman L 6 7

2010 Charleston Georgia Southern W 11 42010 Charleston Col. of Charleston (12) W 7 62010 Charleston Appalachian State L 2 32010 Charleston Appalachian State W 7 62010 Charleston The Citadel L 3 10

2011 Charleston Elon (20) W 10 72011 Charleston Georgia Southern L 1 122011 Charleston College of Charleston L 2 4

2012 Greenville Samford L 0 72012 Greenville Furman L 8 9



W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – N C A A T O U R N A M E N T

1985 NCAA EAST REGIONALSite: Columbia, S.C. Opponent W/L WCU OPP Old Dominion W 5 3 LaSalle L 2 6 St. John’s W 9 6 South Carolina L 3 14

1986 NCAA ATLANTIC REGIONALSite: Coral Gables, Fla. Opponent W/L WCU OPP Miami (Fla.) L 8 10 Georgia Tech L (11) 7 8

1987 NCAA MID-EAST REGIONALSite: Starkville, Miss. Opponent W/L WCU OPP Oklahoma State L 3 6 Purdue W 8 7 Mississippi State W 8 1 Oklahoma State L 6 9

1988 NCAA SOUTH REGIONALSite: Starkville, Miss. Opponent W/L WCU OPP Mississippi State L 4 7 Texas A&M L 6 8

1989 NCAA SOUTH REGIONALSite: Starkville, Miss. Opponent W/L WCU OPP Mississippi State L 0 8 Indiana State L 3 10

1992 NCAA SOUTH II REGIONALSite: Tallahassee, Fla. Opponent W/L WCU OPP Florida State W 1 0 Kent State W 14 1 Stanford W 5 0 Florida State L 3 4 Florida State L 3 18 (Runner-up in NCAA South II Regional)

1993 NCAA SOUTH REGIONALSite: Baton Rouge, La. Opponent W/L WCU OPP Louisiana State L 2 7 Miami (Fla.) W 10 5 Kent State L 5 8

1994 NCAA MIDEAST REGIONALSite: Knoxville, Tenn. Opponent W/L WCU OPP Arizona State L 6 8 Tennessee L 4 6

1997 NCAA EAST REGIONALSite: Tallahassee, Fla. Opponent W/L WCU OPP Auburn L 3 11 Marist W 8 3 South Florida L 4 9

2003 NCAA WILSON REGIONALSite: Wilson, N.C. Opponent W/L WCU OPP Va. Commonwealth L 6 0 Lemoyne W 9 5 Va. Commonweath W 2 0 N.C. State L (14) 6 4 (Runner-up in NCAA Wilson Regional)

2007 NCAA CHAPEL HILL REGIONALSite: Chapel Hill, N.C. Opponent W/L WCU OPP East Carolina L 8 9 Jacksonville W 7 0 East Carolina W 9 5 North Carolina L 5 6 (Runner-up in NCAA Chapel Hill Regional)

1987 Southern Conference Regular Season and Tournament Champions


1993 Southern Conference Tournament Champions


1994 Southern Conference Regular Season Champions






W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – C ATA M O U N T H E A D C O A C H E S

CATAMOUNT HEAD BASEBALL COACHES(Records prior to 1951 are incomplete)

– First year of baseball at WCU was 1928 –

HEAD COACH YRS SEASONS OVERALL SOCONJim Gudger 11 1951-60, ‘63 140-83 --Charles Seeger 2 1961-62 20-21 --Ron Blackburn 5 1964-68 78-65 --Bill Haywood 13 1969-81 215-161-2 48-23David Wright 1 1982 28-12 12-4Jack Leggett 9 1983-91 302-226 103-39Keith LeClair 6 1992-97 229-135-2 99-38Rodney Hennon 2 1998-99 81-38 38-16Todd Raleigh 7 2000-07 257-209 132-101Bobby Moranda 5 2008-pres. 156-126-2 61-54-1TOTALS 61 1,506-1,076-6 509-325-2

Jim Gudger (above) served as WCU’s head coach from 1951 through 1960 and again in 1963, winning 140 games ... Gudger was also Western’s head men’s basketball coach and is the program’s all-time winningest head coach.

The 1981 Southern Conference Coach of the Year, Bill Hay-wood held the reigns of the Western Carolina baseball pro-gram longer than any other coach ... He won 215 games in 13 seasons in Cullowhee.

Rodney Hennon was an Academic All-American at WCU in 1992, returning to coach the Catamounts for two seasons in 1998-99 ... Compiled 81 victories in two seasons and led WCU to the SoCon title game in ‘99.

Todd Raleigh was named Southern Conference Coach of the Year in 2002 and 2007, as well as having played at WCU from 1988-91 under Jack Leggett ... Raleigh won 257 games as head coach, the second-most in school history.

Bobby Moranda became the 10th different head coach in WCU baseball since 1951 ... He took over for Todd Raleigh, who took the head coaching job at Tennessee after the 2007 season, leading WCU to SoCon title game in 2010.

Jack Leggett is WCU’s all-time winningest head coach with 302 career wins ... He was named SoCon Coach of the Year in 1987 and won a total of 10 conference titles and took the Catamounts to fi ve NCAA tournament appearances.

Keith LeClair was an outstanding player for WCU from 1985-88 and took over as head coach in 1992 ... LeClair won 229 games in six seasons with three SoCon Coach of the Year honors, six SoCon titles and four NCAA tournament berths.



W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – C ATA M O U N T H E A D C O A C H E S

FORMER CATAMOUNT BASEBALL PLAYERS IN COACHING RANKS:Alan Beck – Assistant Baseball, Western Carolina

Jason Beverlin – Head Baseball, Bethune-CookmanRodney Hennon – Head Baseball, Georgia SouthernChris Moore – Assistant Baseball, Georgia Southern

Drew Saberhagen – Volunteer Assistant Baseball, TennesseeBarrett Shaft – Assistant Baseball, Bethune-Cookman

Keith Shumate – Head Baseball, NC A&TTim Sinicki – Head Baseball, Binghamton (NY) University

Tommy Smith – Head Coach, UNC AshevilleKenny Smith – Assistant Baseball, Bethune-CookmanJeff Sziksai – Head Baseball Coach, Lincoln Memorial

PROFESSIONAL LEVEL:Rick Adair – Pitching Coach, Seattle Mariners

Mike Tidick – Scout

Bobby Moranda (right) with former Catamount skipper, Jack Leggett (left), prior to a 2007 meeting between Clemson and Western Carolina in Cullowhee.

Bobby Moranda (right) with former Catamount head coach, Todd Raleigh (left), prior to a 2007 meeting between Western Carolina and Tennessee in Knoxville.

Jack Leggett (left) meets with umpires and former player turned coach, Rodney Hennon, at home plate prior to a Clemson-Western Carolina match-up in 1998.

Former player-coach tandem Jack Leggett (left) and Todd Raleigh (right) meet as head coaches prior to a Clemson-Western Carolina game in Cullowhee in 2000.

Todd Raleigh (left) receives instruction from head coach Jack Leggett (right) during his playing days in Cullowhee. Raleigh ranks second only to Leggett in career wins at WCU.



W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – A L L - T I M E Y E A R - B Y - Y E A R R E S U LT S

1969 – 11-15 overallHead Coach: Bill Haywood, 1st season (11-15)

at Erskine % L 0 9 at Armstrong State W 7 0 Guilford W 6 2 at Elon W 3 1 at Elon W 4 2 Salem L 5 7 Salem L 5 14 Appalachian State L 3 4 Appalachian State L 1 3 Mars Hill W 10 4 at Catawba L 6 8 at Catawba W 4 2 Pfeiffer L 5 7 Pfeiffer W 11 8 at Newberry W 13 2 Lenoir-Rhyne W 5 4 Lenoir-Rhyne W 7 0 at Mars Hill L 2 7 Erskine L 4 12 Atlantic Christian L 2 6 Atlantic Christian L 4 6 at High Point L 2 5 at High Point L 0 20 at Newberry W 2 0 vs. High Point * L 1 5 vs. Catawba * L 1 2

% – Forfeit game by WCU* – Carolinas Conference Tournament

1970 – 9-12 overallHead Coach: Bill Haywood, 2nd season (20-27)

at Armstrong State W 5 4 at Armstrong State L 5 7 vs. Lehigh W 6 3 at Georgia Southern L 2 3 at Georgia Southern L 3 5 at Valdosta State L 5 73/30 Furman L 3 4 South Carolina State W 9 3 Appalachian State W 10 9 Gardner-Webb L 4 5 Emory & Henry W 10 8 at Mars Hill W 10 04/17 at Wofford W 7 64/18 at Wofford L 8 10 at Georgia L 3 5 at Emory & Henry W 16 2 Erskine L 6 8 at South Carolina State L 2 3 Erskine L 5 8 Mars Hill W 9 1 at Appalachian State L 6 7

1971 – 20-11 overallHead Coach: Bill Haywood, 3rd season (40-38)

3/20 at South Carolina L 2 43/22 at South Carolina L 3 6 Allen W 4 23/24 at Furman W 4 2 at The Citadel W 5 4 at Augusta L 3 4 South Carolina State W 3 04/1 Wofford W 7 24/1 Wofford W 5 0 Appalachian State L 3 4 Salem W 16 1 Salem W 10 34/11 Furman L 1 2

at Erskine L 2 9 Maryville W 10 6 VMI W 4 3 at Georgia Southern L 1 2 at Georgia Southern W 6 14/22 at Wake Forest W 5 4 Allen W 9 0 Mars Hill W 1 0 Mars Hill W 16 2 at South Carolina State W 5 4 at Georgia Tech L 2 4 Erskine W 8 4 at Georgia W 11 7 at Appalachian State L 1 6 vs. South Carolina State % W 3 2 vs. Appalachian State % L 5 6 vs. South Carolina State % W 11 1 vs. Appalachian State % L 1 4

% – NAIA District 6 Tournament

1972 – 15-15 overallHead Coach: Bill Haywood, 4th season (55-53)

3/11 at South Carolina L 0 1 Toledo L 1 4 Toledo L 3 4 West Virginia State W 14 1 West Virginia State W 7 6 West Virginia State W 9 5 at Armstrong State L 1 64/2 at Georgia Southern L 1 44/3 at Georgia Southern W 7 5 at Georgia L 2 44/8 at Wofford W 15 0 Appalachian State W 10 34/10 at South Carolina L 1 5 at Erskine L 0 4 Voorhees W 5 44/15 Wofford W 20 11 at Appalachian State W 3 2 South Carolina State L 0 34/24 Furman L 5 6 at South Carolina State W 9 4 at Voorhees W 9 5 at Mars Hill W 10 0 at Mars Hill L 3 5 Erskine L 2 5 vs. Newberry % W 4 1 vs. Erskine % W 6 2 vs. Newberry % W 4 1 at Georgia L 2 7 vs. Morris Harvey # L 3 4 vs. Pembroke State # L 0 4

% – NAIA District 6 Playoffs# – NAIA Area VII Playoffs


3/19 at Wake Forest W 2 03/20 at North Carolina (12) W 5 1 Salem L 2 13 at Lehigh L 0 143/24 at Georgia Southern L 5 8 Toledo L 0 1 Toledo L 5 9 Yale L 1 5 South Carolina State W 9 24/2 at South Carolina L 2 10 at Erskine W 6 14/20 at Wofford W 8 0 at Georgia Tech (10) L 3 54/26 at Furman W 4 3

Wofford W 7 3 at Appalachian State W 5 1 Erskine W 8 7 Appalachian State W 9 45/7 Furman L 4 135/9 at South Carolina W 3 0


3/13 at Clemson (10) W 4 3 at Erskine L 2 33/18 at Baptist College L 2 53/19 at The Citadel L 1 43/20 at South Carolina State W 11 83/23 at Duke W 3 23/23 at Duke W 2 13/24 at North Carolina L 2 43/26 Western Maryland W 6 03/26 Western Maryland (11) L 7 83/28 Salem (10) W 6 53/30 at Georgia Southern L 2 103/30 at Georgia Southern L 0 143/31 at Georgia Southern L 0 134/11 at South Carolina L 1 84/16 East Tennessee State W 7 14/17 Mars Hill W 12 04/25 at South Carolina L 6 74/27 at Georgia Tech W 10 54/28 at Georgia Tech L 6 104/30 Appalachian State L 3 85/2 Erskine W 8 05/6 Virginia Tech L 5 85/7 at Mars Hill W 4 35/8 Appalachian State L 2 8

1975 – 15-8-1 overallCoach: Bill Haywood, 7th season (92-84-1)

3/8 at Duke W 3 03/8 at Duke L 2 33/20 at Pembroke W 6 33/23 at North Carolina L 0 43/25 Salem W 12 13/26 Salem W 11 33/28 West Virginia State W 10 13/30 Slippery Rock W 9 83/30 Slippery Rock W 1 04/1 at Clemson L 0 8 at Georgia Southern L 0 5 at Georgia Southern L 8 114/9 at Erksine W 4 24/10 East Tennessee State W 9 34/18 Erksine W 7 04/22 at Georgia L 0 54/24 at East Tennessee State W 19 74/26 at Georgia Tech W 7 54/28 at Appalachian State L 8 94/30 at Furman W 13 75/3 Georgia W 6 5 Virginia Tech W 7 4 Virginia Tech L 5 65/12 #1 South Carolina (6) T 8 8

1976 – 16-15 overallHead Coach: Bill Haywood, 8th season (108-99-1)

3/7 George Mason W 7 43/14 at UNC Wilmington L 3 43/14 at UNC Wilmington W 2 13/15 at East Carolina L 1 53/17 at North Carolina L 1 43/18 Slippery Rock W 12 73/19 Slippery Rock W 6 3




3/20 Fairfi eld W 7 43/22 Salem L 4 53/23 Salem W 5 43/28 West Virginia State @ W 12 03/38 West Virginia State W 3 13/29 Furman W 12 24/4 Georgia L 3 74/5 at Georgia L 1 104/7 at Wake Forest L 0 54/9 Wofford W 13 44/10 at Georgia Tech L 0 144/11 at Georgia Tech L 0 94/13 Baptist L 8 194/14 Baptist W 13 34/15 at Furman L 2 74/19 UNC Wilmington W 7 1 UNC Wilmington W 13 04/25 at Appalachian State W 6 54/27 East Tennessee State L 5 64/27 East Tennessee State W 20 5 Mars Hill L 6 85/6 vs. Appalachian State (10) ! W 4 3

- @ – Indicates NO-HITTER pitched by Jerry Reed! - Game played in Asheville

1977 – 27-5 overall, 14-2 SoConHead Coach: Bill Haywood, 9th season (135-104-1, 14-2)

– FIRST SEASON IN THE SOUTHERN CONFERENCE –

3/3 Slippery Rock W 4 33/10 at UNC Wilmington W 4 33/12 at Pembroke State W 13 43/13 at Pembroke State L 7 83/14 at North Carolina L 1 33/14 at North Carolina W 3 2 George Mason W 13 7 George Mason L 12 14 Salem College W 15 6 West Virginia State W 4 0 West Virginia State W 28 33/26 at Davidson * W 9 53/26 at Davidson * W 11 43/31 East Tennessee State W 12 94/7 The Citadel * L 2 14/7 The Citadel * W 13 104/9 Furman * W 7 64/9 Furman * W 12 4 at Old Dominion W 13 74/16 at William and Mary * W 7 24/16 at William and Mary * W 4 1 East Carolina * W 8 4 East Carolina * L 4 1 Appalachian State * W 4 34/23 at Marshall * W 1 04/23 at Marshall * W 3 24/25 at VMI * W 20 134/25 at VMI * W 18 94/27 at Appalachian State * W 4 34/28 Georgia W 22 154/29 Erksine W 4 34/30 at Georgia Tech W 14 5

* - Southern Conference Game

1978 – 20-13-1 overall, 8-5 SoConHead Coach: Bill Haywood, 10th season (155-117-2, 22-7)

– FIRST SEASON AT CHILDRESS FIELD –

3/11 at Carson-Newman L 12 193/11 at Carson-Newman W 9 03/15 George Mason W 13 143/16 George Mason T 16 163/18 at Furman L 10 11

3/21 Salem - 1ST W 18 23/22 Salem W 6 03/23 West Virginia State W 28 23/23 West Virginia State W 5 33/24 Southern Illinois-Edwardsville W 6 03/28 at South Carolina L 9 123/29 at Francis Marion L 1 23/30 at Pembroke State W 11 33/31 at UNC Wilmington L 1 34/1 at UNC Wilmington L 6 74/3 at Clemson L 3 124/4 at Georgia L 5 144/6 at Gardner-Webb W 9 64/8 Marshall * L 3 64/8 Marshall * L 3 64/10 VMI * W 9 04/10 VMI * W 13 44/12 at Erksine W 11 24/15 at The Citadel * W 5 24/15 at The Citadel * L 0 54/17 at East Tennessee State L 4 124/19 vs. South Carolina (in Asheville) W 13 64/22 at Chattanooga * L 2 34/22 at Chattanooga * W 11 34/24 at Appalachian State * W 12 104/27 Gardner-Webb W 27 64/17 Appalachian State * W 9 54/18 Davidson * W 7 14/18 Davidson * W 6 0

* – Southern Conference Game1ST – First Game Played at Childress Field

1979 – 13-15 overall; 6-7 SoConHead Coach: Bill Haywood, 11th season (168-132-2, 28-14)

3/3 at Georgia Tech W 3 13/8 at Clemson L 3 83/12 at South Carolina L 2 63/13 at Francis Marion L 7 173/14 at Campbell L 3 73/15 at Campbell W 12 53/16 at UNC Wilmington W 7 43/17 at UNC Wilmington L 0 53/20 Salem W 9 73/21 Salem W 15 23/22 Lenoir Rhyne W 8 43/26 The Citadel * @ W 3 03/26 The Citadel * L 6 73/27 Erskine L 9 103/31 at Furman * W 4 14/1 Clemson L 3 134/4 Appalachian State * L 7 114/7 Chattanooga * W 7 64/7 Chattanooga * L 6 104/9 at Carson-Newman W 15 104/9 at Carson-Newman L 4 54/10 Furman * W 4 34/17 Davidson * W 4 04/17 Davidson * L 2 74/19 at East Tennessee State * L 0 14/21 at Marshall * L 1 34/21 at Marshall * L 2 154/23 at VMI * W 7 34/23 at VMI * W 9 1

@ – Indicates NO-HITTER pitched by Rick Adair* - Southern Conference Game

1980 – 22-15 overall; 8-5 SoConHead Coach: Bill Haywood, 12th season (190-147-2, 36-19)

2/28 at Clemson L 2 103/8 at UNC Charlotte (8) W 5 33/9 at UNC Charlotte L 5 83/10 at North Carolina L 1 123/11 at North Carolina L 1 53/12 at Campbell W 4 23/14 at Francis Marion W 14 103/15 at South Carolina L 2 123/18 Salem W 11 23/19 Salem W 4 13/21 Ohio State L 2 103/23 West Virginia State W 21 53/25 at Furman * W 6 43/27 at Georgia State L 3 73/29 Davidson * W 8 53/29 Davidson * W 10 23/31 Carson-Newman W 11 94/1 East Tennessee State * L 2 64/2 Appalachian State * L 4 94/3 UNC Wilmington W 7 54/4 UNC Wilmington W 19 84/5 Campbell W 12 54/5 Campbell (9) W 4 34/8 Furman * W 7 54/10 Clemson L 8 144/16 at Lenoir Rhyne W 6 14/16 at Lenoir Rhyne W 11 84/19 Marshall * W 4 34/19 Marshall * L 1 44/20 South Carolina L 9 134/22 VMI * W 4 34/23 VMI * W 13 74/26 at The Citadel (8) W 5 44/26 at The Citadel L 6 7 East Tennessee State L 6 84/29 at Erskine W 10 55/3 Georgia State L 2 3

*– Southern Conference Game

1981 – 25-14 overall; 12-4 SoConHead Coach: Bill Haywood, 13th season (215-161-2, 48-23)– SOUTHERN CONFERENCE REGULAR SEASON CHAMPION –

3/1 at Georgia W 9 63/6 at Clemson (10) L 6 73/7 at Georgia Tech W 5 43/8 at Georgia Tech W 8 23/11 Slippery Rock W 18 53/14 at High Point W 14 53/15 at High Point L 6 93/16 at Pembroke L 1 73/17 at Pembroke W 6 43/18 vs. West Liberty (at UNCW) W 7 53/18 at UNC Wilmington L 6 73/18 at UNC Wilmington L 2 33/20 at Campbell L 6 73/21 at Campbell W 9 83/23 Furman * W 7 43/23 Furman * W 10 83/25 Ohio State W 12 113/26 Ohio State L 16 323/28 at Davidson * W 1 03/28 at Davidson * W 9 64/1 East Tennessee State * W 11 104/1 East Tennessee State * L 5 74/3 at Wofford (10) W 9 64/4 at Carson-Newman L 6 74/6 The Citadel * L 7 84/6 The Citadel * L 0 54/11 at Marshall * L 0 1




4/11 at Marshall * W 9 24/13 at VMI * W 6 34/13 at VMI * W 15 34/16 at Appalachian State * W 2 14/16 at Appalachian State * W 2 04/20 Chattanooga * W 4 14/20 Chattanooga * W 8 44/25 Campbell W 10 54/25 Campbell W 12 74/27 Erskine W 11 7 East Tennessee State ^ L 4 9 Marshall ^ L 3 5

* – Southern Conference Game^ – Southern Conference Tournament

1982 – 28-12 overall; 12-4 SoConHead Coach: David Wright, 1st season (28-12, 12-4)

at Georgia L 7 103/8 at Clemson L 0 53/9 UNC Wilmington L 3 43/9 UNC Wilmington W 6 43/14 at Francis Marion L 6 9 at Francis Marion W 10 8 at Campbell L 2 3 at Campbell L 1 113/22 at Erskine W 14 63/23 Ohio State W 13 43/23 Ohio State L 7 83/27 at Carson-Newman W 17 133/28 Marshall * W 6 53/29 Marshall * W 3 03/30 Clemson W 10 34/4 High Point W 12 44/5 High Point W 14 124/5 APPALACHIAN STATE * W 2 04/7 Appalachian State * W 6 54/10 at The Citadel * L 0 44/10 at The Citadel * W 3 14/14 Carson-Newman W 16 8 at East Tennessee State * L 2 164/18 at East Tennessee State * W 2 14/19 VMI * W 18 44/19 VMI * W 7 24/20 at Furman * W 7 44/21 at Furman * W 9 24/23 Georgia W 14 134/24 Campbell W 6 3 Campbell W 14 24/27 Wofford L 8 94/29 Wofford W 16 0 at Chattanooga * L 1 7 at Chattanooga * L 8 94/30 UNC Charlotte W 9 54/30 UNC Charlotte W 10 65/1 Davidson * W 5 15/1 Davidson * W 17 13 Georgia State W 26 8

ALL CAPS – Indicates No HItter by Jeff Mashburn* – Southern Conference Game

1983 – 25-20 overall; 9-5 SoConHead Coach: Jack Leggett, 1st season (25-20, 9-5)

2/25 at Georgia Tech L 5 142/26 at Georgia Tech L 9 162/27 at Georgia L 1 193/4 at Wake Forest L 8 93/5 South Carolina L 2 43/6 South Carolina W 6 53/8 Tennessee W 13 123/11 Austin Peay W 16 15

3/11 Austin Peay L 2 33/12 Austin Peay W 14 73/14 at Campbell L 8 133/15 at Campbell W 9 33/16 at High Point W 11 43/18 Ohio W 14 63/18 Ohio (8) W 3 23/19 Ohio W 7 33/20 Ohio State L 3 43/20 Ohio State W 9 83/21 Ohio State W 9 83/22 Ohio State L 4 243/26 Eastern Kentucky (8) W 9 83/27 Eastern Kentucky W 10 93/30 Georgia L 8 144/1 at South Carolina L 2 114/4 Campbell W 3 64/4 Campbell W 8 54/5 at Clemson L 3 84/9 Furman * W 7 24/9 Furman * W 4 34/11 at Appalachian State (12) W 9 64/11 AT APPALACHIAN STATE W 4 04/15 at Eastern Kentucky L 5 84/16 at Marshall * L 8 94/16 at Marshall * L 3 54/18 at VMI * W 4 14/18 at VMI * L 3 44/22 at Wofford L 11 164/26 East Tennessee State * W 5 34/26 East Tennessee State * L 8 124/27 at Tennessee L 4 214/29 Clemson W 13 74/30 at Davidson * W 10 44/30 at Davidson * W 16 105/1 The Citadel * L 7 85/1 The Citadel * W 2 1

ALL CAPS – Indicates No HItter by Greg Moore* – Southern Conference Game

1984 – 37-20 overall; 13-3 SoCon SouthHead Coach: Jack Leggett, 2nd season (62-40, 22-8)

– SOCON SOUTH DIVISION - REGULAR SEASON CHAMPION –

2/9 at Florida International L 2 72/10 at Florida International W 7 02/11 at Florida International L 0 72/12 at Florida International W 4 12/24 at Wake Forest W 9 8 at North Carolina State W 7 6 at North Carolina State L 4 14 at North Carolina State L 2 16 at North Carolina State W 5 3 at Georgia W 11 4 Slippery Rock State W 9 0 Slippery Rock State W 6 5 Eastern Kentucky L 3 4 Eastern Kentucky W 3 23/8 Tennessee L 4 7 at East Tennessee State W 7 3 at East Tennessee State W 5 2 at High Point W 9 1 at High Point W 4 2 at High Point W 16 3 at Campbell L 1 9 at Campbell L 2 33/16 at Furman * W 10 83/17 at Furman * W 12 23/17 at Furman * W 11 13/24 The Citadel * W 2 13/24 The Citadel * W 7 43/25 The Citadel * W 8 3 East Tennessee State L 0 10

East Tennessee State W 6 4 at Davidson * W 16 2 at Davidson * W 7 4 at Davidson * W 19 7 at Carson-Newman W 13 54/5 at Clemson L 3 54/7 Furman * L 5 64/7 Furman * W 6 14/8 Furman * W 3 24/10 at Tennessee L 5 13 Campbell L 1 6 Campbell W 6 54/12 Clemson W 9 24/14 at The Citadel * W 5 34/14 at The Citadel * L 3 44/16 Wofford W 5 44/16 Wofford W 8 54/18 at South Carolina W 8 6 Davidson * W 3 2 Davidson * L 3 54/25 at Wofford W 8 74/25 at Wofford L 8 9 Carson-Newman L 10 114/27 VMI ^ W 10 54/28 Appalachian State ^ L 5 94/29 The Citadel ^ L 0 85/1 Florida International L 9 19

* – Southern Conference South Division Game^ – Southern Conference Tournament (Cullowhee, NC)

1985 – 37-35 overall; 11-16 SoCon SouthHead Coach: Jack Leggett, 3rd season (99-75, 33-24)

– SOUTHERN CONFERENCE TOURNAMENT CHAMPION –

2/14 at Georgia Southern L 0 52/15 at Georgia Southern L 7 112/16 at Georgia Southern W 10 92/17 at Georgia Southern L 3 42/22 at UNC Charlotte (12) W 3 12/22 at UNC Charlotte L 4 62/23 at North Carolina State W 4 22/23 at North Carolina State W 5 32/24 at North Carolina State L 3 132/24 at North Carolina State L 0 52/27 at Georgia L 11 123/2 Eastern Kentucky W 7 63/2 Eastern Kentucky W 10 63/3 Eastern Kentucky L 3 93/3 Eastern Kentucky L 0 23/5 South Carolina W 7 53/6 Tennessee W 4 33/8 UNC Asheville L 6 73/9 at Elon L 2 73/9 at Elon L 1 23/10 at High Point W 7 13/10 at High Point L 1 23/11 at High Point L 7 83/12 at Campbell L 4 123/13 at Campbell L 4 73/13 at Campbell L 5 83/14 at Campbell W 27 143/16 Furman * W 5 33/16 Furman * W 8 13/17 Furman * L 9 103/19 at UNC Asheville W 17 63/19 at UNC Asheville W 23 03/20 Appalachian State L 6 123/20 Appalachian State W 7 53/22 at South Carolina L 7 143/23 at The Citadel * W 7 33/23 at The Citadel * L 1 83/24 at The Citadel * W 9 83/26 Campbell W 12 5




3/26 Campbell L 2 63/28 at Wofford W 9 53/30 Davidson * W 11 103/30 Davidson * L 4 64/2 East Tennessee State L 8 94/5 at Furman * W 9 74/5 at Furman * W 4 24/6 at Furman * W 12 64/10 at Tennessee L 3 154/11 UNC Asheville W 13 34/13 The Citadel * W 5 34/13 The Citadel * W 9 84/14 The Citadel * W 10 34/17 Wofford W 10 04/17 Wofford W 11 04/18 at Carson-Newman W 15 134/20 at Davidson * L 2 34/20 at Davidson * L 9 104/21 at Davidson * L 1 44/23 Clemson L 2 94/24 Carson-Newman W 16 134/26 Appalachian State ^ W 3 2 Marshall ^ L 2 5 Davidson ^ W 13 2 Marshall ^ W 12 6 Marshall ^ W 13 125/13 at North Carolina L 0 115/14 at North Carolina L 0 95/15 at North Carolina L 4 75/23 vs. Old Dominion # W 5 35/24 vs. La Salle # L 12 135/25 vs. St. John’s # W 9 65/25 vs. South Carolina # L 14 3

* – Southern Conference South Division Game^ – Southern Conference Tournament (Boone, NC)

# – NCAA East Regional Tournament (Columbia, SC)

1986 – 33-28 overall; 12-5 SoCon SouthHead Coach: Jack Leggett, 4th season (132-103, 45-29)

– SOCON SOUTH DIVISION - REGULAR SEASON CHAMPION –– SOUTHERN CONFERENCE TOURNAMENT CHAMPION –

2/13 at Georgia Southern L 6 112/14 at Georgia Southern W 4 32/15 at Georgia Southern W 8 72/16 at Georgia Southern W 6 52/21 at UNC Charlotte L 5 7 at North Carolina State L 5 7 at North Carolina State L 1 3 at North Carolina State W 1 0 at North Carolina State L 4 132/26 at Georgia L 7 103/1 Eastern Kentucky L 4 63/1 Eastern Kentucky W 9 73/2 Eastern Kentucky W 5 33/2 Eastern Kentucky W 12 53/5 UNC Asheville W 10 83/7 High Point W 24 23/8 High Point W 8 13/8 High Point L 7 93/9 at Elon L 0 53/10 at Campbell W 9 13/11 at Campbell W 11 83/11 at Campbell L 4 73/12 at Campbell W 4 23/14 at Furman * W 11 73/15 at Furman * W 10 33/18 at Appalachian State * L 2 53/18 at Appalachian State * L 2 83/22 The Citadel * W 10 53/22 The Citadel * L 6 73/23 The Citadel * W 15 53/24 USC Spartanburg L 15 18

3/27 Illinois L 14 153/28 at Davidson * L 2 163/28 at Davidson * L 3 73/29 at Davidson * L 5 133/31 at South Caolina L 5 164/1 at UNC Asheville W 17 134/2 at Carson-Newman L 15 194/4 Clemson L 0 84/5 Furman * W 2 14/5 Furman * W 7 14/6 Furman * W 15 44/8 at Georgia Tech W 4 34/9 at Georgia Tech L 11 134/11 at USC Spartanburg W 18 34/12 at The Citadel * W 8 64/12 at The Citadel * W 5 04/13 at The Citadel * W 12 44/15 Campbell L 11 134/15 Campbell L 7 164/17 at Clemson L 7 134/19 Davidson * L 0 104/19 Davidson * W 8 74/20 Davidson * W 8 54/22 UNC Asheville W 24 144/23 Carson-Newman W 9 74/25 East Tennessee State ^ W 11 24/26 Appalachian State ^ W 18 174/26 Appalachian State ^ W 11 85/23 at Miami # L 8 105/24 vs. Georgia Tech # L 7 8

* – Southern Conference Game^ – Southern Conference Tournament (Cullowhee, NC)

# – NCAA Atlantic Regional Tournament (Coral Gables, FL)

1987 – 36-20 overall; 13-3 SoCon SouthCoach: Jack Leggett, 5th season (168-123, 58-32)


2/7 at Florida L 7 92/7 at Florida W 12 32/8 at Florida L 12 132/12 at Georgia Southern L 5 62/12 at Georgia Southern W 14 122/14 at Georgia Southern L 0 102/15 at Georgia Southern W 8 72/21 at UNC Charlotte L 0 52/21 at UNC Charlotte L 2 32/25 at Clemson L 1 83/3 Campbell W 9 73/3 Campbell W 5 33/6 at High Point W 12 73/7 at High Point W 6 23/7 at High Point L 2 133/8 at High Point W 10 33/9 at Campbell W 7 43/10 at Campbell L 8 113/11 at Campbell L 2 73/12 Eastern Kentucky W 8 43/12 Eastern Kentucky W 17 23/14 Furman * L 2 63/14 Furman * W 6 43/15 Furman * W 5 23/17 Appalachian State * W 9 43/17 Appalachian State * L 0 73/21 at The Citadel * W 11 23/21 at The Citadel (10) * W 3 13/22 at The Citadel * W 18 43/24 UNC Asheville W 17 103/25 Elon W 5 23/26 at USC Spartanburg L 5 83/28 Davidson * L 1 143/28 Davidson * W 5 2

3/29 Davidson * W 10 44/1 at Carson Newman L 3 84/4 at Furman * L 7 104/4 at Furman * W 10 14/7 at Georgia L 8 114/8 at Georgia W 11 94/11 The Citadel * W 7 64/11 The Citadel * W 5 44/12 The Citadel * W 14 54/14 at East Tennessee State * W 10 84/15 East Tennessee State * L 5 64/17 at Davidson * W 14 104/17 at Davidson * W 8 24/20 USC Spartanburg W 9 64/22 Carson-Newman W 11 44/24 vs. VMI ^ W 16 44/25 vs. Appalachian State ^ W 8 74/26 vs. VMI ^ W 9 45/21 vs. Oklahoma State # L 3 65/22 vs. Purdue # W 8 75/23 at Mississippi State # W 8 15/24 vs. Oklahoma State # L 6 9

* - Southern Conference Game^ - Southern Conference Tournament (Asheville, NC)

# - NCAA Mid-East Regional Tournament (Starkville, MS)

1988 – 38-24 overall; 14-3 SoCon SouthCoach: Jack Leggett, 6th season (206-147, 72-35)


2/6 at Florida W 3 12/6 at Florida L 6 92/7 at Florida L 2 72/12 at Auburn L 0 32/13 at Auburn L 3 72/14 at Auburn W 4 12/14 at Auburn L 0 12/20 at North Carolina State L 1 72/20 at North Carolina State W 12 62/21 at North Carolina State L 4 62/21 at North Carolina State L 0 122/27 Eastern Kentucky W 11 12/27 Eastern Kentucky L 3 72/28 Eastern Kentucky W 12 02/28 Eastern Kentucky W 14 23/1 at Clemson L 4 83/2 Campbell W 15 53/3 Campbell L 2 63/4 at High Point W 8 63/5 at High Point W 15 93/6 at High Point W 16 33/7 at Campbell W 7 23/8 at Campbell L 1 93/9 at Campbell L 9 103/11 Liberty W 11 103/12 Liberty W 13 23/12 Liberty W 7 43/19 at Furman * W 8 53/19 at Furman * W 9 03/22 at USC Spartanburg W 11 103/23 at Appalachian State * L 2 33/23 at Appalachian State * W 9 23/24 South Carolina L 6 73/26 The Citadel * W 8 23/26 The Citadel * L 2 93/27 The Citadel * W 15 103/29 at Georgia L 2 33/30 at Georgia L 2 64/1 at Davidson * L 7 114/1 at Davidson * W 7 34/2 at Davidson * W 12 84/4 at Clemson L 11 20




4/7 USC Spartanburg W 10 44/9 Furman * W 6 44/9 Furman * W 4 24/10 Furman * W 6 54/14 Clemson L 4 124/16 at The Citadel * W 9 84/16 at The Citadel * L 2 44/17 at The Citadel * W 5 44/19 UNC Asheville W 11 14/20 East Tennessee State * W 10 54/23 Davidson * W 9 24/23 Davidson * W 8 34/24 Davidson * W 16 114/26 at Carson-Newman W 17 104/27 Piedmont W 14 74/29 vs. Appalachian State ^ W 18 84/30 vs. The Citadel ^ W 6 45/1 vs. The Citadel ^ W 22 65/26 at Mississippi State # L 4 75/27 vs. Texas A&M # L 6 8

* – Southern Conference Game^ – Southern Conference Tournament (Asheville, NC)

* – NCAA South Regional Tournament (Starkville, MS)

1989 – 23-31 overall; 10-5 SoConHead Coach: Jack Leggett, 7th season (229-178, 82-40)– SOUTHERN CONFERENCE REGULAR SEASON CHAMPION –


2/4 at Florida L 3 52/4 at Florida L 9 142/5 at Florida L 1 182/10 at Auburn L 2 152/11 at Auburn W 3 22/11 at Auburn L 3 82/12 at Auburn L 2 152/25 at Georgia L 0 12/25 at Georgia W 8 52/26 at South Carolina L 2 132/26 at South Carolina L 0 172/28 at Clemson L 8 93/1 Carson-Newman L 1 33/1 Carson-Newman W 8 13/10 UNC Asheville W 12 63/11 at Furman * L 2 33/11 at Furman * W 4 33/12 at Furman * W 10 03/14 at Clemson L 6 7

3/16 USC Spartanburg W 15 103/18 The Citadel * W 11 103/19 The Citadel * W 10 63/19 The Citadel * L 1 53/24 at East Tennessee State * L 3 53/25 at East Tennessee State * W 16 43/25 at East Tennessee State * W 10 03/28 at USC Spartanburg W 15 123/29 at UNC Asheville (13) L 4 54/1 VMI * L 3 104/1 VMI * W 7 44/2 VMI * W 3 24/5 at Georgia L 2 104/5 at Georgia L 5 104/6 Clemson L 2 144/10 at Clemson L 4 124/11 at Tennessee L 5 64/13 Campbell L 0 44/13 Campbell W 4 14/15 Middle Tennessee State W 7 44/15 Middle Tennessee State L 2 34/16 Middle Tennessee State L 3 134/18 at Carson-Newman W 10 44/19 UNC Asheville W 15 64/20 Piedmont L 12 134/22 Appalachian State * W 11 104/22 Appalachian State * L 5 164/23 Appalachian State * W 5 34/25 Carson-Newman W 15 05/2 Appalachian State ^ W 7 25/2 Marshall ^ W 4 25/20 at Auburn L 6 165/20 at Auburn L 3 55/25 Mississippi State # L 0 85/26 Indiana State # L 3 10

* – Southern Conference Game^ – Southern Conference Tournament (Asheville, NC)

* – NCAA South Regional Tournament (Starkville, MS)

1990 – 37-25 overall; 10-7 SoConHead Coach: Jack Leggett, 8th season (266-203, 92-47)

2/3 at Florida W 2 12/3 at Florida L 2 182/4 at Florida L 1 132/10 at Auburn W 9 32/10 at Auburn W 4 2

2/11 at Auburn L 6 92/11 at Auburn (8) W 13 92/18 Western Kentucky (10) W 4 32/18 Western Kentucky W 5 42/24 at North Carolina State L 1 52/24 at North Carolina State W 16 92/25 at North Carolina State L 1 22/25 at North Carolina State L 2 222/27 at Georgia L 6 142/28 at Clemson L 2 143/3 Eastern Kentucky L 6 93/3 Eastern Kentucky W 25 73/4 Eastern Kentucky (8) L 7 83/4 Eastern Kentucky W 10 33/5 at Davidson W 6 43/6 at Davidson W 22 13/7 at East Carolina L 2 73/8 at East Carolina L 0 123/10 at The Citadel * L 3 63/10 at The Citadel * L 3 73/11 at The Citadel * L 3 103/14 Winthrop W 6 53/15 Providence L 5 73/17 East Tennessee State * W 12 13/18 East Tennessee State * W 5 03/18 East Tennessee State * W 11 43/20 Piedmont W 15 83/21 UNC Asheville W 13 53/23 at Virginia Tech L 8 93/25 at VMI * W 8 53/25 at VMI * W 4 03/27 Virginia Tech W 18 63/31 Marshall * W 10 73/31 Marshall * L 5 64/1 Marshall * W 17 134/3 at Carson-Newman W 8 64/4 Milligan W 12 54/5 Wofford W 3 14/7 Newberry W 5 44/7 Newberry W 17 24/8 Newberry W 8 34/10 Milliagn W 18 04/13 at Appalachian State * L 2 114/13 at Appalachian State * W 6 14/14 at Appalachian State * L 0 34/17 at Georgia L 11 124/18 at Georgia L 3 154/20 Carson-Newman W 13 24/21 Furman * L 6 74/21 Furman * W 5 24/22 Furman * W 15 34/24 Piedmont W 8 34/26 East Tennessee State ^ W 6 14/27 Marshall ^ L 1 34/28 Appalachian State ^ W 5 44/28 Marshall ^ W 11 34/29 The Citadel ^ L 5 9

* – Southern Conference Game^ – Southern Conference Tournament (Charleston, SC)

1991 – 36-26 overall; 11-3 SoConHead Coach: Jack Leggett, 9th season (302-229, 103-50)

2/8 at Auburn L 16 172/9 at Auburn L 2 92/9 at Auburn W 4 32/10 at Auburn L 6 132/17 at North Carolina State L 3 82/17 at North Carolina State L 8 102/18 at North Carolina State (10) L 5 62/23 Radford W 10 22/24 Radford W 6 52/24 Radford W 12 3

The 1989 Catamounts won a fi fth-consecutive Southern Conference regular season and tournament championship.




2/26 at Winthrop W 5 33/1 Winthrop W 13 43/2 East Carolina L 6 83/4 at High Point W 10 13/5 at High Point W 17 63/6 at Virginia Tech L 1 113/7 at Virginia Tech L 10 153/8 at Radford L 7 113/9 at East Tennessee State * W 5 13/9 at East Tennessee State * W 8 43/10 at East Tennessee State * (10) W 4 33/12 at Georgia Tech W 10 53/13 at Georgia Tech W 7 53/16 VMI * W 14 23/16 VMI * W 20 13/17 VMI * W 21 03/19 Tennessee Tech W 17 63/20 Tennessee Tech W 14 23/23 at Marshall * W 7 33/23 at Marshall * W 17 03/26 Augusta W 7 63/27 Augusta L 6 83/30 North Carolina State L 0 33/30 North Carolina State L 2 63/31 Clemson W 9 74/3 at Clemson L 3 134/6 Appalachian State * L 3 44/6 Appalachian State * W 4 14/7 Appalachian State * W 15 94/11 UNC Asheville W 6 04/11 UNC Asheville W 11 04/15 at Milligan W 9 14/15 at Milligan W 7 54/16 at UNC Asheville W 14 74/17 USC Aiken L 3 184/18 USC Aiken L 3 74/18 USC Aiken L 7 84/20 The Citadel * W 10 44/20 The Citadel * L 6 84/21 The Citadel * L 5 94/23 Piedmont W 10 64/25 VMI ^ W 18 24/26 East Tennessee State ^ L 4 74/27 The Citadel ^ W 7 44/28 East Tennessee State ^ W 9 44/28 Appalachian State ^ W 4 04/28 Furman ^ L 9 115/10 at Maine L 4 65/11 at Maine L 1 35/11 at Maine W 14 75/12 at Maine L 11 145/13 at Maine L 13 14

* – Southern Conference Game^ – Southern Conference Tournament (Charleston SC)

1992 – 44-21-1 overall; 17-4 SoConHead Coach: Keith LeClair, 1st season (44-21-1, 17-4)

– SOUTHERN CONFERENCE REGULAR SEASON CHAMPION –– SOUTHERN CONFERENCE TOURNAMENT CHAMPION –

2/13 at South Carolina L 2 32/14 at USC Aiken L 3 62/15 at USC Aiken (11) W 11 82/19 at Clemson L 0 62/21 at North Carolina State L 3 52/22 at North Carolina State L 2 52/23 at North Carolina State L 4 72/29 Wright State L 3 22/29 Wright State W 6 43/1 Wright State W 12 73/2 at Davidson L 7 113/3 at Virginia Tech L 2 143/4 at Virginia Tech (11) T 5 5

3/5 at Radford W 16 53/7 at VMI * W 7 43/8 at VMI * W 8 33/8 at VMI * L 5 63/10 at Georgia Tech L 10 113/11 at Georgia (14) W 13 113/13 Davidson W 13 33/14 Marshall * W 6 43/14 Marshall * W 3 13/15 Marshall * W 29 13/17 Virginia Tech L 1 103/20 at Tennessee Tech W 5 23/20 at Tennessee Tech W 7 33/22 Georgia Southern * W 3 03/23 Georgia Southern * W 3 13/23 Georgia Southern * W 18 63/26 Georgia W 8 43/28 at Appalachian State * W 4 13/28 at Appalachian State * W 10 63/29 at Appalachian State * W 8 23/31 at UNC Asheville L 17 194/1 Tennessee Tech W 13 74/2 UNC Greensboro W 18 74/3 Winthrop W 14 54/4 Furman * W 14 74/4 Furman * W 8 34/5 Furman * L 7 84/7 UNC Asheville W 14 134/8 Davidson W 15 54/10 at Winthrop W 9 54/11 at The Citadel * L 1 24/11 at The Citadel * L 0 14/12 at The Citadel * W 8 74/14 USC Aiken L 6 104/15 USC Aiken L 0 74/16 Presbyterian W 16 54/17 East Tennessee State * W 5 34/17 East Tennessee State * W 3 04/18 East Tennessee State * W 6 34/21 Piedmont W 8 74/23 vs. VMI ^ W 3 24/24 at The Citadel ^ W 2 14/25 vs. Georgia Southern ^ W 17 104/16 vs. Georgia Southern ^ L 12 144/26 vs. Georgia Southern ^ W 4 35/9 at Northwestern W 5 2

5/10 at Northwestern W 10 45/11 at Northwestern W 9 35/21 at Florida State # W 1 05/22 vs. Kent # W 14 15/23 vs. Stanford # W 5 05/24 at Florida State # L 3 45/24 at Florida State # L 3 18


# – NCAA South II Regional Tournament (Tallahassee, FL)

1993 – 34-28 overall; 15-6 SoConCoach: Keith LeClair, 2nd season (78-49-1, 32-10)– SOUTHERN CONFERENCE TOURNAMENT CHAMPION –

2/13 UNC Charlotte L 9 112/14 UNC Charlotte W 10 62/17 Winthrop W 16 52/20 Wright State L 1 32/20 Wright State W 8 42/24 at UNC Asheville L 5 102/27 at The Citadel * W 12 22/27 at The Citadel (9) * W 8 72/28 at The Citadel * L 5 73/1 at Jacksonville L 0 93/2 at Jacksonville L 1 183/3 at Stetson L 2 43/4 at Stetson L 0 43/6 Davidson * W 9 73/7 Davidson * W 10 53/7 Davidson * W 10 53/9 at Georgia L 4 53/10 at Georgia L 9 113/20 Furman * W 23 73/20 Furman * W 9 23/21 Furman * W 13 63/22 at #1/2 Georgia Tech L 1 43/23 at #1/2 Georgia Tech W 4 33/15 UNC Asheville W 11 43/27 at Georgia Southern * W 1 03/27 at Georgia Southern * W 6 13/18 at Georgia Southern * L 0 24/1 UNC Asheville W 10 74/2 Virginia Tech L 8 124/3 Marshall * L 3 6

The 1992 squad ended a two-year void without a title in Cullowhee, winning both the regular season and tournament championships.




4/3 Marshall * W 15 34/4 Marshall * W 13 44/6 at Tennessee L 4 94/8 Presbyterian W 3 14/9 at VirginiaTech L 5 84/10 at VMI * L 3 44/10 at VMI * L 1 74/11 at VMI * W 13 14/13 Clemson L 2 124/15 at Clemson L 1 84/16 at UNC Greensboro L 7 84/17 at UNC Greensboro W 11 24/18 at UNC Greensboro W 8 64/20 USC Aiken W 7 54/21 USC Aiken L 10 134/22 at Winthrop W 9 34/24 at Appalachian State * L 3 74/24 at Appalachian State * (8) W 13 54/15 at Appalachian State * W 8 54/27 Lincoln Memorial W 14 74/29 vs. Marshall ^ W 7 64/30 at The Citadel ^ W 6 35/1 vs. VMI ^ L 4 85/2 vs. Georgia Southern (10) ^ W 6 55/2 vs. VMI ^ W 12 55/2 vs. VMI ^ W 5 15/10 vs. Grand Canyon W 10 85/11 vs. Grand Canyon L 22 255/12 at Brigham Young L 5 125/27 at #3 Louisiana State # L 2 75/28 vs. Miami # W 10 55/29 vs. Kent # L 5 8

* – Southern Conference Games^ – Southern Conference Tournament (Charleston SC)

# – NCAA South Regional Tournament (Baton Rouge, LA)

1994 – 45-18 overall; 19-4 SoConHead Coach: Keith LeClair, 3rd season 123-67-1, 51-14)– SOUTHERN CONFERENCE REGULAR SEASON CHAMPION –

2/12 at Clemson L 1 32/12 at Clemson L 1 42/13 at Clemson (13) L 5 62/19 Wright State W 4 32/19 Wright State W 2 1

2/20 Wright State W 9 02/24 UNC Asheville W 18 12/26 The Citadel * W 7 12/26 The Citadel * W 3 22/27 The Citadel * W 3 23/1 at Winthrop (8) W 9 53/3 at UNC Charlotte W 14 53/4 at UNC Charlotte W 7 33/5 at Davidson * L 7 83/5 at Davidson * W 7 43/6 at Davidson * W 9 73/8 at Georgia W 10 13/9 UNC Wilmington W 7 23/12 at East Tennessee State * W 10 83/12 at East Tennessee State * W 2 13/13 at East Tennessee State * W 13 63/15 at South Carolina W 9 23/16 at Winthop L 4 63/19 at Furman * W 6 53/19 at Furman * W 5 33/20 at Furman * W 7 03/22 at Tennessee Tech W 6 43/23 at Tennessee Tech L 5 63/24 Charleston Southern W 10 23/26 Georgia Southern * W 5 23/26 Georgia Southern * W 10 23/30 Tennessee L 0 14/2 at Marshall * W 7 44/2 at Marshall (8) * W 5 44/3 at Marshall * W 8 54/5 USC Aiken W 9 44/7 Eastern Kentucky W 13 44/7 Eastern Kentucky W 5 24/9 VMI * W 9 34/9 VMI * W 5 14/10 VMI * L 1 34/12 Winthrop (10) W 4 34/13 Lincoln Memorial W 7 54/16 South Florida W 9 24/16 South Florida W 5 44/17 South Florida L 4 74/19 Tennessee Tech W 7 04/20 Tennessee Tech W 10 64/23 Appalachian State * W 6 24/23 Appalachian State * L 2 13

4/24 Appalachian State * L 4 64/26 Greensboro College W 6 54/28 vs. Davidson ^ L 1 24/29 vs. East Tennessee State ^ W 4 04/30 vs. Marshall ^ W 8 25/1 vs. VMI ^ W 7 15/1 at The Citadel ^ L 2 45/13 at Miami L 2 75/14 at Miami L 2 85/15 at Miami L 4 55/27 vs. Arizona State # (completed 5/28) L 6 85/28 at Tennessee # L 4 6


# – NCAA Mid-East Regional Tournament (Knoxville, TN)

1995 – 32-24 overall; 13-11 SoConCoach: Keith LeClair, 4th season (155-91-1, 64-25)

2/10 at South Florida L 0 92/11 at South Florida W 6 12/12 at South Florida W 11 62/18 Wright State L 3 62/18 Wright State L 1 82/19 Wright State W 7 42/22 at Georgia W 10 92/25 Davidson * W 7 02/25 Davidson * W 5 22/26 Davidson * W 16 43/1 UNC Asheville W 10 53/4 East Tennessee State * L 5 83/4 East Tennessee State * L 4 103/5 East Tennessee State * W 5 43/7 at Georgia Tech L 0 63/8 at Georgia Tech W 13 73/11 Furman * W 10 93/11 Furman * L 3 43/12 Furman * W 12 83/14 #4 Clemson L 2 53/15 Old Dominion L 3 273/16 Old Dominion L 6 153/18 at Georgia Southern * L 2 93/18 at Georgia Southern * W 6 23/19 at Georgia Southern * L 2 93/21 at UNC Asheville W 15 03/22 Lenoir-Rhyne W 13 113/25 Marshall * L 9 103/25 Marshall * W 3 13/26 Marshall* W 20 63/29 at #4 Clemson L 4 53/31 at Virginia Tech W 7 64/1 at VMI * W 1 04/1 at VMI * L 1 24/2 at VMI * W 7 24/4 Virginia Tech W 10 94/5 Virginia Tech W 8 24/8 Troy State W 11 74/9 Troy State W 6 34/12 at #9 Tennessee W 3 14/14 at Appalachian State * L 4 64/14 at Appalachian State * W 8 74/15 at Appalachian State * W 17 104/18 Charleston Southern L 4 74/19 Charleston Southern W 5 14/22 at The Citadel * L 2 44/22 at The Citadel * L 3 114/23 at The Citadel * L 4 84/25 Montreat W 9 54/27 vs. Appalachian State ^ W 9 64/28 vs. Georgia Southern ^ L 4 104/29 vs. Marshall ^ W 10 34/29 vs. East Tennessee State ^ L 1 6

Head coach Keith LeClair (23) and the Catamounts hoisted the 1993 Southern Conference Tournament Championship trophy.




5/7 at Troy State W 7 05/8 at Troy State L 4 55/13 at Old Dominion L 5 7


1996 – 32-24-1 overall; 17-7 SoConHead Coach: Keith LeClair, 5th season (187-115-2, 81-32)

2/2 at Central Florida (12) L 4 52/3 at Central Florida L 8 112/4 at Central Florida L 2 122/9 vs. #23 North Carolina State # L 4 102/10 vs. UNC Greensboro # L 3 62/11 vs. Old Dominion # L 4 92/17 Wright State W 4 32/18 Wright State W 15 12/18 Wright State L 6 82/20 at Georgia L 0 32/21 at Georgia W 7 52/24 at East Tennessee State * W 5 12/24 at East Tennessee State * L 1 52/25 at East Tennessee State* W 7 42/27 at Charleston Southern L 3 62/28 at Charleston Southern T 5 53/2 at Furman * W 12 63/2 at Furman * L 2 123/3 at Furman * W 11 63/5 at Clemson L 2 43/9 Georgia Southern * L 10 173/9 Georgia Southern * W 3 23/10 Georgia Southern * W 9 83/12 at Eastern Kentucky W 4 33/13 at Eastern Kentucky W 11 83/14 at Morehead State W 9 73/16 at Marshall * W 10 63/16 at Marshall * W 4 33/17 at Marshall * W 7 13/22 Milligan W 12 73/23 VMI * W 8 63/23 VMI * W 3 13/24 VMI * W 13 53/26 Kent L 4 93/27 at UNC Asheville W 19 53/28 #7 Clemson L 3 133/30 Wofford L 7 143/30 Wofford W 13 04/2 at Winthrop W 9 34/3 Wofford W 8 04/4 UNC Asheville L 10 184/6 Appalachian State * L 12 154/6 Appalachian State * L 6 204/7 Appalachian State * W 8 54/9 at Clemson L 4 104/10 Winthrop W 6 54/13 The Citadel * L 1 64/13 The Citadel * W 5 24/14 The Citadel * L 1 24/16 Eastern Kentucky W 14 104/17 Eastern Kentucky W 12 114/20 at Davidson * W 9 64/21 at Davidson (8) * W 7 54/21 at Davidson * W 11 64/23 Montreat W 19 54/25 vs. VMI ^ L 3 74/26 vs. Furman ^ L 4 7

* – Southern Conference Game# – CITGO Southern Challenge(Charleston SC)

^ – Southern Conference Tournament (Charleston SC)

1997 – 41-20; 18-6 SoConHead Coach: Keith LeClair, 6th season (228-135-2, 99-38)

– SOUTHERN CONFERENCE REGULAR SEASON CHAMPION –– SOUTHERN CONFERENCE TOURNAMENT CHAMPION –

2/1 at Jacksonville State (8) W 7 62/1 at Jacksonville State L 1 102/2 at Jacksonville State W 10 92/7 vs. Old Dominion % L 10 162/8 vs. Virginia Commonwealth % W 11 62/9 vs. East Carolina % L 4 52/15 Wright State W 9 82/15 Wright State W 15 12/16 Wright State W 6 52/18 at #19 Georgia L 6 92/19 at #19 Georgia W 3 12/22 Furman * W 10 62/22 Furman * W 12 32/23 Furman * W 10 43/1 at Georgia Southern * L 13 153/1 at Georgia Southern * W 7 63/2 at Georgia Southern * W 18 63/5 Old Dominion (12) L 8 103/8 Marshall * W 15 43/8 Marshall * W 10 23/9 Marshall * L 3 43/10 Marshall * W 20 103/11 at #4 Georgia Tech W 13 73/12 at #4 Georgia Tech L 0 143/15 at VMI * L 9 173/15 at VMI * L 5 63/16 at VMI * W 13 63/19 at South Carolina L 12 303/20 UNC Asheville W 13 63/22 Miami (Ohio) W 12 63/22 Miami (Ohio) W 3 03/23 Miami (Ohio) W 11 83/25 # 10 Clemson W 9 43/26 at #10 Clemson L 9 143/29 at Appalachain State * W 18 43/29 at Appalachian State * W 26 63/30 at Appalachian State * W 8 24/1 at Tennessee L 8 104/2 UNC Asheville W 14 34/5 at The Citadel * W 5 44/5 at The Citadel * W 5 24/6 at The Citadel * L 5 64/8 Morehead State L 3 94/9 Morehead State W 13 54/12 Davidson * W 11 14/12 Davidson * W 9 44/13 Davidson * L 9 114/16 at UNC Asheville (11) W 4 34/19 East Tennessee State * W 9 84/19 East Tennessee State * W 11 104/20 East Tennessee State * W 8 64/24 vs. VMI ^ W 4 34/25 vs. Furman ^ W 7 14/26 vs. The Citadel ^ W 10 34/27 vs. Furman (10) ^ W 10 95/9 at Old Dominion L 7 115/10 Old Dominion W 11 105/10 at Old Dominion W 6 35/11 at Old Dominion L 7 85/22 vs. #7 Auburn $ L 3 115/23 vs. Marist $ W 8 35/24 vs. South Florida $ L 4 9

* - Southern Conference Game% - Colonial-SoCon Challenge (Charleston, SC)

^ - Southern Conference Tournament (Charleston, SC)$ - NCAA East Regional (Tallahassee, FL)

1998 – 45-15 overall; 20-6 SoConHead Coach: Rodney Hennon, 1st season (45-15, 20-6)

2/7 at Stetson W 7 62/7 at Stetson W 8 12/8 at Stetson (12) W 11 92/13 vs. South Carolina % L 5 112/14 vs. Richmond % W 15 22/15 vs. Tennessee % L 6 92/18 at South Carolina L 0 32/21 Wright State L 5 62/21 Wright State W 7 32/22 Wright State W 10 32/28 St. Bonaventure W 17 12/28 St. Bonaventure W 5 43/3 at Charleston Southern W 16 93/4 at Charleston Southern W 8 23/4 at Charleston Southern W 4 13/9 William & Mary W 15 53/10 William & Mary W 10 73/14 at Georgia Southern * W 10 63/14 at Georgia Southern * W 12 23/15 at Georgia Southern * L 3 43/17 at #5 Clemson L 1 53/19 #5 Clemson W 10 73/21 at Davidson * W 11 63/22 at Davidson * W 12 23/22 at Davidson * W 9 73/24 at Georgia L 5 83/35 at UNC Asheville W 5 33/28 VMI * W 25 13/28 VMI * W 8 73/29 VMI * W 11 44/1 Furman * W 7 14/1 Furman * W 6 54/2 Furman * W 6 44/4 at UNC Greensboro * W 10 94/4 at UNC Greensboro (8) * L 0 14/5 at UNC Greensboro * L 0 54/8 at Kentucky W 6 54/11 Wofford * W 11 34/11 Wofford * L 3 44/12 Wofford * W 6 34/14 Charleston Southern W 12 44/15 Charleston Southern W 14 04/16 at East Tennessee State * W 9 84/18 The Citadel * W 9 64/18 The Citadel * L 7 104/21 at UNC Asheville L 6 94/22 at East Tennessee State * W 10 94/22 at East Tennessee State * L 4 104/25 at Appalachian State * W 15 74/25 at Appalachian State * W 9 84/26 at Appalachian State * W 14 34/28 UNC Asheville W 9 74/30 vs. Georgia Southern ^ W 6 55/1 at The Citadel ^ L 0 55/2 vs. Wofford ^ W 9 45/2 vs. Furman ^ W 2 15/3 vs. UNC Greensboro ^ L 2 45/9 at UNC Wilmington (11) W 5 45/9 at UNC Wilmington W 7 45/10 at UNC Wilmington (11) W 10 9

* - Southern Conference Game% - Franklin Life Shootout (Charleston, SC)

^= Southern Conference Tounament (Charleston, SC)

1999 – 36-23 overall; 18-10 SoConHead Coach: Rodney Hennon, 2nd season (81-38, 38-16)

2/12 at Coastal Carolina W 5 22/13 at Coastal Carolina L 3 52/14 at Coastal Carolina L 9 11




2/20 Wright State (13) W 5 42/20 Wright State (7) W 8 52/21 Wright State (10) W 11 82/23 at Georgia L 0 62/24 at Georgia L 11 152/27 North Carolina A&T W 9 82/28 North Carolina A&T (5) W 20 02/28 North Carolina A&T W 13 23/6 at Wofford * W 12 93/7 at Wofford (7) * W 5 43/7 at Wofford (10) * W 14 103/10 High Point W 15 83/10 High Point W 10 43/13 UNC Greensboro * W 5 43/16 at #19 North Carolina State L 2 73/17 at #19 North Carolina State L 1 113/20 St. John’s (10) W 8 73/20 St. John’s (7) W 4 13/21 St. John’s L 11 133/23 at #10 Georgia Tech L 0 23/27 Davidson * W 9 33/38 Davidson (7) * L 8 113/28 Davidson * W 15 73/31 at High Point T 8 84/2 at The Citadel * L 1 44/3 at The Citadel (7) * L 1 44/3 at The Citadel * L 1 54/6 Clemson (10) W 9 84/7 at Clemson L 11 164/10 East Tennessee State (7) * W 18 34/10 East Tennessee State (10) * W 11 104/11 East Tennessee State * L 9 124/14 at UNC Asheville W 10 74/17 Appalachian State * W 11 44/17 Appalachian State (7) * L 5 64/18 Appalachian State * W 5 44/20 at UNC Asheville W 9 64/24 at VMI (7) * W 18 54/24 at VMI (7) * W 10 44/25 at VMI * W 7 44/27 UNC Asheville L 8 145/1 at Furman (10) * W 12 115/1 at Furman (7) * W 13 35/2 at Furman * W 10 95/4 at #23 Clemson (10) L 10 115/8 at College of Charleston * L 7 85/8 at College of Charleston (7) * L 1 25/9 at College of Charleston * W 15 65/15 Georgia Southern (11) * L 10 125/15 Georgia Southern (7) * L 10 115/16 Georgia Southern * W 12 115/19 Georgia Southern ^ L 5 85/20 vs. VMI ^ W 8 45/21 vs. East Tennessee State ^ W 7 55/21 vs. Furman ^ W 11 45/22 vs. College of Charleston ^ W 3 25/22 at The Citadel ^ L 3 6


2000 – 15-38 overall; 8-22 SoConHead Coach: Todd Raleigh, 1st season (15-38, 8-22)

2/1 at Tennessee L 0 62/2 at Tennessee L 1 122/11 at Central Florida L 2 72/12 at Central Florida L 0 212/13 at Central Florida L 7 132/19 Wright State W 13 112/19 Wright State (7) W 13 112/20 Wright State W 16 42/24 Georgia L 3 232/26 VMI * L 3 8

2/26 VMI * W 11 72/27 VMI * L 6 72/29 UNC Asheville L 1 93/3 at UNC Greensboro * L 1 63/4 at UNC Greensboro * L 0 63/5 at UNC Greensboro * L 7 103/7 at #2 North Carolina L 8 113/8 at #2 North Carolina L 1 43/10 The Citadel * L 6 83/12 The Citadel * W 10 53/12 The Citadel (7) * L 5 73/15 UNC Asheville (10) L 3 43/18 at Appalachian State * L 2 53/18 at Appalachian State (10) * W 12 63/19 at Appalachian State * L 12 133/25 Furman * L 13 243/25 Furman * L 5 83/26 Furman * L 9 133/28 Georgia State L 8 213/29 Georgia State W 5 44/1 Wofford * W 5 34/1 Wofford * W 9 44/2 Wofford * W 12 84/4 at #8 Clemson L 7 114/7 College of Charleston * L 1 44/8 College of Charleston * L 5 104/9 College of Charleston * W 15 64/14 at East Tennessee State * L 6 124/15 at East Tennessee State * L 2 34/16 at East Tennessee State * L 4 54/18 at Tennessee (10) L 4 54/22 Elon L 4 104/22 Elon (7) W 3 14/23 Elon L 9 114/26 vs. #7 Clemson @ L 4 134/29 at Davidson * L 3 44/30 at Davidson * (7) W 15 44/30 at Davidson * L 2 35/6 at Georgia Southern * L 7 85/6 at Georgia Southern * L 5 65/7 at Georgia Southern (10) * L 5 65/13 at UNC Asheville W 7 45/14 vs. UNC Asheville @ W 8 5

* – Southern Conference Game@ – Played at McCormick Field in Asheville, N.C.

2001 – 30-26 overall; 18-11 SoConHead Coach: Todd Raleigh, 2nd season (45-64, 26-33)

2/2 at #11 Auburn L 1 142/3 at #11 Auburn L 2 42/4 at #11 Auburn L 4 52/9 at #23 East Carolina L 5 92/10 at #23 East Carolina L 0 62/11 at #23 East Carolina L 1 122/17 Wright State W 15 22/18 Wright State L 12 132/18 Wright State (7) W 10 62/23 vs. Kent State # W 9 52/24 at Coastal Carolina # L 2 132/25 vs. Delaware # W 7 62/28 UNC Asheville W 19 103/4 at Wofford * W 10 13/4 at Wofford * L 4 53/7 UNC Asheville W 9 73/9 at Coll. of Charleston * L 2 33/10 at Coll. of Charleston * W 7 33/11 at Coll. of Charleston * L 2 53/14 at #19 Tennessee L 3 63/16 UNC Greensboro * W 10 13/17 UNC Greensboro * L 5 223/18 UNC Greensboro * W 11 93/23 Georgia Southern * W 13 12

3/24 Georgia Southern * L 3 173/25 Georgia Southern * W 13 83/27 #6 Tennessee L 13 153/31 Appalachian State * W 7 33/31 Appalachian State * W 18 74/1 Appalachian State (10) * L 11 134/6 at #23 The Citadel * L 0 74/7 at #23 The Citadel * W 7 64/8 at #23 The Citadel * W 12 64/10 at Georgia State L 3 44/11 at Georgia State W 13 74/13 East Tennessee State * W 9 84/14 East Tennessee State * L 5 94/15 East Tennessee State * W 8 74/18 at UNC Asheville (7) W 16 14/20 at Furman * L 8 114/21 at Furman * L 1 64/22 at Furman * W 7 54/24 at #12 Clemson L 2 84/28 North Carolina A&T (10) W 13 124/28 North Carolina A&T (7) W 18 44/29 North Carolina A&T W 9 35/1 at #18 Georgia L 2 75/2 at UNC Asheville @ W 5 45/5 Davidson * W 8 75/5 Davidson * W 13 75/6 Davidson * W 7 05/12 at VMI * W 5 35/12 at VMI * L 8 155/13 at VMI * W 6 35/16 vs. UNC Greensboro ^ L 5 75/17 vs. College of Charleston ^ L 7 9

* – Southern Conference Game@ – Played at Asheville’s McCormick Field

# – Baseball at the Beach (Myrtle Beach, SC)^ – Southern Conference Tournament (Charleston, SC)

2002 – 33-23 overall; 20-10 SoConHead Coach: Todd Raleigh, 3rd season (78-87,46-43)

2/16 Wright State W 14 42/16 Wright State (7) W 18 02/17 Wright State W 9 62/22 vs. Virginia Tech ! L 1 52/23 vs. Virginia ! W 4 32/24 vs. West Virginia ! L 5 122/26 at #1 Florida State L 3 132/27 at #1 Florida State L 0 33/3 North Carolina A&T (7) W 16 33/3 North Carolina A&T (7) W 18 13/6 UNC Asheville W 6 53/6 at UNC Greensboro * W 2 03/9 at UNC Greensboro * L 11 133/10 at UNC Greensboro * L 8 113/16 Wofford * W 6 33/16 Wofford * W 12 43/17 Wofford * L 10 123/20 at Georgia State (10) L 5 93/23 at Appalachian State * (8) W 26 103/23 at Appalachian State * (7) W 17 33/24 at Appalachian State * W 6 33/27 Binghamton (7) W 17 43/28 Binghamton W 10 73/29 Furman * W 8 33/30 Furman * W 7 63/31 Furman * W 11 34/2 UNC Asheville W 9 64/5 The Citadel * L 3 84/6 The Citadel * L 0 74/7 The Citadel * W 2 14/10 at #4 Georgia Tech L 1 24/12 #34 C of Charleston * L 3 74/13 #34 C of Charleston (13) * W 8 7




4/14 #34 C of Charleston (11) * W 13 94/16 at #1 Clemson L 9 134/17 Tennessee Tech W 11 74/20 at Davidson * L 4 54/20 at Davidson * W 4 04/21 at Davidson (10 * W 4 14/23 at Georgia L 11 184/26 at Georgia Southern * L 2 44/27 at Georgia Southern * W 6 34/28 at Georgia Southern * W 14 115/4 VMI (7) * W 10 05/5 VMI * W 6 25/5 VMI * L 4 75/10 at East Tennessee State * W 16 35/11 at East Tennessee State * W 7 65/12 at East Tennessee State * L 10 165/14 Winthrop L 2 35/15 #1 Clemson L 4 125/19 UNC Asheville @ (7) L 2 35/19 UNC Asheville @ (7) W 1 05/22 vs. Wofford ^ W 9 25/23 vs. College of Charleston ^ L 0 35/24 vs. UNC Greensboro (10) ^ L 4 6

* – Southern Conference Game! – Berkley Electric Shootout (Charleston, SC)

^ – Southern Conference Tournament (Charleston, SC)@ – Played at Asheville’s McCormick Field

2003 – 43-21 overall; 22-8 SoConHead Coach: Todd Raleigh, 4th season (121-108, 68-51)– SOUTHERN CONFERENCE REGULAR SEASON CHAMPION –


2/8 at Coastal Carolina L 3 82/9 at Coastal Carolina L 3 42/12 High Point W 11 12/14 at #31 East Carolina L 4 62/14 at #31 East Carolina L 2 42/15 at #31 East Carolina L 1 22/22 Wright State W 7 62/22 Wright State W 6 12/23 Wright State W 13 33/1 Liberty W 9 63/1 Liberty W 9 83/2 Liberty W 4 33/5 UNC Asheville W 6 5

3/7 The Citadel (10) * W 8 73/8 The Citadel * L 3 73/9 The Citadel * W 8 53/11 at Gardner-Webb W 8 33/12 at #6 South Carolina L 2 53/14 at Davidson (7) * W 11 03/15 at Davidson * W 5 43/16 at Davidson * W 9 03/18 at UNC Asheville (11) L 2 33/21 East Tennessee State * W 20 13/22 East Tennessee State * W 13 123/23 East Tennessee State * W 9 53/25 #10 CLEMSON W 9 53/28 at Furman * W 3 23/29 at Furman * W 6 53/30 at Furman * L 2 44/1 at #15 Clemson L 3 54/4 Georgia Southern * W 7 54/5 Georgia Southern * W 16 14/6 Georgia Southern * W 12 24/12 at UNC Greensboro * L 4 54/12 at UNC Greensboro * L 1 64/16 at UNC Greensboro * L 2 144/15 Tennessee Tech W 12 44/16 Gardner-Webb L 7 114/18 VMI * W 16 34/19 VMI * W 11 74/20 VMI * W 14 94/22 Georgia State W 21 104/23 Georgia State (10) W 9 74/29 at #26 Oklahoma State W 12 54/30 at #26 Oklahoma State W 15 95/3 at Wofford * W 17 55/3 at Wofford * W 11 15/4 at Wofford * W 6 55/11 Appalachian State * L 7 125/11 Appalachian State * W 10 55/12 Appalachian State * W 10 85/13 at Tennessee Tech L 5 75/16 at College of Charleston * W 3 25/17 at College of Charleston * L 2 35/18 at College of Charleston * L 2 35/21 vs. Davidson ^ W 14 05/22 vs. Furman ^ W 6 05/24 vs. Georgia Southern ^ W 1 05/25 vs. Georgia Southern (11) ^ L 4 85/25 vs. Georgia Southern ^ W 6 5

5/30 vs. #19 Va. Commonwealth $ L 0 65/31 vs. Le Moyne $ W 9 55/31 vs. #19 Va. Commonwealth $ W 2 06/1 vs. #12 North Carolina State $ (14) L 4 6

ALL CAPS – First Night Game Played at Childress Field* – Southern Conference Game

^ - Southern Conference Tournament (Charleston, SC)$ – NCAA Wilson Regional (Wilson, NC)

2004 – 28-31 overall; 12-18 SoConHead Coach: Todd Raleigh, 5th season (149-139, 80-69)

2/13 at #12 Auburn L 4 52/14 at #12 Auburn L 1 42/15 at #12 Auburn L 0 62/21 Wright State L 6 82/21 Wright State (7) W 14 12/22 Wright State W 14 02/28 Wagner W 17 112/28 Wagner W 15 32/29 Wagner W 12 43/4 at Wake Forest L 4 163/6 Miami (Ohio) W 12 113/6 Miami (Ohio) W 14 123/7 Miami (Ohio) L 8 123/9 at #17 Georgia Tech L 3 43/10 at #17 Georgia Tech W 9 53/12 College of Charleston * L 3 193/13 College of Charleston * L 10 113/14 College of Charleston * L 0 73/16 at Gardner-Webb W 11 23/19 at The Citadel * L 0 43/20 at The Citadel * L 3 63/21 at The Citadel * L 3 63/24 at Tennessee Tech L 12 133/26 Davidson * L 4 53/27 Davidson * W 12 103/28 Davidson (10) * W 3 23/30 at Georgia State (13) W 10 93/31 at Georgia State L 10 114/3 at East Tennessee State * W 8 44/3 at East Tennessee State * W 8 44/4 at East Tennessee State * L 3 44/9 Furman * W 9 64/10 Furman * W 10 44/11 Furman * W 8 64/16 at Georgia Southern * L 5 64/17 at Georgia Southern * L 5 64/18 at Georgia Southern * L 0 34/21 at #17 Clemson L 7 84/23 UNC Greensboro * L 7 94/24 UNC Greensboro * L 0 74/27 Tennessee Tech W 12 34/30 at Elon * W 8 65/1 at Elon * L 8 115/2 at Elon * L 4 95/11 at UNC Asheville L 5 125/12 at UNC Asheville W 9 15/14 Wofford * W 4 35/15 Wofford * W 6 45/16 Wofford * W 8 25/19 Gardner-Webb (11) W 4 35/22 at Appalachian State * W 10 85/22 at Appalachian State * L 4 55/23 at Appalachian State * L 11 185/26 vs. #30 College of Charleston ^ W 4 35/27 vs. Elon ^ W 7 65/28 at The Citadel ^ W 5 25/29 at The Citadel ^ L 2 95/30 at The Citadel ^ L 1 8


The 2003 Western Carolina Catamounts ended a six-year span without a Southern Conference championship by winningboth the regular season and tournament championships, claiming the tourney crown in Charleston, S.C.





2/19 Wright State W 9 52/19 Wright State (7) L 0 122/20 Wright State W 8 52/25 at #7 Rice ! L 1 92/27 vs. New Mexico (12) ! W 14 132/27 at #7 Rice ! L 4 83/4 vs. Kent State % W 4 13/5 vs. James Madison % W 4 33/6 at #23 Coastal Carolina % L 3 43/9 Georgia State W 3 13/9 Georgia State W 12 73/11 Appalachian State * W 9 43/12 Appalachian State * W 14 63/13 Appalachian State * W 10 93/15 at UNC Asheville W 8 53/18 at #18 College of Charleston * L 1 23/19 at #18 College of Charleston * L 8 93/20 at #18 College of Charleston * L 5 173/23 UNC Asheville W 7 63/25 The Citadel * W 15 13/26 The Citadel * L 7 83/26 The Citadel * W 10 93/29 at #1 Georgia Tech W 8 53/30 Brown L 6 103/31 Brown (7) W 18 94/1 at Davidson * L 2 54/2 at Davidson * W 13 114/3 at Davidson * W 7 44/6 UNC Asheville W 8 34/8 East Tennessee State * W 13 34/9 East Tennessee State * L 3 44/10 East Tennessee State * W 9 84/12 Clemson $ L 4 74/15 at Furman * L 2 144/16 at Furman * L 0 124/17 at Furman * L 2 84/19 at Clemson L 1 104/22 Georgia Southern * L 5 174/23 Georgia Southern * W 11 64/24 Georgia Southern * L 5 64/29 at UNC Greensboro * W 3 14/30 at UNC Greensboro * W 8 75/1 at UNC Greensboro * L 5 65/7 Elon * W 7 25/8 Elon * W 9 45/9 Elon * W 12 105/11 at Georgia W 2 15/13 Charleston Southern L 8 135/14 Charleston Southern W 6 55/17 Gardner-Webb L 7 125/20 at Wofford * W 7 25/21 at Wofford * W 10 35/22 at Wofford * W 10 75/25 at The Citadel ^ W 6 15/26 vs. Georgia Southern ^ L 2 75/27 vs. #20 College of Charleston ^ L 4 11

* – Southern Conference Game! – Rice Invitational (Houston, Texas)

% – Coastal Carolina Tourney (Conway, SC)$ – Game started 4/12; Halted in bot. of 4th due to rain;

Resumed 4/19 at Clemson^ – Southern Conference Tournament (Charleston, SC)


2/19 Butler (10) L 3 52/19 Butler (7) W 4 22/24 vs. South Florida # (13) L 3 4

2/25 at Stetson # W 4 32/26 vs Illinois # W 14 132/28 UNC Asheville W 16 53/3 at Charleston Southern L 11 153/4 at Charleston Southern L 4 73/5 at Charleston Southern W 11 13/7 at UNC Wilmington L 2 33/8 at UNC Wilmington L 4 53/10 at Elon * L 10 133/11 at Elon * W 6 13/12 at Elon * L 3 163/15 at #20 Georgia L 0 113/18 Princeton W 10 33/18 Princeton W 13 83/19 Princeton (12) W 10 83/21 Hartford W 24 123/21 Hartford W 11 03/22 Gardner-Webb W 8 43/24 Wofford * W 9 83/25 Wofford * W 11 73/26 Wofford * W 20 103/28 at #3 Georgia Tech L 5 193/31 at Appalachian State* W 11 04/1 at Appalachian State* L 3 44/2 at Appalachian State* W 15 44/4 at #7 Clemson W 8 64/7 at Georgia Southern * L 0 174/9 at Georgia Southern * L 1 74/9 at Georgia Southern * W 4 24/11 #5 Clemson ! L 3 84/14 #17 College of Charleston * L 1 174/15 #17 College of Charleston * L 6 14

4/16 #17 College of Charleston * W 5 44/18 East Tennessee State W 7 14/21 at The Citadel* L 4 54/23 at The Citadel* W 8 54/24 at The Citadel* L 3 44/25 at Georgia W 7 54/26 at Gardner-Webb L 5 104/28 Davidson * W 6 04/29 Davidson * L 6 124/30 Davidson * W 5 35/5 UNC Greensboro * W 8 35/6 UNC Greensboro * W 5 25/7 UNC Greensboro * L 6 105/10 at Tennessee L 2 75/12 Kennesaw State W 6 35/13 Kennesaw State W 5 45/14 Kennesaw State W 9 75/16 East Tennessee State L 8 165/19 Furman * L 4 55/20 Furman * W 7 55/20 Furman * L 6 105/24 vs Furman ^ W 14 15/25 vs #28 College of Charleston ^ L 0 15/26 vs Georgia Southern ^ W 13 35/26 at The Citadel ^ L 2 4

* - Southern Conference Game# - Stetson Invitational (DeLand, Fla.)

! - Prior to game, WCU retired the number 23 of Hall of Fame player and coach Keith LeClair before a record crowd of 2,823

^ - Southern Conference Tournament (Charleston, SC)




2007 – 42-20 overall; 20-7 SoConHead Coach: Todd Raleigh, 8th season (257-207, 132-101)– SOUTHERN CONFERENCE REGULAR SEASON CHAMPION –

2/16 at Kennsaw State W 9 62/17 at Kennesaw State W 10 62/18 at Kennesaw State L 3 52/23 Connecticut W 16 52/24 Connecticut L 1 82/25 Connecticut W 12 12/27 at #14 Georgia Tech W 10 73/2 vs. #20 N.C. State % W 6 53/3 vs. #12 Pepperdine % L 1 33/4 at East Carolina % L 2 33/6 at East Tennessee State W 7 43/7 Mercer L 10 133/9 Xavier W 9 43/10 Xavier L 12 173/11 Xavier W 14 73/13 at Georgia W 3 13/14 UNC Asheville L 6 73/16 Columbia W 10 93/17 Columbia W 17 113/18 Columbia W 14 63/20 #6 Clemson W 6 33/23 at College of Charleston* L 6 73/24 at College of Charleston* L 8 183/25 at College of Charleston* L 7 83/28 at #11 Clemson L 6 153/30 The Citadel* W 7 33/31 The Citadel* W 12 54/1 The Citadel* W 18 34/5 at Davidson* W 13 114/6 at Davidson* W 10 44/7 at Davidson* W 2 14/10 at UNC Asheville @ W 12 64/13 at UNC Greensboro* W 5 24/14 at UNC Greensboro* W 11 14/14 at UNC Greensboro* L 4 94/18 East Tennessee State W 7 34/20 Elon* W 4 24/21 Elon* W 4 34/22 Elon* W 5 44/24 at High Point W 15 84/25 Georgia L 7 124/27 at Furman* L 3 54/28 at Furman* W 12 44/29 at Furman* W 8 55/4 Appalachian State* W 6 05/5 Appalachian State* W 13 75/6 Appalachian State* L 3 65/8 at Ohio State W 7 35/9 at Ohio State W 12 25/11 at Wofford* W 26 125/12 at Wofford* W 21 35/13 at Wofford* W 14 15/15 High Point W 4 05/17 Georgia Southern* W 4 15/18 Georgia Southern* W 8 35/19 Georgia Southern* L 2 55/23 at The Citadel ^ L 2 75/24 vs Georgia Southern ^ L 5 66/1 vs. #28 East Carolina $ L 8 96/2 vs. Jacksonville $ W 7 06/3 vs. #28 East Carolina $ W 9 56/4 at #3 North Carolina $ L 5 6

* – Southern Conference Game% – Keith LeClair Classic (Greenville, N.C.)

@ – Game played at Asheville’s McCormick Field^ – Southern Conference Tournament (Charleston, S.C.)

$ – NCAA Chapel Hill Regional (Chapel Hill, N.C.)

2008 – 29-28 overall; 14-13 SoConHead Coach: Bobby Moranda, 1st season (29-28, 14-13)

2/22 Marshall L 9 142/23 Marshall W 11 52/24 Marshall W 12 82/29 vs. West Virginia % L 7 83/1 vs. George Mason % L 6 123/2 vs. Marshall % W 9 73/2 at #26 Coastal Carolina % L 1 73/4 at #19 Georgia Tech L 1 43/6 vs. Michigan State $ L 3 53/7 vs. Creighton $ W 11 83/8 at #4 Rice $ L 11 123/11 at #4 Vanderbilt L 3 53/12 at #4 Vanderbilt L 4 113/16 Hartford W 32 33/16 Hartford W 5 33/17 Hartford L 7 83/18 at Georgia L 3 83/21 at Georgia Southern * L 10 193/22 at Georgia Southern * L 12 133/23 at Georgia Southern * L 12 153/25 East Tennessee State W 12 113/26 at UNC Asheville @ W 12 103/28 UNC Greensboro * W 17 23/29 UNC Greensboro * L 3 73/30 UNC Greensboro * W 9 54/1 at Gardner-Webb W 13 64/2 UNC Asheville W 10 74/5 Davidson * W 22 74/5 Davidson * W 10 84/6 Davidson * W 8 44/8 at #14 South Carolina L 6 94/11 at Elon * L 1 164/12 at Elon * (11) L 2 34/13 at Elon * W 6 34/15 at Clemson W 6 24/18 at Appalachian State * L 2 64/20 at Appalachian State * L 8 124/20 at Appalachian State * (10) W 5 44/22 Clemson L 0 64/23 at Mercer (10) W 8 74/25 Furman * L 2 44/26 Furman * L 4 134/27 Furman * L 5 64/29 at Tennessee W 5 24/30 Gardner-Webb W 8 05/2 Wofford * W 5 35/3 Wofford * W 16 85/4 Wofford * W 9 45/9 at The Citadel * W 11 35/10 at The Citadel * (10) W 5 25/10 at The Citadel * W 11 25/16 College of Charleston * L 4 105/16 College of Charleston * L 9 205/17 College of Charleston * W 13 125/20 vs. Davidson ^ (12) W 11 105/21 vs. College of Charleston ^ L 4 55/22 vs. Appalachian State ^ L 5 10

* – Southern Conference Game% – Coastal Carolina Bash at the Beach (Myrtle Beach, SC)

$ – Rice Invitational (Houston, Texas)@ – Game played at Asheville’s McCormick Field

^ – Southern Conference Tournament (Charleston, SC)

2009 – 35-22 overall; 19-10 SoConHead Coach: Bobby Moranda, 2nd season (64-50, 33-23)

2/20 Bowling Green W 16 82/21 Bowling Green W 4 12/22 Bowling Green W 14 5

2/27 at #24 USC W 3 23/1 at #24 USC L 4 63/2 at #24 USC W 9 33/3 at #11 San Diego L 7 143/6 Appalachian State * W 4 03/7 Appalachian State * W 14 113/8 Appalachian State * W 4 33/10 East Tennessee State W 11 53/11 East Tennessee State W 6 53/13 at College of Charleston * L 3 93/14 at College of Charleston * W 8 23/15 at College of Charleston * L 4 73/17 High Point W 14 43/18 UNC Asheville 9 23/20 The Citadel * L 3 103/21 The Citadel * W 3 13/22 The Citadel * W 10 93/24 at Tennessee L 1 53/29 at Wofford * (10) W 14 103/29 at Wofford * W 19 24/1 at UNC Asheville @ W 11 04/2 Brigham Young L 1 04/3 Brigham Young L 11 154/4 Brigham Young L 12 184/7 at Kennesaw State L 10 124/8 Eastern Kentucky (11) W 24 234/11 #26 Georgia Southern * L 2 94/11 #26 Georgia Southern * W 5 24/12 #26 Georgia Southern * L 5 104/14 #18 Clemson L 1 114/15 at #18 Clemson L 2 134/17 Samford * (10) L 7 84/18 Samford * W 26 54/18 Samford * W 16 64/21 at #4 Georgia Tech L 7 164/22 #4 Georgia Tech W 10 94/24 at Furman * W 5 14/25 at Furman * (15) L 10 114/26 at Furman * W 6 44/28 at Charlotte W 8 64/29 Tennessee Tech W 11 05/1 at UNC Greensboro * W 10 35/2 at UNC Greensboro * W 9 45/3 at UNC Greensboro * W 9 45/8 #28 Elon * (11) L 11 135/9 #28 Elon * L 6 275/10 #28 Elon * L 2 75/13 at High Point W 10 55/14 at Davidson * (12) W 10 85/15 at Davidson * W 11 105/16 at Davidson * W 6 35/20 vs. College of Charleston ^ W 12 45/21 vs. #22 Elon ^ L 7 155/22 vs. Furman ^ L 6 7

* – Southern Conference Game@ – Game played at Asheville’s McCormick Field

^ – Southern Conference Tournament (Greenville, S.C.)

2010 – 37-21-1 overall; 16-13-1 SoConHead Coach: Bobby Moranda, 3rd season (101-71-1, 49-36-1)

2/19 Gardner-Webb W 14 92/20 at Gardner-Webb ! W 6 52/21 at Gardner-Webb ! W 6 32/23 at Charlotte W 5 32/26 Eastern Kentucky W 11 42/27 Eastern Kentucky L 9 122/28 Eastern Kentucky W 5 43/5 vs. West Virginia % W 1 03/6 vs. Illinois % W 4 23/7 at #11 East Carolina % L 4 53/9 SIU-Edwardsville W 6 03/10 SIU-Edwardsville W 12 8



3/12 at The Citadel * L 0 43/13 at The Citadel * L 5 73/14 at The Citadel * L 6 113/16 UNC Asheville W 10 33/17 Charlotte W 5 43/19 at Appalachian State * L 7 113/20 at Appalachian State * W 10 73/21 at Appalachian State * (6) T 4 43/26 College of Charleston * L 8 113/27 College of Charleston * W 4 33/27 College of Charleston * W 10 93/31 High Point W 17 114/2 New York Tech L 3 44/3 New York Tech W 12 44/4 New York Tech W 11 84/7 at Tennessee W 14 94/9 Wofford * W 5 44/10 Wofford * W 8 24/11 Wofford * L 2 54/14 at #16 Clemson W 7 54/16 at Elon * L 0 34/17 at Elon * W 14 84/18 at Elon * L 10 124/21 Tennessee L 8 184/23 at Georgia Southern * L 4 114/24 at Georgia Southern * W 11 34/25 at Georgia Southern * W 14 114/28 at Georgia L 10 134/30 UNC Greensboro * W 11 105/1 UNC Greensboro * L 3 55/2 UNC Greensboro * L 2 145/7 Furman * W 7 65/9 Furman * W 8 75/10 Furman * W 18 45/12 at High Point W 6 55/14 at Samford * L 6 75/15 at Samford * W 8 15/16 at Samford * L 5 85/18 at Tennessee Tech L 2 115/20 Davidson * (10) W 7 65/21 Davidson * W 7 55/22 Davidson * W 11 25/26 vs. Georgia Southern ^ W 11 45/27 vs. Col. of Charleston ^ (12) W 7 65/29 vs. Appalachian State ^ L 2 35/29 vs. Appalachian State ^ W 7 65/30 at The Citadel ^ L 3 10

! - Game played at Forest City’s McNair Field% – Keith LeClair Classic (Greenville, N.C.)

* – Southern Conference Game@ – Game played at Asheville’s McCormick Field

^ – Southern Conference Tournament (Charleston, S.C.)

2011 – 23-31-1 overall; 12-18 SoConHead Coach: Bobby Moranda, 4th season (124-102-2, 61-54-1)

2/18 Morehead State W 9 22/19 Morehead State W 18 02/20 Morehead State W 9 62/22 at Wake Forest (10) L 1 22/25 Manhattan L 6 112/26 Manhattan W 7 32/27 Manhattan W 9 83/1 at Eastern Kentucky L 8 123/2 at Eastern Kentucky W 5 03/4 vs. Akron ! W 9 83/11 at UNCG * L 4 53/12 at UNCG * L 4 113/13 at UNCG * L 6 93/15 at Kennesaw State W 5 13/16 UNC Asheville L 2 63/18 Elon * L 5 63/19 Elon * L 4 5


3/20 Elon * L 6 93/23 Gardner-Webb (9) T 8 83/25 at Davidson * W 2 13/27 at Davidson * W 7 13/27 at Davidson * (10) L 0 33/29 High Point W 11 04/1 at College of Charleston * L 3 64/2 at College of Charleston * L 8 154/3 at College of Charleston * L 3 154/6 at Clemson L 3 124/8 Samford * (12) W 4 34/9 Samford * W 3 24/10 Samford * L 6 114/12 at UNC Asheville @ L 4 74/15 Georgia Southern * W 12 44/16 Georgia Southern * L 7 84/17 Georgia Southern * L 13 164/22 Wofford * L 7 114/23 Wofford * W 11 04/24 Wofford * W 25 144/26 at High Point W 6 24/27 #18 Clemson L 4 64/29 San Diego State L 3 44/30 San Diego State L 5 115/1 San Diego State L 9 115/7 at Appalachian State * L 5 105/8 at Appalachian State * L 9 105/9 at Appalachian State * W 13 75/11 Kennesaw State L 2 65/13 at Furman * (16) W 14 135/14 at Furman * L 8 95/15 at Furman * L 7 145/19 The Citadel * W 7 55/20 The Citadel * W 6 05/21 The Citadel * W 12 85/25 vs. Elon ^ (20) W 10 75/26 vs. Georgia Southern ^ L 1 125/27 vs. College of Charleston ^ L 2 4

! - Game played at Forest City’s McNair Field* – Southern Conference Game

@ – Game played at Asheville’s McCormick Field^ – Southern Conference Tournament (Charleston, S.C.)

2012 – 32-24 overall; 16-14 SoConHead Coach: Bobby Moranda, 5th season (156-126-2, 77-68-1)

2/17 Fordham W 9 82/17 Fordham W 6 12/18 Fordham W 12 92/21 at Winthrop W 13 32/25 vs. Maryland % L 0 32/26 at #20 East Carolina % L 1 32/27 vs. Purdue % L 7 142/29 at #8 Georgia W 5 33/2 Iona W 2 03/3 Iona W 22 23/4 Iona W 8 43/6 Duke W 12 43/7 East Tennessee State W 7 33/9 at The Citadel * L 2 43/10 at The Citadel * W 11 43/11 at The Citadel * W 6 53/14 #23 Clemson W 8 43/16 at Jacksonville L 2 53/17 at Jacksonville W 2 13/18 vs. Fairfi eld ! W 10 33/21 at UNC Asheville @ (12) L 1 33/24 UNC Greensboro * W 16 23/24 UNC Greensboro * (11) W 6 53/25 UNC Greensboro * L 1 53/27 Kennesaw State L 9 113/28 at Kennesaw State (10) W 7 63/31 Davidson * W 12 6

3/31 Davidson * L 5 74/1 Davidson * W 5 34/4 at Clemson W 13 84/6 at Wofford * L 0 24/7 at Wofford * W 4 24/7 at Wofford * L 5 64/13 Furman * W 3 04/14 Furman * W 9 24/15 Furman * W 11 54/17 at Gardner-Webb L 4 64/20 at Samford * L 3 64/21 at Samford * L 2 44/22 at Samford * L 9 104/25 at East Tennessee State W 6 14/27 College of Charleston * L 4 54/28 College of Charleston * W 7 64/29 College of Charleston * L 2 65/5 at Elon * W 6 55/6 at Elon * W 11 95/7 at Elon * L 4 115/11 at Georgia Southern * W 4 05/12 at Georgia Southern * L 4 165/13 at Georgia Southern * L 1 25/15 Winthrop L 5 115/17 #24 Appalachian State * W 8 65/18 #24 Appalachian State * L 4 55/19 #24 Appalachian State * W 9 75/23 vs. Samford ^ L 0 75/24 vs. Furman ^ L 8 9

% - Keith LeClair Classic (Greenville, N.C.)* – Southern Conference Game

! - Game played at Sessions Stadium (Jacksonville, Fla.)@ – Game played at Asheville’s McCormick Field

^ – Southern Conference Tournament (Greenville, S.C.)



AKRON 1-0 Date Site Result03/04/11 N W, 9-8

ALLEN 2-0 Date Site Result1971 H W, 4-21971 H W, 9-0

APPALACHIAN STATE 75-44-1Date Site Result1969 H L, 3-41969 H L, 1-31970 H W, 10-91970 A L, 6-71971 H L, 3-41971 A L, 1-61971 N L, 5-61971 N L, 1-41972 H W, 10-31972 A W, 3-21973 A W, 5-11973 H W, 9-404/30/74 H L, 3-805/08/74 H L, 2-804/28/75 A L, 8-904/25/76 A W, 6-505/06/76 N W, 4-3 (10)1977 H W, 4-304/27/77 A W, 4-304/24/78 A W, 12-1004/17/78 H W, 9-504/04/79 H L, 7-1104/02/80 H L, 4-904/16/81 A W, 2-104/16/81 A W, 2-004/05/82 H W, 2-004/07/82 H W, 6-504/11/83 A W, 9-6 (12)04/11/83 A W, 4-004/28/84 N L, 5-903/20/85 H L, 6-1203/20/85 H W, 7-504/26/85 A W, 3-203/18/86 A L, 2-503/18/86 A L, 2-804/26/86 H W, 18-1704/26/86 H W, 11-803/17/87 H W, 9-403/17/87 H L, 0-704/25/87 N W, 8-703/23/88 A L, 2-303/23/88 A W, 9-204/29/88 N W, 18-804/22/89 H W, 11-1004/22/89 H L, 5-1604/23/89 H W, 5-305/02/89 N W, 7-204/13/90 A L, 2-1104/13/90 A W, 6-104/14/90 A L, 0-304/28/90 N W, 5-404/06/91 H L, 3-1304/06/91 H W, 4-104/07/91 H W, 15-904/28/91 N W, 4-003/28/92 A W, 4-103/28/92 A W, 10-603/29/92 A W, 8-204/24/93 A L, 3-704/24/93 A W, 13-5 (8)04/25/93 A W, 8-504/23/94 H W, 6-2

W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – A L L - T I M E S E R I E S H I S T O R Y

04/23/94 H L, 2-1304/24/94 H L, 4-604/14/95 A L, 4-604/14/95 A W, 8-704/15/95 A W, 17-1004/27/95 N W, 9-604/06/96 H L, 10-1804/06/96 H L, 12-1504/07/96 H W, 8-503/29/97 A W, 18-403/29/97 A W, 26-603/30/97 A W, 8-204/25/98 A W, 15-704/25/98 A W, 9-804/26/98 A W, 14-304/17/99 H W, 11-404/17/99 H L, 5-6 (7)04/18/99 H W, 5-403/18/00 A L, 2-503/18/00 A W, 12-6 (10)03/19/00 A L, 12-1303/31/01 H W, 7-303/31/01 H W, 18-704/01/01 H L, 11-13 (10)03/23/02 A W, 26-10 (8)03/23/02 A W, 17-3 (7)03/24/02 A W, 6-305/11/03 H L, 7-1205/11/03 H W, 10-505/12/03 H W, 10-805/22/04 A W, 10-805/22/04 A L, 4-505/23/04 A L, 11-1803/11/05 H W, 9-403/12/05 H W, 14-603/13/05 H W, 10-903/31/06 A W, 11-004/01/06 A L, 3-404/02/06 A W, 15-405/04/07 H W, 6-005/05/07 H W, 13-705/06/07 H L, 3-604/18/08 A L, 2-604/20/08 A L, 8-1204/20/08 A W, 5-4 (10)05/22/08 N L, 5-1003/06/09 H W, 4-003/07/09 H W, 14-1103/08/09 H W, 4-303/19/10 A L, 7-1103/20/10 A W, 10-703/21/10 A T, 4-405/29/10 N L, 2-305/29/10 N W, 7-605/07/11 A L, 5-1005/08/11 A L, 9-1005/09/11 A W, 13-705/17/12 H W, 8-605/18/12 H L, 4-505/19/12 H W, 9-7

ARIZONA STATE 0-1Date Site Result05/27/94 N L, 6-8

ARMSTRONG STATE 2-1Date Site Result1969 A W, 7-01970 A W, 5-41970 A L, 5-71972 A L, 1-6

ATLANTIC CHRISTIAN 0-2Date Site Result1969 H L, 2-61969 H L, 4-6

AUBURN 6-19Date Site Result02/12/88 A L, 0-302/13/88 A L, 3-702/14/88 A W, 4-102/14/88 A L, 0-102/10/89 A L, 2-1502/11/89 A W, 3-202/11/89 A L, 3-802/12/89 A L, 2-1505/20/89 A L, 6-1605/20/89 A L, 3-502/10/90 A W, 9-302/10/90 A W, 4-202/11/90 A L, 6-902/11/90 A W, 13-9 (8)02/08/91 A L, 16-1702/09/91 A L, 2-902/09/91 A W, 4-302/10/91 A L, 6-1305/22/97 N L, 3-1102/02/01 A L, 1-1402/03/01 A L, 2-402/04/01 A L, 4-502/13/04 A L, 4-502/14/04 A L, 1-402/15/04 A L, 0-6

AUGUSTA 1-2Date Site Result1971 A L, 3-403/26/91 H W, 7-603/27/91 H L, 6-8

AUSTIN PEAY STATE 2-1Date Site Result03/11/83 H W, 16-1503/11/83 H L, 2-303/12/83 H W, 14-7

BAPTIST COLLEGE 0-3Date Site Result03/18/74 A L, 2-504/13/76 H L, 8-1904/14/76 H L, 2-7

BINGHAMTON 2-0Date Site Result03/27/02 H W, 17-4 (7)03/28/02 H W, 10-7

BOWLING GREEN 3-0 Date Site Result02/20/09 H W, 16-802/21/09 H W, 4-102/22/09 H W, 14-5

BRINGHAM YOUNG 0-4 Date Site Result05/12/93 A L, 5-1204/02/09 H L, 1-004/03/09 H L, 11-1504/04/09 H L, 12-18

BROWN 1-1Date Site Result03/30/05 H L, 6-1003/31/05 H W, 18-9 (7)

BUTLER 1-1Date Site Result02/19/06 H L, 3-5 (10_02/19/06 H W, 4-2 (7)

CAMPBELL 24-21Date Site Result03/14/79 A L, 3-703/15/79 A W, 12-503/12/80 A W, 4-204/05/80 H W, 12-504/05/80 H W, 4-3 (9)03/20/81 A L, 6-703/20/81 A W, 9-804/25/81 H W, 12-704/25/81 H W, 11-71982 A L, 2-31982 A L, 1-1104/24/82 H W, 6-304/24/82 H W, 14-203/14/83 A L, 8-1303/15/83 A W, 9-304/04/83 H W, 6-304/04/83 H W, 8-51984 A L, 1-91984 A L, 2-31984 H L, 5-131984 H W, 6-503/12/85 A L, 4-1203/13/85 A L, 4-703/13/85 A L, 5-803/14/85 A W, 27-1403/26/85 H W, 12-503/26/85 H L, 2-603/10/86 A W, 9-103/11/86 A W, 11-803/11/86 A L, 4-703/12/86 A W, 4-204/15/86 H L, 11-1304/15/86 H L, 7-1603/03/87 H W, 9-703/03/87 H W, 5-303/09/87 A W, 7-403/10/87 A L, 8-1103/11/87 A L, 2-703/02/88 H W, 15-503/03/88 H L, 2-603/07/88 A W, 7-203/08/88 A L, 1-903/09/88 A L, 9-1004/13/89 H L, 0-404/13/89 H L, 0-4

CARSON-NEWMAN 16-7 Date Site Result03/11/78 A L, 12-1903/11/78 A W, 9-004/09/79 A W, 15-1004/09/79 A L, 4-503/31/80 H W, 11-904/04/81 A L, 6-703/27/82 A W, 17-1304/14/82 H W, 16-81984 A W, 13-51984 H L, 10-1104/18/85 A W, 15-1304/24/85 H W, 16-1304/02/86 A L, 15-1904/23/86 H W, 9-704/01/87 A L, 3-804/22/87 H W, 11-404/26/88 A W, 17-1003/01/89 H L, 1-303/01/89 H W, 8-104/18/89 A W, 10-404/25/89 H W, 15-004/03/90 A W, 8-604/20/90 H W, 13-2

A P PA L A C H I A N S TAT EA P PA L A C H I A N S TAT E




CATAWBA 1-2Date Site Result1969 A L, 6-81969 A W, 4-21969 N L, 1-2

CENTRAL FLORIDA 0-6Date Site Result02/02/96 A L, 4-502/03/96 A L, 8-1102/04/96 A L, 2-1202/11/00 A L, 2-702/12/00 A L, 0-2102/13/00 A L, 7-13

CHARLESTON SOUTHERN 9-6-1Date Site Result03/24/94 H W, 10-204/18/95 H L, 4-704/19/95 H W, 5-102/27/96 A L, 3-602/28/96 A T, 5-503/03/98 A W, 16-90304/98 H W, 8-203/04/98 H W, 4-104/14/98 H W, 12-404/15/98 H W, 14-005/13/05 H L, 8-1305/14/05 H W, 6-503/03/06 A L, 11-1503/04/06 A L, 4-703/05/06 A W, 11-1

CHATTANOOGA 4-6 Date Site Result04/22/78 A L, 2-304/22/78 A W, 11-304/07/79 H W, 7-604/07/79 H L, 6-1004/20/81 H W, 4-104/20/81 H W, 8-41982 A L, 1-71982 A L, 5-9

CLEMSON 15-54Date Site Result04/03/78 A L, 3-1203/08/79 A L, 3-804/01/79 H L, 3-1302/28/80 A L, 2-1004/10/80 H L, 8-1403/06/81 A L, 6-7 (10)03/08/82 A L, 0-503/30/82 H W, 10-304/05/83 A L, 3-804/29/83 H W, 13-704/05/84 A L, 3-504/12/84 H W, 9-204/23/85 H L, 2-904/04/86 H L, 0-804/17/86 A L, 7-1302/25/87 A L, 1-803/01/88 A L, 4-804/04/88 A L, 11-2004/14/88 H L, 4-1202/28/89 A L, 8-903/14/89 A L, 6-704/06/89 H L, 2-1404/10/89 A L, 4-1202/28/90 A L, 6-1403/31/91 H W, 9-704/03/91 A L, 3-1302/19/92 A L, 0-6

04/13/93 H L, 2-1204/15/93 A L, 1-802/12/94 A L, 1-302/12/93 A L, 1-402/13/94 A L, 5-6 (13)03/14/95 H L, 2-503/29/95 A L, 4-503/05/96 A L, 2-403/28/96 H L, 3-1304/09/96 H L, 4-1003/25/97 H W, 9-403/26/97 A L, 9-1403/17/98 A L, 1-503/19/98 H W, 10-704/06/99 H W, 9-8 (10)04/07/99 A L, 11-1605/04/99 A L, 10-1104/04/00 A L, 7-1104/26/00 N L, 4-1304/24/01 A L, 2-804/16/02 A L, 9-1305/15/02 H L, 4-1203/25/03 H W, 9-504/01/03 A L, 3-504/21/04 A L, 7-804/12/05 H L, 4-704/19/05 A L, 1-1004/04/06 A W, 8-604/11/06 H L, 3-803/20/07 H W, 6-303/28/07 A L, 6-1504/15/08 A W, 6-204/22/08 H L, 0-604/14/09 H L, 1-1104/15/09 A L, 2-1304/14/10 A W, 7-504/05/11 A L, 3-1204/27/11 H L, 4-603/14/12 H W, 8-404/04/12 A W, 13-8

COASTAL CAROLINA 1-7Date Site Result02/12/99 A W, 5-202/13/99 A L, 3-502/14/99 A L, 9-1102/24/01 A L, 2-1302/08/03 A L, 3-802/09/03 A L, 3-403/06/05 A L, 3-403/02/08 A L, 1-7

COLLEGE OF CHARLESTON 16-36Date Site Result05/08/99 A L, 7-805/08/99 A L, 1-2 (7)05/09/99 A W, 15-605/22/99 N W, 3-204/07/00 H L, 7-1104/08/00 H L, 5-1004/09/00 H W, 15-603/09/01 A L, 2-303/10/01 A W, 7-303/11/01 A L, 2-505/17/01 N L, 7-904/12/02 A L, 3-704/13/02 A W, 8-704/14/02 A W, 13-905/23/02 N L, 0-305/16/03 A W, 3-205/17/03 A L, 2-305/18/03 A L, 2-303/12/04 H L, 3-19

03/13/04 H L, 10-1103/14/04 H L, 0-705/26/04 N W, 4-303/18/05 A L, 1-203/19/05 A L, 8-903/20/05 A L, 5-1705/27/05 N L, 4-1104/14/06 H L, 1-1704/15/06 H L, 6-1404/16/06 H W, 5-405/25/06 N L, 0-103/23/07 A L, 6-703/24/07 A L, 8-1803/25/07 A L, 7-805/16/08 H L, 4-1005/16/08 H L, 9-2005/17/08 H W, 13-1205/21/08 N L, 4-503/13/09 A L, 3-903/14/09 A W, 8-203/15/09 A L, 4-705/20/09 N W, 12-403/26/10 H L, 8-1103/27/10 H W, 4-303/28/10 H W, 10-905/27/10 N W, 7-6 (12)04/01/11 A L, 3-604/02/11 A L, 8-1504/03/11 A L, 3-1505/27/11 N L, 2-404/27/12 H L, 4-504/28/12 H W, 7-604/29/12 H L, 2-6

COLUMBIA 3-0Date Site Result03/16/07 H W, 10-903/17/07 H W, 17-1103/18/07 H W, 14-6

CONNECTICUT 2-1Date Site Result02/23/07 H W, 16-502/24/07 H L, 1-802/25/07 H W, 16-5

CREIGHTON 1-0Date Site Result03/07/08 N W, 11-8

DAVIDSON 86-25Date Site Result03/26/77 A W, 9-503/26/77 A W, 12-904/18/78 H W, 7-104/18/78 H W, 6-004/17/79 H W, 4-004/17/79 H L, 2-703/23/80 H W, 8-50/23/80 H W, 10-203/28/81 A W, 1-003/28/81 A W, 9-605/01/82 H W, 5-105/01/82 H W, 17-1304/30/83 A W, 10-404/30/83 A W, 16-101984 A W, 16-21984 A W, 7-41984 A W, 19-71984 H W, 3-21984 H L, 3-503/30/85 H W, 11-1003/30/85 H L, 4-6

04/20/85 A L, 2-304/20/85 A L, 9-1004/21/85 A L, 1-41985 N W, 13-203/28/86 A L, 2-1603/28/86 A L, 3-703/29/86 A L, 5-1604/19/86 H L, 0-1004/19/86 H W, 8-704/20/86 H W, 8-503/28/87 H L, 1-1403/28/87 H W, 5-203/29/87 H W, 10-404/17/87 A W, 14-1004/17/87 A W, 9-604/01/88 A L, 7-1104/01/88 A W, 7-304/02/88 A W, 12-804/23/88 H W, 9-204/23/88 H W, 8-304/24/88 H W, 16-1103/05/90 A W, 6-403/06/90 A W, 22-103/02/92 A L, 7-1103/13/92 H W, 13-1104/08/92 H W, 15-503/06/93 H W, 9-703/07/93 H W, 10-503/07/93 H W, 10-503/05/94 A L, 7-803/05/94 A W, 7-403/06/94 A W, 9-704/28/94 N L, 1-202/25/95 H W, 7-002/25/95 H W, 5-202/26/95 H W, 5-204/20/96 A W, 9-604/21/96 A W, 7-5 (8)04/21/96 A W, 11-604/12/97 H W, 11-104/12/97 H W, 9-404/13/97 H L, 9-1103/21/98 A W, 11-603/22/98 A W, 12-203/22/98 A W, 9-703/27/99 H W, 9-303/28/99 H L, 8-11 (7)03/28/99 H W, 15-704/29/00 A L, 3-404/30/00 A W, 15-404/30/00 A L, 2-305/05/01 H W, 8-705/05/01 H W, 13-705/06/01 H W, 7-004/20/02 A L, 4-504/20/02 A W, 4-004/21/02 A W, 4-1 (10)03/14/03 A W, 11-0 (7)03/15/03 A W, 5-403/16/03 A W, 9-005/21/03 N W, 14-003/26/04 H L, 4-503/27/04 H W, 12-1003/28/04 H W, 3-2 (10)04/01/05 A L, 2-504/02/05 A W, 13-1104/04/05 A W, 7-404/28/06 H W, 6-004/29/06 H L, 6-1204/30/06 H W, 5-304/05/07 A W, 13-1104/06/07 A W, 10-404/07/07 A W, 2-104/05/08 H W, 22-704/05/08 H W, 10-804/06/08 H W, 8-4

C L E M S O NC L E M S O N

D AV I D S O ND AV I D S O N

COLLEGE OF CHARLESTONCOLLEGE OF CHARLESTON




05/20/08 N W, 11-10 (12)05/14/09 A W, 10-8 (12)05/15/09 A W, 11-1005/15/09 A W, 6-305/20/10 H W, 7-605/21/10 H W, 7-505/22/10 H W, 11-203/25/11 A W, 2-103/27/11 A W, 7-103/27/11 A L, 0-3 (10)03/31/12 H W, 12-603/31/12 H L, 5-704/01/12 H W, 5-3

DELAWARE 1-0Date Site Result02/25/01 N W, 7-6

DUKE 3-1Date Site Result03/23/74 A W, 3-203/23/74 A W, 2-103/08/75 A W, 3-003/08/75 A L, 2-3

EAST CAROLINA 2-15 Date Site Result03/15/76 A L, 1-51977 H W, 8-41977 H L, 1-403/07/90 A L, 2-703/08/90 A L, 0-1203/02/91 H L, 6-802/09/97 N L, 4-502/09/01 A L, 5-902/10/01 A L, 5-90211/01 A L, 1-1202/14/03 A L, 4-602/14/03 A L, 2-402/15/03 A L, 1-203/04/07 A L, 2-306/01/07 N L, 8-906/03/07 N W, 9-503/07/10 A L, 4-502/25/12 A L, 1-3

EAST TENNESSEE 59-28Date Site Result04/16/74 H W, 7-104/10/75 H W, 9-304/24/75 A W, 19-704/27/76 H L, 5-604/27/76 H W, 20-503/31/77 H W, 12-904/17/78 A L, 4-1204/19/79 A L, 0-104/01/80 H L, 2-604/28/80 H L, 6-804/01/81 H W, 11-1004/01/81 H L, 5-71981 N L, 4-904/18/82 A L, 2-1604/18/82 A W, 2-104/26/83 H W, 5-304/26/83 H L, 8-121984 A W, 7-31984 A W, 5-21984 H L, 0-101984 H W, 6-404/02/85 H L, 8-904/25/86 H W, 11-204/14/87 A W, 10-804/15/87 H L, 5-6

04/20/88 H W, 10-503/24/89 A L, 3-503/25/89 A W, 16-403/25/89 A W, 10-003/17/90 H W, 12-103/18/90 H W, 5-003/18/90 H W, 11-404/26/90 N W, 6-103/09/91 A W, 5-103/09/91 A W, 8-403/10/91 A W, 7-504/26/91 N L, 4-704/28/91 N W, 9-404/17/92 H W, 5-304/17/92 H W, 3-004/18/92 H W, 6-303/12/94 A W, 10-803/12/94 A W, 2-103/13/94 A W, 13-604/29/94 N W, 4-004/29/95 N L, 1-602/24/96 A W, 5-102/24/96 A L, 1-502/25/96 A W, 7-404/19/97 H W, 9-804/19/97 H W, 11-1004/20/97 H W, 8-604/16/98 A W, 9-804/22/98 A W, 10-904/22/98 A L, 4-1004/10/99 H W, 18-3 (7)04/10/99 H W, 11-10 (10)04/11/99 H L, 9-1205/21/99 N W, 7-504/14/00 A L, 6-1204/15/00 A L, 2-304/16/00 A L, 4-504/13/01 H W, 9-804/14/01 H L, 5-905/15/01 H W, 8-705/10/02 A W, 16-305/11/02 A W, 7-605/12/02 A L, 10-1603/21/03 H W, 20-103/22/03 H W, 13-1203/23/03 H W, 9-504/03/04 A W, 8-404/03/04 A W, 8-404/05/04 A L, 3-404/08/05 H W, 13-304/09/05 H L, 3-404/10/05 H W, 9-804/18/06 H W, 7-105/16/06 H L, 8-1603/06/07 A W, 7-404/18/07 H W, 7-303/25/08 H W, 12-1103/10/09 H W, 11-503/11/09 H W, 6-503/07/12 H W, 7-304/25/12 A W, 6-1

EASTERN KENTUCKY 24-11Date Site Result03/26/83 H W, 9-8 (8)03/27/83 H W, 10-904/15/83 A L, 5-81984 H L, 3-41984 H W, 3-203/02/85 H W, 7-603/02/85 H W, 10-603/03/85 H L, 3-903/03/85 H L, 0-2

03/01/86 H L, 4-603/01/86 H W, 5-303/02/86 H W, 12-503/02/86 H W, 10-803/12/87 H W, 8-403/12/87 H W, 17-202/27/88 H W, 11-102/27/88 H L, 3-702/28/88 H W, 12-002/28/88 H W, 14-203/03/90 H L, 6-903/03/90 H W, 25-703/04/90 H L, 7-8 (8)03/04/90 H W, 10-304/07/94 H W, 13-404/07/94 H W, 5-203/04/95 H L, 5-803/04/95 H L, 4-1003/05/95 H W, 5-403/12/96 A W, 4-303/13/96 A W, 11-804/16/96 H W, 14-1004/17/96 H W, 12-1104/08/09 H W, 24-2302/26/10 H W, 11-402/27/10 H L, 9-1202/28/10 H W, 5-403/01/11 A L, 8-1203/02/11 A W, 5-0

ELON 18-21Date Site Result1969 A W, 3-11969 A W, 4-203/09/85 A L, 2-703/09/85 A L, 1-203/09/86 A L, 0-503/25/87 H W, 5-204/22/00 H L, 4-1004/22/00 H W, 3-1 (7)04/23/00 H L, 9-1104/30/04 A W, 12-305/01/04 A L, 8-1105/02/04 A L, 4-905/27/04 N W, 7-605/07/05 H W, 7-205/08/05 H W, 9-405/09/05 H W, 12-1003/10/06 A L, 10-1303/11/06 A W, 6-103/12/06 A L, 3-1604/20/07 H W, 4-204/21/07 H W, 4-304/22/07 H W, 5-404/11/08 A L, 1-1604/12/08 A L, 2-3 (11)04/13/08 A W, 6-305/08/09 H L, 11-13 (11)05/09/09 H L, 6-2705/10/09 H L, 2-705/21/09 N L, 7-1504/16/10 A L, 0-304/17/10 A W, 14-804/18/10 A L, 10-1203/18/11 H L, 5-603/19/11 H L, 4-503/20/11 H L, 6-905/25/11 N W, 10-7 (20)05/05/12 A W, 6-505/06/12 A W, 11-905/07/12 A L, 4-11

E LO NE LO N

EMORY AND HENRY 2-0Date Site Result1970 H W, 10-81970 A W, 16-2

ERSKINE 12-8Date Site Result1969 A L, 0-91969 H L, 4-121970 H L, 6-81970 H L, 5-81971 A L, 2-91971 H W, 8-41972 A L, 0-41972 H L, 2-51972 N W, 6-21973 A W, 6-11973 H W, 8-703/18/74 A L, 2-305/02/74 H W, 8-004/09/75 A W, 4-204/18/75 H W, 7-004/29/77 H W, 4-304/12/78 A W, 11-203/27/79 H L, 9-1004/29/80 A W, 10-504/27/81 H W, 11-703/22/82 A W, 14-6

FAIRFIELD 2-0Date Site Result03/20/76 H W, 7-403/18/12 N W, 10-3

FLORIDA 3-9Date Site Result02/07/87 A L, 7-902/07/87 A W, 12-302/08/87 A L, 12-1302/06/88 A W, 3-102/06/88 A L, 6-902/07/88 A L, 2-702/04/89 A L, 3-502/04/89 A L, 9-1402/05/89 A L, 1-1802/03/90 A W, 2-102/03/90 A L, 2-1802/04/90 A L, 1-13

FLORIDA INTERNATIONAL 2-3 Date Site Result1984 A L, 2-71984 A W, 7-01984 A L, 0-71984 A W, 4-11984 H L, 9-19

FLORIDA STATE 1-4Date Site Result05/21/92 A W, 1-005/24/92 A L, 3-405/24/92 A L, 3-1802/26/02 A L, 3-1302/27/02 A L, 0-3

FRANCIS MARION 2-3Date Site Result03/29/78 A L, 9-1203/13/79 A L, 7-1703/14/80 A W, 14-1003/14/82 A L, 6-903/14/82 A W, 10-8

E A S T T E N N E S S E E S TAT EE A S T T E N N E S S E E S TAT E

E A S T E R N K E N T U C K YE A S T E R N K E N T U C K Y



F U R M A NF U R M A N


FORDHAM 3-0Date Site Result02/17/12 H W, 9-802/17/12 H W, 6-102/18/12 H W, 12-9

FURMAN 90-35Date Site Result03/23/68 A L, 4-703/30/70 H L, 3-403/24/71 A W, 4-204/11/71 H L, 1-204/24/72 H L, 5-604/26/73 A W, 4-305/07/73 H L, 4-1304/30/75 A W, 13-703/29/76 H W, 12-204/15/76 A L, 2-704/09/77 H W, 7-604/09/77 H W, 12-403/18/78 A L, 10-1103/31/79 A W, 4-104/10/79 H W, 4-303/25/80 A W, 6-404/08/80 H W, 7-503/23/81 H W, 7-403/23/81 H W, 10-804/20/82 A W, 7-404/21/82 A W, 9-204/09/83 H W, 7-204/09/83 H W, 4-303/16/84 A W, 10-803/17/84 A W, 12-203/17/84 A W, 11-104/07/84 H L, 3-504/07/84 H L, 5-604/08/84 H W, 6-103/16/85 H W, 5-303/16/85 H W, 8-103/17/85 H L, 9-1004/05/85 A W, 9-704/05/85 A W, 4-204/06/85 A W, 12-603/14/86 A W, 11-703/14/86 A W, 10-304/05/86 H W, 2-104/05/86 H W, 7-104/06/86 H W, 15-403/14/87 H L, 2-603/14/87 H W, 6-403/15/87 H W, 5-204/04/87 A L, 7-1004/04/87 A W, 10-103/19/88 A W, 8-503/19/88 A W, 9-004/09/88 H W, 6-404/09/88 H W, 4-204/10/88 H W, 6-403/11/89 A L, 2-303/11/89 A W, 4-303/12/89 A W, 10-004/21/90 H L, 6-704/21/90 H W, 5-204/22/90 H W, 15-304/28/91 N L, 9-1104/04/92 H W, 14-704/04/92 H W, 8-304/05/92 H L, 7-803/20/93 H W, 23-703/20/93 H W, 9-203/21/93 H W, 13-603/19/94 A W, 6-503/19/94 A W, 5-3

03/20/94 A W, 7-003/11/95 H W, 10-903/11/95 H L, 3-403/12/95 H W, 12-803/02/96 A W, 12-603/03/96 A L, 2-1203/03/96 A W, 11-604/26/96 N L, 4-702/22/97 H W, 10-602/22/97 H W, 12-302/23/97 H W, 10-404/25/97 N W, 7-104/27/97 N W, 10-904/01/98 H W, 7-104/01/98 H W, 6-504/02/98 H W, 6-405/02/98 N W, 2-105/01/99 A W, 12-1105/01/99 A W, 13-305/02/99 A W, 10-905/21/99 N W, 11-403/25/00 H L, 13-2403/25/00 H L, 5-803/26/00 H L, 9-1304/20/01 A L, 8-1104/21/01 A L, 1-604/22/01 A W, 7-503/29/02 H W, 8-303/31/02 H W, 7-603/31/02 H W, 11-303/28/03 A W, 3-203/29/03 A W, 6-503/30/03 A L, 2-405/22/03 N W, 6-004/09/04 H W, 9-604/10/04 H W, 10-404/11/04 H W, 8-604/15/05 A L, 2-1404/16/05 A L, 0-1204/17/05 A L, 2-805/19/06 H L, 4-505/20/06 H W, 7-505/20/06 H L, 6-1005/24/06 N W, 14-104/27/07 A L, 3-504/28/07 A W, 12-404/29/07 A W, 8-504/25/08 H L, 2-404/26/08 H L, 4-1904/27/08 H L, 5-604/24/09 A W, 5-104/25/09 A L, 10-11 (15)04/26/09 A W, 6-405/22/09 N L, 6-705/08/10 H W, 7-605/09/10 H W, 8-705/10/10 H W, 18-405/13/11 A W, 14-13 (16)05/14/11 A L, 8-905/15/11 A L, 7-1404/13/12 H W, 3-004/14/12 H W, 9-204/15/12 H W, 11-505/24/12 N L, 8-9

GARDNER-WEBB 11-4-1Date Site Result1970 H L, 4-504/06/78 A W, 9-604/27/78 H W, 27-603/11/03 A W, 8-304/16/03 H L, 7-1103/16/04 A W, 11-2

05/19/04 H W, 4-305/17/05 H L, 7-1203/22/06 H W, 8-404/26/06 A L, 5-1004/01/08 A W, 13-604/30/08 H W, 8-002/19/10 H W, 14-902/20/10 N W, 6-502/21/10 N W, 6-303/23/11 H T, 8-8 (9)04/17/12 L 4-6

GEORGE MASON 3-2-1 Date Site Result03/07/76 H W, 7-41977 H W, 13-71977 H L, 12-1403/15/78 H W, 14-1303/16/78 H T, 16-1603/01/08 N L, 6-12

GEORGIA 18-35Date Site Result1970 A L, 3-51971 A W, 11-71972 A L, 2-41972 A L, 2-704/22/75 A L, 0-505/03/75 H W, 6-504/04/76 H L, 3-704/06/76 A L, 1-1004/28/77 H W, 22-1504/04/78 A L, 5-1403/01/81 A W, 9-61982 A L, 7-1004/23/82 H W, 14-1302/27/83 A L, 1-1903/30/83 H L, 8-141984 A W, 11-402/27/85 A L, 11-1202/26/86 A L, 7-1004/07/87 A L, 8-1104/08/87 A W, 11-903/29/88 A L, 2-303/30/88 A L, 2-602/25/89 A L, 0-102/25/89 A W, 8-504/05/89 A L, 2-1004/05/89 A L, 5-1002/27/90 A L, 6-1404/17/90 A L, 11-1204/18/90 A L, 3-1503/11/92 A W, 13-11 (14)03/26/92 H W, 8-403/09/93 A L, 4-503/10/93 A L, 9-1103/08/94 A W, 10-102/20/96 A L, 0-302/21/96 A W, 7-502/18/97 A L, 6-902/19/97 A W, 3-103/24/98 A L, 5-802/23/99 A L, 0-602/24/99 A L, 11-1502/24/00 H L, 3-2305/01/01 A L, 2-704/23/02 A L, 11-1805/11/05 A W, 2-103/15/06 A L, 0-1104/25/06 A W, 7-503/14/07 A W, 3-104/25/07 H L, 7-1203/18/08 A L, 3-8

04/28/10 A L, 10-1302/29/12 A W, 5-3

GEORGIA SOUTHERN 53-53Date Site Result1970 A L, 2-31970 A L, 3-51971 A L, 1-21971 A W, 6-104/02/72 A L, 1-604/03/72 A W, 7-503/24/73 A L, 5-803/29/74 A L, 2-1003/30/74 A L, 0-1403/30/74 A L, 0-131975 A L, 0-81975 A L, 8-1102/14/85 A L, 0-502/15/85 A L, 7-1102/16/85 A W, 10-902/17/85 A L, 3-402/13/86 A L, 6-1102/14/86 A W, 4-302/15/86 A W, 8-702/16/85 A W, 6-503/12/87 A L, 5-603/12/87 A W, 14-1202/14/87 A L, 0-1002/15/87 A W, 8-703/22/92 H W, 3-003/23/92 H W, 3-103/23/92 H W, 18-604/25/92 N W, 17-1004/26/92 N L, 12-1404/26/92 N W, 4-303/27/93 A W, 1-003/27/93 A W, 6-103/28/93 A L, 0-205/02/93 N W, 6-5 (10)03/26/94 H W, 5-203/26/94 H W, 10-203/18/95 A L, 2-903/18/95 A W, 6-203/19/95 A L, 2-904/28/95 N L, 4-1003/09/96 H L, 10-1703/09/96 H W, 3-203/10/96 H W, 9-803/01/97 A L, 13-1503/01/97 A W, 7-603/02/97 A W, 18-603/14/98 A W, 10-603/14/98 A W, 12-203/15/98 A L, 3-404/30/98 N W, 6-505/15/99 H L, 10-12 (11)05/15/99 H L, 10-11 (7)05/16/99 H W, 12-1105/19/99 H L, 5-805/06/00 A L, 7-805/06/00 A L, 5-605/07/00 A L, 5-603/23/01 H W, 13-1203/24/01 H L, 3-1703/25/01 H W, 13-804/26/02 A L, 2-404/27/02 A W, 6-304/28/02 A W, 14-1104/04/03 H W, 7-504/05/03 H W, 16-104/06/03 H W, 12-205/24/03 N W, 1-005/25/03 N L, 4-8 (11)

G E O R G I A S O U T H E R NG E O R G I A S O U T H E R N

G A R D N E R - W E B BG A R D N E R - W E B B

G E O R G I AG E O R G I A




05/25/03 N W, 6-504/22/05 H L, 5-1704/23/05 H W, 11-604/24/05 H L, 5-605/26/05 N L, 2-704/07/06 A L, 0-1704/09/06 A L, 1-704/09/07 A W, 4-205/26/06 N W, 13-305/17/07 H W, 4-105/18/07 H W, 8-30519/07 H L, 2-505/24/07 N L, 5-603/21/08 A L, 10-1903/22/08 A L, 12-1303/23/08 A L, 12-1504/11/09 H L, 2-904/11/09 H W, 5-204/12/09 H L, 5-1004/23/10 A L, 4-1104/24/10 A W, 11-304/25/10 A W, 14-1105/26/10 N W, 11-404/15/11 H W, 12-404/16/11 H L, 7-804/17/11 H L, 13-1605/26/11 N L, 1-1205/11/12 A W, 4-005/12/12 A L, 4-1605/13/12 A L, 1-2

GEORGIA STATE 8-6Date Site Result03/27/80 A L, 3-705/03/80 H L, 2-31982 H W, 26-803/28/00 H L, 9-1303/29/00 H L, 8-2104/10/01 A L, 3-404/11/01 A W, 13-703/20/02 A L, 5-9 (10)04/22/03 H W, 21-1004/23/03 H W, 9-7 (10)03/30/04 A W, 10-9 (13)03/31/04 A L, 10-1104/16/04 A L, 5-604/17/04 A L, 5-604/18/04 A L, 0-303/09/05 H W, 3-103/09/05 H W, 12-7

GEORGIA TECH 16-18Date Site Result1971 A L, 2-41973 A L, 3-504/27/74 A W, 10-504/24/74 A L, 6-1004/26/75 A W, 7-504/10/76 A L, 0-1404/11/76 A L, 0-904/30/77 A W, 14-503/03/79 A W, 3-103/07/81 A W, 5-403/08/81 A W, 8-202/25/83 A L, 5-1402/26/83 A L, 9-1604/08/86 A W, 4-304/09/86 A L, 11-1305/24/86 N L, 7-803/12/91 A W, 10-503/13/91 A W, 14-203/10/92 A L, 10-1103/22/93 A L, 1-403/23/93 A L, 1-402/22/95 A W, 10-903/07/95 A L, 0-603/08/95 A W, 13-7

03/11/97 A W, 13-703/12/97 A L, 0-1403/23/99 A L, 0-204/10/02 A L, 1-203/09/04 A L, 3-403/10/04 A W, 9-503/29/05 A W, 8-503/28/06 A L, 5-1902/27/07 A W, 12-104/21/09 A L, 7-604/22/09 H W, 10-9

GRAND CANYON 1-1Date Site Result05/10/93 N W, 10-805/11/93 N L, 22-25

GREENSBORO COLLEGE 1-0 Date Site Result04/26/94 H W, 6-5

GUILFORD 1-0Date Site Result1969 H W, 6-2

HARTFORD 4-1Date Site Result03/21/06 H W, 24-1203/21/06 H W, 11-003/16/08 H W, 32-303/16/08 H W, 5-303/17/08 H L, 7-8

HIGH POINT 28-7Date Site Result1969 A L, 2-51969 A L, 0-201969 N L, 1-503/14/81 A W, 14-503/15/81 A L, 6-904/04/82 H W, 12-404/04/82 H W, 14-1203/16/83 A W, 11-41984 A W, 9-11984 A W, 4-21984 A W, 16-303/10/85 A W, 7-103/10/85 A L, 1-203/10/85 A L, 7-803/07/86 H W, 24-203/08/86 H W, 8-103/08/86 H L, 7-903/06/87 A W, 12-703/07/87 A W, 6-203/07/87 A L, 2-1303/08/87 A W, 10-303/04/88 A W, 8-603/05/88 A W, 15-903/06/88 A W, 16-303/04/91 A W, 10-103/05/91 A W, 17-603/10/99 H W, 15-803/10/99 H W, 10-403/31/99 A T, 8-802/12/03 H W, 11-104/24/07 A W, 15-805/15/07 H W, 4-003/17/09 H W, 14-405/13/09 A W, 10-503/31/10 H W, 17-1105/12/10 A W, 6-503/29/11 H W, 11-004/26/11 A W, 6-2

ILLINOIS 2-1Date Site Result03/27/86 H L, 14-1502/26/05 N W, 14-1303/06/10 N W, 4-2

INDIANA STATE 0-1Date Site Result05/26/89 N L, 3-10

IONA 3-0Date Site Result03/02/12 H W, 2-003/03/12 H W, 22-203/04/12 H W, 8-4

JACKSONVILLE 2-3Date Site Result03/01/93 A L, 0-903/02/93 A L, 1-1806/02/07 N W, 7-003/16/12 A L, 2-503/17/12 A W, 2-1

JACKSONVILLE STATE 2-1Date Site Result02/01/97 A W, 7-602/01/97 A L, 1-1002/02/97 A W, 10-9

JAMES MADISON 1-0 Date Site Result03/05/05 N W, 4-3

KENNESAW STATE 7-4Date Site Result05/12/06 H W, 6-305/13/06 H W, 5-405/14/06 H W, 9-702/16/07 A W, 9-602/17/07 A W, 10-602/18/07 A L, 3-504/07/09 A L, 10-1203/15/11 A W, 5-105/11/11 H L, 2-603/27/12 H L, 9-1103/28/12 A W, 7-6 (10)

KENT STATE 3-2Date Site Result05/22/92 N W, 14-105/29/93 N L, 5-803/26/96 H L, 4-904/08/98 A W, 6-502/23/01 N W, 9-503/04/05 N W, 4-1

LA SALLE 0-1Date Site Result05/24/85 N L, 12-13

LE MOYNE 1-0Date Site Result05/31/03 N W, 9-5

LEHIGH 0-1Date Site Result1970 N W, 6-31973 A L, 0-14

LENOIR-RHYNE 6-0Date Site Result1969 H W, 5-41969 H W, 7-003/22/79 H W, 8-404/16/80 A W, 6-104/16/80 A W, 11-803/22/95 H W, 13-11

LIBERTY 6-0Date Site Result03/11/88 H W, 11-1003/12/88 H W, 13-203/12.88 H W, 7-403/01/03 H W, 9-603/01/03 H W, 9-803/02/03 H W, 4-3

LINCOLN MEMORIAL 2-0Date Site Result04/27/93 H W, 14-704/13/94 H W, 7-5

LOUISIANA STATE 0-1Date Site Result05/27/93 A L, 2-7

MAINE 1-4Date Site Result05/10/91 A L, 4-605/11/91 A L, 1-305/11/91 A W, 14-705/12/91 A L, 11-1405/13/91 A L, 13-14

MANHATTAN 2-1Date Site Result02/25/11 H L, 6-1102/26/11 H W, 7-302/27/11 H W, 9-8

MARIST 1-0Date Site Result05/23/97 N W, 8-3

MARSHALL 38-14Date Site Result04/23/77 A W, 1-004/23/77 A W, 3-204/08/78 H L, 3-604/08/78 H L, 3-604/21/79 A L, 1-304/21/79 A L, 2-1504/19/80 H W, 4-304/19/80 H L, 1-404/11/81 A L, 0-104/11/81 H W, 9-21981 N L, 3-503/28/82 H W, 6-503/28/82 H W, 3-004/16/83 A L, 5-804/16/83 A L, 3-51985 N L, 2-51985 N W, 12-61985 N W, 13-1205/02/89 N W, 4-203/31/90 H W, 10-703/31/90 H L, 5-604/01/90 H W, 17-1304/27/90 N L, 1-304/28/90 N W, 11-303/23/91 A W, 7-303/23/91 A W, 17-003/14/92 H W, 6-403/14/92 H W, 3-103/15/92 H W, 29-104/03/93 H L, 3-6

KENNESAW STATEKENNESAW STATE




04/03/93 H W, 15-304/04/93 H W, 13-404/29/93 N W, 7-604/02/94 A W, 7-404/02/94 A W, 5-4 (8)04/03//94 A W, 8-504/30/94 N W, 8-203/25/95 H L, 9-1003/25/95 H W, 3-103/26/95 H W, 20-604/29/95 N W, 10-303/16/96 A W, 10-603/16/96 A W, 4-303/17/96 A W, 7-103/08/97 H W, 15-403/08/97 H W, 10-203/09/97 H L, 3-403/10/97 H W, 20-1002/22/08 H L, 9-1402/23/08 H W, 11-502/24/08 H W, 12-803/02/08 N W, 9-7

MARYLAND 0-1Date Site Result02/25/12 N L, 0-3

MARS HILL 7-3Date Site Result1969 H W, 10-41969 A L, 2-71970 A W, 7-61970 H W, 9-11971 H W, 1-01971 H W, 16-21972 A W, 10-01972 A L, 3-504/17/74 H W, 12-005/07/74 A W, 4-31976 H L, 6-8

MARYVILLE 1-0Date Site Result1971 H W, 10-6

MERCER 1-1Date Site Result03/07/07 H L, 10-1304/23/08 A W, 8-7

MIAMI (FLA.) 2-5Date Site Result05/23/86 A L, 8-1005/28/93 N W, 10-505/13/94 A L, 2-705/14/94 A L, 2-805/15/94 A L, 4-5

MIAMI (OHIO) 5-1Date Site Result03/22/97 H W, 12-603/22/97 H W, 3-003/23/97 H W, 11-803/06/04 H W, 12-1103/06/04 H W, 14-1203/07/04 H L, 8-12

MICHIGAN STATE 0-1Date Site Result03/06/08 N L, 3-5

MIDDLE TENNESSEE 1-2 Date Site Result04/15/89 H W, 4-104/15/89 H L, 2-304/16/89 H L, 3-13

MILLIGAN 5-0Date Site Result04/04/90 H W, 12-504/10/90 H W, 18-004/15/91 A W, 9-104/15/91 A W, 7-503/22/96 H W, 12-7

MISSISSIPPI STATE 1-2Date Site Result05/23/87 N W, 8-105/26/88 A L, 4-705/25/89 N L, 0-8

MONTREAT 2-0Date Site Result04/25/95 H W, 9-504/23/96 H W, 19-5

MOREHEAD STATE 5-1 Date Site Result03/14/96 A W, 9-704/08/97 H L, 3-904/09/97 H W, 13-502/18/11 H W, 9-202/19/11 H W, 18-002/20/11 H W, 9-6

MORRIS HARVEY 0-1Date Site Result1972 N L, 3-4

NEWBERRY 6-0Date Site Result1969 A W, 13-21969 A W, 2-01972 N W, 4-11972 N W, 4-104/07/90 H W, 5-404/07/90 H W, 17-204/08/90 H W, 8-3

NEW MEXICO 1-0Date Site Result02/27/05 N W, 14-13 (12)

NEW YORK TECH 2-1Date Site Result04/02/10 H L, 3-404/03/10 H W, 12-404/04/10 H W, 11-8

NORTH CAROLINA 2-12 Date Site Result1973 A W, 5-1 (12)03/24/74 A L, 2-403/23/75 A L, 0-403/17/76 A L, 1-403/14/77 A L, 1-303/14/77 A W, 3-203/10/80 A L, 1-12

03/10/80 A L, 1-505/13/85 A L, 0-1105/14/85 A L, 0-905/15/85 A L, 4-703/07/00 A L, 8-1103/08/00 A L, 1-406/04/07 A L, 5-6

NORTH CAROLINA A&T 8-0 Date Site Result02/27/99 H W, 9-802/28/99 H W, 20-0 (5)02/28/99 H W, 13-204/24/01 H W, 13-12 (10)04/28/01 H W, 18-4 (7)04/29/01 H W, 9-303/03/02 H W, 16-303/03/02 H W, 18-1

NORTH CAROLINA STATE 8-25 Date Site Result1984 A W, 7-61984 A L, 4-141984 A L, 2-161984 A W, 5-302/23/85 A W, 4-202/23/85 A W, 10-602/24/85 A L, 3-1302/24/85 A L, 0-51986 A L, 5-71986 A L, 1-31986 A W, 1-01986 A L, 4-1302/20/88 A L, 1-702/20/87 A W, 12-602/21/87 A L, 4-602/21/87 A L, 0-1202/24/90 A L, 1-502/24/90 A W, 16-502/25/90 A L, 1-202/25/90 A L, 2-2202/17/91 A L, 3-802/17/91 A L, 8-1002/18/91 A L, 5-6 (10)03/30/91 H L, 0-303/30/91 H L, 2-602/21/92 A L, 3-502/22/91 A L, 2-502/23/91 A L, 4-702/09/96 N L, 4-1003/16/99 A L, 2-703/17/99 A L, 1-1106/01/03 N L, 4-6 (12)03/02/07 N W, 6-5

NORTHWESTERN 3-0Date Site Result05/09/92 A W, 5-205/10/92 A W, 10-405/11/92 A W, 9-3

OHIO 3-0Date Site Result03/18/83 H W, 14-603/18/83 H W, 3-2 (8)03/19/83 H W, 7-3

OHIO STATE 6-5Date Site Result03/21/80 H L, 2-1003/25/81 H W, 12-1103/26/81 H L, 16-3203/23/82 H L, 7-803/23/82 H W, 13-403/20/83 H L, 3-403/20/83 H W, 9-8

03/21/83 H W, 9-803/22/83 H L, 4-2405/08/07 A W, 7-305/09/07 A W, 12-2

OKLAHOMA STATE 2-2Date Site Result05/21/87 N L, 3-605/24/87 N L, 6-904/29/03 A W, 12-504/30/03 A W, 15-9

OLD DOMINION 4-7 Date Site Result1977 A W, 13-705/23/85 N W, 5-303/15/95 H L, 3-2703/16/95 H L, 6-1505/13/95 A L, 5-702/11/96 N L, 4-902/07/97 N L, 10-1603/05/97 H L, 8-10 (12)05/09/97 A L, 7-1105/10/97 A W, 11-1005/10/97 A W, 6-3

PEMBROKE STATE 4-3 Date Site Result1972 N L, 0-403/20/75 A W, 6-303/12/77 A W, 13-403/13/77 A L, 7-803/30/78 A W, 11-303/16/81 A L, 10703/16/81 A W, 6-4

PEPPERDINE 0-1Date Site Result03/03/07 N L, 1-3

PFEIFFER 1-1Date Site Result1969 H L, 5-71969 H W, 11-8

PIEDMONT 5-1Date Site Result04/27/88 H W, 14-704/20/89 H L, 12-1303/20/90 H W, 15-804/24/90 H W, 8-304/23/91 H W, 10-604/21/92 H W, 8-7

PRESBYTERIAN 2-0Date Site Result04/16/92 H W, 16-504/08/93 H W, 3-1

PRINCETON 3-0Date Site Result03/18/06 H W, 10-303/18/06 H W, 13-803/19/06 H W, 10-8 (12)

PROVIDENCE 0-1Date Site Result03/15/90 H L, 5-7

PURDUE 1-1Date Site Result05/22/87 N W, 8-702/26/12 N L, 7-14

M I C H I G A N S TAT EM I C H I G A N S TAT E

M I A M I - O H I OM I A M I - O H I O




RADFORD 4-1Date Site Result02/23/91 H W, 10-202/24/91 H W, 6-502/24/91 H W, 12-303/08/91 A L, 7-1103/05/92 A W, 16-5

RICE 0-3Date Site Result02/25/05 N L, 1-902/27/05 N L, 4-803/08/08 A L, 11-12

RICHMOND 1-0Date Site Result02/14/98 N W, 15-2

SAINT BONAVENTURE 2-0Date Site Result02/28/98 H W, 17-102/28/98 H W, 5-4

ST. JOHN’S 3-1Date Site Result05/25/85 N W, 9-603/20/99 H W, 8-7 (10)03/20/99 H W, 4-1 (7)03/21/99 H L, 11-13

SALEM 12-4Date Site Result1969 H L, 5-71969 H L, 5-141971 H W, 16-11971 H W, 10-31973 H L, 2-1303/28/74 H W, 6-5 (10)03/25/75 H W, 12-103/26/75 H W, 11-303/22/76 H L, 4-503/23/76 H W, 5-403/21/78 H W, 18-203/22/78 H W, 6-003/20/79 H W, 9-703/21/79 H W, 15-203/18/80 H W, 11-203/19/80 H W, 4-1

SALEM COLLEGE 1-0Date Site Result1977 H W, 15-6

SAMFORD 5-8Date Site Result04/17/09 H L, 7-8 (10)04/18/09 H W, 26-504/18/09 H W, 16-605/14/10 A L, 6-705/15/10 A W, 8-105/16/10 A L, 5-804/08/11 H W, 4-3 (12)04/09/11 H W, 3-204/10/11 H L, 6-1104/20/12 A L, 3-604/21/12 A L, 2-404/22/12 A L, 9-1005/23/12 N L, 0-7

SAN DIEGO 0-1Date Site Result03/03/09 A L, 7-14

SAN DIEGO STATE 0-3Date Site Result04/29/11 H L, 3-404/30/11 H L, 5-1105/01/11 H L, 9-11 (7)

SLIPPERY ROCK 9-0Date Site Result03/30/75 H W, 9-803/30/75 H W, 1-003/18/76 H W, 12-703/19/76 H W, 6-303/03/77 H W, 4-303/11/81 H W, 18-51984 H W, 9-01984 H W, 6-5

SOUTH CAROLINA 6-24 Date Site Result03/20/71 A L, 2-403/22/71 A L, 3-603/11/72 A L, 0-104/10/72 A L, 1-504/02/73 A L, 2-1005/09/73 A W, 3-004/11/74 A L, 1-804/25/74 A L, 6-705/12/75 NA T, 8-8 (6)03/28/78 A L, 9-1203/12/79 A L, 2-603/15/80 A L, 2-1204/20/80 H L, 9-1303/05/83 H L, 2-403/06/83 A W, 6-504/01/83 A L, 8-1404/18/84 A W, 8-603/05/85 H W, 7-503/22/85 A L, 7-1405/25/85 N L, 3-1403/31/86 A L, 5-1603/24/88 H L, 6-702/26/89 A L, 2-1302/26/89 A L, 0-1702/13/92 A L, 2-303/15/94 A W, 9-203/19/97 A L, 12-3002/13/98 N L, 5-1102/18/98 A L, 0-303/12/03 A L, 2-504/08/08 A L, 6-9

SOUTH CAROLINA STATE 7-1 Date Site Result1970 H W, 9-31970 A L, 2-31971 H W, 3-01971 A W, 5-41971 N W, 3-21971 N W, 11-11972 H L, 0-31972 A W, 9-41973 H W, 9-203/20/74 A W, 11-804/19/78 N W, 13-6

SOUTH FLORIDA 4-4Date Site Result04/16/94 H W, 9-204/16/94 H W, 5-404/17/94 H L, 4-702/10/95 A L, 0-902/11/95 A W, 6-102/12/95 A W, 11-605/24/97 N L, 4-902/24/06 N L, 3-4 (13)

SIU-Edwardsville 3-0 Date Site Result03/24/78 H W, 6-003/09/10 H W, 6-003/10/10 H W, 12-8

STANFORD 1-0Date Site Result05/23/92 N W, 5-0

STETSON 4-2Date Site Result03/03/93 A L, 2-403/04/93 A L, 0-402/07/98 A W, 7-602/07/98 A W, 8-102/08/98 A W, 11-9 (12)02/25/06 A W, 4-3

TENNESSEE 4-18Date Site Result03/08/83 H W, 13-1204/27/83 A L, 4-2103/08/84 H L, 4-704/10/84 A L, 5-1303/06/85 H W, 4-304/10/85 A L, 3-1504/11/89 A L, 5-604/06/93 A L, 4-903/30/94 H L, 0-105/28/94 A L, 4-604/12/95 A W, 3-104/01/97 A L, 8-1002/15/98 N L, 6-902/01/00 A L, 0-602/02/00 A L, 1-1204/18/00 A L, 4-5 (10)03/14/01 A L, 3-603/27/01 H L, 13-1505/10/06 A L, 2-704/29/08 A W, 5-203/24/09 A L, 1-504/07/10 A W, 14-904/21/10 H L, 8-18

TENNESSEE TECH 12-4Date Site Result03/19/91 H W, 17-603/20/91 H W, 14-203/20/92 A W, 5-203/20/92 A W, 7-304/01/92 H W, 13-703/22/94 A W, 6-403/23/94 A L, 5-604/19/94 H W, 7-004/20/94 H W, 10-604/17/02 H W, 11-704/15/03 H W, 12-405/13/03 A L, 5-703/24/04 A L, 12-1304/27/04 H W, 12-304/29/09 H W, 11-005/18/10 A L, 2-11

TEXAS A&M 0-1Date Site Result05/27/88 N L, 6-8

THE CITADEL 75-59Date Site Result1971 A W, 5-403/19/74 A L, 1-404/07/77 H L, 1-204/07/77 H W, 13-1004/15/78 A W, 5-204/15/78 A L, 0-503/26/79 H W, 3-003/26/79 H L, 6-704/26/80 A W, 5-404/26/80 A L, 6-704/06/81 H L, 7-804/06/81 H L, 0-504/10/82 A L, 0-404/10/82 A W, 3-105/01/83 H L, 7-805/01/83 H W, 2-103/24/84 H W, 2-103/24/84 H W, 7-403/25/84 H W, 8-304/14/84 A W, 5-304/14/84 A L, 3-404/29/84 N L, 0-803/23/85 A W, 7-303/23/85 A L, 1-803/24/85 A W, 9-804/13/85 H W, 5-304/13/75 H W, 9-804/14/85 H W, 10-303/22/86 H W, 10-503/22/86 H L, 6-703/23/86 H W, 15-504/12/86 A W, 18-304/12/86 A W, 5-003/21/87 A W, 11-203/21/87 A W, 3-1 (10)03/22/87 A W, 18-404/11/87 H W, 7-604/11/87 H W, 5-404/2/87 H W, 14-503/26/88 H W, 8-203/26/88 H L, 2-903/26/88 H W, 15-1004/16/88 A W, 9-804/16/88 A L, 2-404/17/88 A W, 5-404/30/88 N W, 6-405/01/88 N W, 22-603/18/89 H W, 11-1003/19/89 H W, 10-603/19/89 H L, 1-503/10/90 A L, 0-1203/10/90 A L, 3-603/11/90 A L, 3-1004/29/90 N L, 5-904/20/91 H W, 10-404/20/91 H L, 6-804/20/91 H L, 5-904/28/91 N W, 7-404/11/92 A L, 1-204/11/92 A L, 0-104/12/92 A W, 8-704/24/92 A W, 2-102/27/93 A W, 12-202/27/93 A W, 8-702/28/93 A L, 5-704/30/93 A W, 6-302/26/94 H W, 7-102/26/94 H W, 3-202/27/94 H W, 3-205/01/94 A L, 2-4

THE CITADELTHE CITADEL

S A M F O R DS A M F O R D

T E N N E S S E E T E C HT E N N E S S E E T E C H

T E N N E S S E ET E N N E S S E E



UNC ASHEVILLEUNC ASHEVILLE


04/22/95 A L, 2-404/22/95 A L, 3-1104/23/95 A L, 4-804/13/96 H L, 1-604/13/96 H W, 5-204/14/96 H L, 1-204/05/97 A W, 5-404/05/97 A W, 5-204/05/97 A L, 5-604/26/97 N W, 10-304/18/98 H W, 9-604/18/98 H L, 7-1005/01/98 A L, 0-504/02/99 A L, 1-404/03/99 A L, 1-5 (7)04/03/99 A L, 1-505/22/99 A L, 3-603/10/00 H L, 6-803/12/00 H W, 10-503/12/00 H L, 5-7 (7)04/06/01 A L, 0-704/07/01 A W, 7-604/08/01 A W, 12-604/05/02 H L, 3-804/06/02 H L, 0-704/07/02 H W, 2-103/07/03 H W, 8-7 (10)03/08/03 H L, 3-703/09/03 H W, 8-503/19/04 A L, 0-403/20/04 A L, 3-603/21/04 A L, 3-605/28/04 A W, 5-205/29/04 A L, 2-905/30/04 A L, 1-803/25/05 H W, 7-603/26/05 H L, 7-803/26/05 H W, 10-905/25/05 A W, 6-104/21/06 A L, 4-504/23/06 A W, 8-504/24/06 A L, 3-405/26/06 A L, 2-403/30/07 H W, 7-303/31/07 H W, 12-504/01/07 H W, 18-305/23/07 N L, 2-705/09/08 A W, 11-305/10/08 A W, 5-20510/08 A W, 11-203/20/09 H L, 3-1003/21/09 H W, 3-103/22/09 H W, 10-903/12/10 A L, 0-403/13/10 A L, 5-703/14/10 A L, 6-1105/20/10 A L, 3-105/19/11 H W, 7-55/20/11 H W, 6-05/21/11 H W, 12-803/09/12 A L, 2-403/10/12 A W, 11-403/11/12 A W, 6-5

TOLEDO 0-4Date Site Result1972 H L, 1-41972 H L, 3-41973 H L, 0-11973 H L, 5-9

TROY STATE 3-1Date Site Result04/08/95 H W, 11-704/09/95 H W, 6-305/07/95 A W, 7-005/08/95 A L, 4-5

UNC ASHEVILLE 46-23Date Site Result03/08/85 H L, 6-703/19/85 A W, 17-603/19/85 A W, 23-004/11/85 H W, 13-303/05/86 H W, 10-804/01/86 A W, 17-1304/22/86 H W, 24-1403/24/87 H W, 17-1004/19/88 H W, 11-103/10/89 H W, 12-603/29/89 A L, 4-5 (13)04/19/89 H W, 15-603/21/90 H W, 15-804/11/91 H W, 6-004/11/91 H W, 11-004/16/91 A W, 14-703/31/92 A L, 17-1904/07/92 H W, 14-1302/24/93 A L, 5-1003/15/93 H W, 11-404/01/93 H W, 10-702/24/94 H W, 18-103/01/95 H W, 10-503/21/95 A W, 15-003/27/96 A W, 19-504/04/96 H L, 10-1803/20/97 H W, 13-604/02/97 H W, 14-304/16/97 A W, 4-3 (11)03/25/98 A W, 5-304/21/98 A L, 6-904/28/98 H W, 9-704/14/99 A W, 10-704/20/99 A W, 9-604/27/99 H L, 8-1402/29/00 H L, 1-903/15/00 H L, 3-4 (10)05/13/00 A W, 7-405/14/00 A W, 8-502/28/01 H W, 19-1003/07/01 H W, 9-704/18/01 A W, 16-1 (7)05/02/01 A W, 5-403/06/02 H W, 6-503/02/02 H W, 4-205/19/02 H L, 2-3 (7)05/19/02 H W, 1-0 (7)03/05/03 H W, 6-503/18/03 A L, 2-3 (11)05/11/04 A L, 5-1205/12/04 A W, 9-103/15/05 A W, 8-503/23/05 H W, 7-604/06/05 H W, 8-302/28/06 H W, 16-503/14/07 H L, 6-704/10/07 A W, 12-603/26/08 A W, 12-1004/02/08 H W, 10-703/18/09 H W, 9-204/01/09 A W, 11-003/16/10 H W, 10-303/16/11 H L, 2-604/12/11 A L, 4-703/21/12 A L, 1-3 (12)

UNC CHARLOTTE 9-6Date Site Result03/08/80 A W, 5-303/09/80 A L, 5-8

04/30/82 H W, 10-604/30/82 H W, 5-102/22/85 A W, 3-1 (12)02/22/85 A L, 4-602/21/86 A L, 5-702/21/87 A L, 0-502/21/87 A L, 2-302/13/93 H L, 9-1102/14/93 H W, 10-603/03/94 A W, 14-503/04/94 A W, 7-304/28/09 A W, 8-602/23/10 A W, 5-303/17/10 H W, 5-4

UNC GREENSBORO 21-28Date Site Result04/02/92 H W, 18-704/16/93 A L, 7-804/17/93 A W, 11-204/18/93 A W, 8-602/10/96 N L, 3-604/04/98 A W, 10-904/04/98 A L, 0-1 (8)04/05/98 A L, 0-505/03/98 N L, 2-403/13/99 H W, 5-403/03/00 A L, 1-603/04/00 A L, 0-603/05/00 A L, 7-1003/16/01 H W, 10-103/17/01 H L, 5-2203/18/01 H W, 11-905/16/01 N L, 5-703/06/02 A W, 2-003/09/02 A L, 11-1303/10/02 A L, 8-1105/24/02 N L, 4-604/12/03 A L, 4-504/12/03 A L, 1-604/16/03 A L, 2-1404/23/04 H L, 7-904/24/04 H L, 0-704/29/05 A W, 3-104/30/05 A W, 8-705/01/05 A L, 5-605/05/06 H W, 8-305/06/06 H W, 5-205/07/06 H L, 6-1004/13/07 A W, 5-204/14/07 A W, 11-104/14/07 A L, 4-903/28/08 H W, 17-203/29/08 H L, 3-703/30/08 H W, 9-505/01/09 A W, 10-305/02/09 A W, 9-405/03/09 A W, 9-404/30/10 H W, 11-1005/01/10 H L, 3-505/02/10 H L, 2-1403/11/11 A L, 4-503/12/11 A 4-1103/13/11 A L, 6-903/24/12 H W, 16-203/24/12 H W, 6-5 (11)03/25/12 H L, 1-5

UNC WILMINGTON 14-7Date Site Result03/14/76 A L, 3-403/14/76 A W, 2-104/19/76 H W, 7-1

04/19/76 H W, 13-003/10/77 A W, 4-303/31/78 A L, 1-304/01/78 A L, 6-703/16/79 A W, 7-403/17/79 A L, 0-504/03/80 H W, 7-504/03/80 H W, 19-803/18/81 A L, 6-703/18/81 A L, 2-303/09/82 H L, 3-403/09/82 H W, 6-403/09/94 H W, 7-205/09/98 A W, 5-4 (11)05/09/98 A W, 7-405/10/98 A W, 10-9 (11)03/07/06 A L, 2-303/08/06 A L, 4-5

USC 2-1Date Site Result02/27/09 A W, 3-203/01/09 A L, 4-603/02/09 A W, 9-3

USC AIKEN 3-7Date Site Result04/17/91 H L, 3-1804/18/91 H L, 3-704/18/91 H L, 7-802/14/92 A L, 3-602/15/92 A W, 11-8 (11)04/14/92 H L, 6-1004/15/92 H L, 0-704/20/93 H W, 7-504/21/93 H L, 10-1304/05/94 H W, 9-4

USC SPARTANBURG 6-1Date Site Result04/11/86 A W, 18-303/26/87 A L, 5-804/20/87 H W, 9-603/22/88 A W, 11-1004/07/88 H W, 10-403/16/89 H W, 15-1003/28/89 A W, 15-12

USC UPSTATE 0-1Date Site Result03/24/86 H L, 15-18

VALDOSTA STATE 0-1Date Site Result1970 A L, 5-7

VANDERBILT 0-2Date Site Result03/11/08 A L, 3-503/12/08 A L, 4-11

VIRGINIA 1-0Date Site Result02/23/02 N W, 4-3

VIRGINIA TECH 5-10Date Site Result05/06/74 H L, 5-81975 H W, 7-41975 H L, 5-603/23/90 A L, 8-903/27/90 H W, 18-603/06/91 A L, 1-1103/07/91 A L, 7-1103/03/92 A L, 2-1403/04/92 A T, 5-5 (11)03/17/92 H L, 1-0

UNC GREENSBOROUNC GREENSBORO




04/02/93 H L, 8-1204/09/93 A L, 5-803/31/95 A W, 7-604/04/95 H W, 10-904/05/95 H W, 8-202/22/01 N L, 1-5

VORHEES 2-0Date Site Result1972 H W, 5-41972 A W, 9-5

VA. COMMONWEALTH 2-1 Date Site Result02/08/97 N W, 11-605/30/03 N L, 0-605/31/03 N W, 2-0

VMI 55-15Date Site Result1971 H W, 4-304/25/77 A W, 20-1304/25/77 A W, 18-904/10/78 H W, 9-004/10/78 H W, 13-404/23/79 A W, 7-304/23/79 A W, 9-104/22/80 H W, 4-304/23/80 H W, 13-704/13/81 A W, 6-304/13/81 A W, 15-304/19/82 H W, 18-404/19/82 H W, 7-204/18/83 A W, 4-104/18/83 A L, 3-404/27/84 N W, 10-504/24/87 N W, 16-404/26/87 N W, 9-404/01/89 H L, 3-1004/01/89 H W, 7-404/01/89 H W, 3-203/25/90 A W, 8-503/25/90 A W, 4-003/16/91 H W, 14-203/16/91 H W, 20-103/17/91 H W, 21-004/25/91 N W, 18-203/07/92 A W, 7-403/08/92 A W, 8-303/08/92 A L, 5-604/23/92 N W, 3-204/10/93 A L, 5-804/10/93 A L, 1-704/11/93 A W, 13-105/01/93 N L, 4-805/02/93 N W, 12-505/02/93 N W, 5-104/09/94 H W, 9-304/09/94 H W, 5-104/10/94 H L, 1-305/01/94 N W, 7-104/01/95 A W, 1-004/01/95 A L, 1-204/02/95 A W, 7-203/23/96 H W, 8-603/23/96 H W, 3-103/24/96 H W, 13-504/25/96 N L, 3-703/15/97 A L, 9-1703/15/97 A L, 5-603/16/97 A W, 13-604/24/97 N W, 4-303/28/98 H W, 25-103/28/98 H W, 8-703/29/98 H W, 11-404/24/99 A W, 18-5 (7)04/24/99 A W, 10-4 (7)

04/25/99 A W, 7-405/20/99 N W, 8-402/26/00 H L, 3-802/26/00 H W, 11-702/27/00 H L, 6-705/12/01 A W, 5-305/12/01 A L, 8-1505/13/01 A W, 6-305/04/02 H W, 10-0 (7)05/05/02 H W, 6-20505/02 H L, 4-704/18/03 H W, 16-304/19/03 H W, 11-704/20/03 H W, 14-9

WAGNER 3-0Date Site Result02/28/04 H W, 17-1102/28/11 H W, 15-302/29/11 H W, 12-4

WAKE FOREST 3-4Date Site Result04/22/71 A W, 5-403/19/73 A W, 2-004/07/76 A L, 0-503/04/83 A L, 8-902/24/84 A W, 9-803/04/11 A L, 4-1602/22/11 A L, 1-2 (10)

WEST LIBERTY 1-0Date Site Result03/18/81 N W, 7-5

WEST VIRGINIA 1-2 Date Site Result02/24/02 N L, 5-1202/29/08 N L, 7-803/05/10 N W, 1-0

WEST VIRGINIA STATE 11-0 Date Site Result1972 H W, 14-11972 H W, 7-61972 H W, 9-503/28/75 H W, 10-103/28/76 H W, 12-003/28/76 H W, 3-11977 H W, 4-01977 H W, 28-303/23/78 H W, 28-203/23/78 H W, 5-303/23/80 H W, 21-5

WESTERN KENTUCKY 2-0Date Site Result02/18/90 H W, 4-13 (10)02/18/90 H W, 5-4

WESTERN MARYLAND 1-1Date Site Result03/26/74 H W, 6-003/26/74 H L, 7-8 (11)

WILLIAM AND MARY 4-0Date Site Result04/16/77 A W, 7-204/16/77 A W, 4-103/09/98 H W, 15-503/10/98 H W, 10-7

WINTHROP 13-5Date Site Result03/14/90 H W, 6-502/26/91 A W, 5-303/01/91 H W, 13-404/03/92 H W, 14-504/10/92 A W, 9-502/17/93 H W, 16-504/22/93 A W, 9-303/01/94 A W, 9-5 (8)03/16/94 A L, 4-604/12/94 H W, 4-3 (10)04/10/96 H W, 6-502/21/12 A W, 13-305/15/12 H L, 5-11

WRIGHT STATE 32-9Date Site Result02/29/92 H W, 6-402/29/92 H W, 12-703/01/92 H W, 12-702/20/93 H L, 1-302/20/93 H W, 8-402/19/94 H W, 4-302/19/94 H W, 2-102/20/94 H W, 9-002/18/95 H L, 3-602/18/95 H L, 1-802/19/95 H W, 7-402/17/96 H W, 4-302/18/96 H W, 15-102/18/96 H L, 6-802/15/97 H W, 9-802/15/97 H W, 15-102/16/97 H W, 6-502/21/98 H L, 5-602/21/98 H W, 7-302/22/98 H W, 10-302/20/99 H W, 5-4 (13)02/20/99 H W, 8-5 (7)02/21/99 H W, 11-8 (10)02/17/01 H W, 15-202/18/01 H L, 12-1302/18/01 H W, 10-6 (7)02/16/02 H W, 14-402/16/02 H W, 18-0 (7)02/17/02 H W, 9-605/14/02 H L, 2-302/22/03 H W, 7-602/22/03 H W, 6-102/23/03 H W, 13-302/21/04 H L, 6-802/22/04 H W, 14-1 (7)02/19/05 H W, 9-502/19/05 H L, 0-1202/20/05 H W, 8-5

WOFFORD 55-17Date Site Result04/17/70 A W, 7-604/18/70 A L, 8-1004/01/71 H W, 7-204/01/71 H W, 5-004/08/72 A W, 15-004/15/72 H W, 20-1104/20/73 A W, 8-01973 H W, 7-304/09/76 H W, 13-404/03/81 A W, 9-6 (10)04/27/82 H L, 8-904/29/82 H W, 16-0

04/22/83 A L, 11-1604/16/84 H W, 5-404/16/84 H W, 8-504/25/84 A W, 8-704/25/84 A L, 8-903/28/85 A W, 9-504/17/85 H W, 10-004/17/85 H W, 11-004/05/90 H W, 3-103/30/96 H L, 7-1403/30/96 H W, 13-004/02/96 A W, 9-304/03/96 H W, 8-004/11/98 H W, 11-304/11/98 H L, 3-40412/98 H W, 6-305/02/98 N W, 9-403/06/99 A W, 12-903/07/99 A W, 5-4 (7)03/07/99 A W, 14-10 (10)04/01/00 H W, 5-304/01/00 H W, 9-404/02/00 H W, 12-803/04/01 A W, 10-103/04/01 A L, 4-503/16/02 H W, 6-303/16/02 H W, 12-403/17/02 H L, 10-1205/22/02 N W, 9-205/03/03 A W, 17-505/03/03 A W, 11-105/04/03 A W, 6-505/14/04 H W, 4-305/15/04 H W, 6-405/16/04 H W, 8-205/20/05 A W, 7-205/21/05 A W, 10-305/22/05 A W, 10-703/24/06 H W, 9-803/25/06 H W, 11-703/26/06 H W, 20-1005/11/07 A W, 26-1205/12/07 A W, 21-305/13/07 A W, 14-105/02/08 H W, 5-305/03/08 H W, 16-805/04/08 H W, 9-403/29/09 A W, 14-10 (10)03/29/09 A W, 19-204/09/10 H W, 5-404/10/10 H W, 8-204/11/10 H L, 2-504/22/11 H L, 7-1104/23/11 H W, 11-004/24/11 H 25-1404/06/12 A L, 0-204/07/12 A W, 4-204/07/12 A L, 5-6

XAVIER 2-1Date Site Result03/09/07 H W, 9-403/10/07 H L, 12-1703/11/07 H W, 14-7

YALE 0-1Date Site Result1973 H L, 1-5

WOFFORDWOFFORD

WAKE FORESTWAKE FOREST



W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – A L L - T I M E S E R I E S R E C O R D S

OPPONENT W L T LAST STRKAkron 1 0 0 2011 W–1APPALACHIAN STATE 75 44 1 2012 W–1Allen 2 0 0 1971 W–2Arizona State 0 1 0 1994 L–1Armstrong State 2 1 0 1970 L–1Auburn 6 19 0 2004 L–8Augusta 1 2 0 1991 L–1Austin Peay 2 1 0 1983 W–1Barton 0 2 0 1969 L–2Binghamton 2 0 0 2002 W–2Bowling Green 3 0 0 2009 W–3Brigham Young 0 4 0 2009 L–4Brown 1 1 0 2005 W–1Butler 1 1 0 2006 W–1Campbell 24 21 0 1989 W–1Carson-Newman 16 7 0 1990 W–5Catawba 1 2 0 1969 L–1Central Florida 0 6 0 1996 L–6Charleston (W.Va.) 0 1 0 1992 L–1Charleston Southern 9 6 1 2006 W–1Chattanooga 4 6 0 1982 L–2CINCINNATI FIRST EVER MEETINGTHE CITADEL 75 59 0 2012 W–2CLEMSON 15 54 0 2012 W–2Coastal Carolina 1 7 0 2008 L–7COL. OF CHARLESTON 16 36 0 2012 W–1Columbia 3 0 0 2007 W–3Connecticut 2 1 0 2007 W–1Creighton 1 0 0 2008 W–1DAVIDSON 86 25 0 2012 W–1Delaware 1 0 0 2001 W–1Duke 4 1 0 2012 W–1East Carolina 2 16 0 2012 L–2East Tennessee State 59 28 0 2012 W–7EASTERN KENTUCKY 24 11 0 2011 W–1ELON 18 20 0 2012 L–1Emory & Henry 1 0 0 1970 W–1Erskine 12 8 0 1982 W–3Fairfi eld 3 1 0 2012 W–1Florida 3 9 0 1990 L–2Florida International 2 3 0 1984 L–1Florida State 1 4 0 2002 L–4Francis Marion 2 3 0 1982 W–1Fordham 3 0 0 2012 W–3FURMAN 91 33 0 2012 L–1GARDNER-WEBB 11 4 1 2012 L–1George Mason 2 3 1 2008 L–1GEORGIA 18 36 0 2012 W–1GEORGIA SOUTHERN 46 53 0 2012 L–2Georgia State 8 6 0 2005 W–2Georgia Tech 16 18 0 2009 W–1Grand Canyon 1 1 0 1993 L–1Greensboro College 1 0 0 1994 W–1Guilford 1 0 0 1969 W–1Hartford 4 1 0 2008 L–1High Point 28 7 1 2010 W–10HOFSTRA FIRST EVER MEETINGIllinois 2 1 0 2010 W–2Indiana State 0 1 0 1989 L–1Iona 3 0 0 2012 W–3Jacksonville 2 3 0 2012 W–1Jacksonville State 2 1 0 1997 W–1

OPPONENT W L T LAST STRKJames Madison 1 0 0 2005 W–1KENNESAW STATE 6 3 0 2012 W–1Kent State 3 2 0 2005 W–2Kentucky 1 0 0 1998 W–1 LaSalle 0 1 0 1985 L–1Lehigh 0 1 0 1970 L–1Lenoir-Rhyne 6 0 0 1995 W–6LeMoyne 1 0 0 2003 W–1Liberty 6 0 0 2003 W–6Lincoln Memorial 2 0 0 1994 W–2LONGWOOD FIRST EVER MEETINGLouisiana State 0 1 0 1993 L–1Maine 1 4 0 1991 L–2Manhattan 2 1 0 2011 W–2Marist 1 0 0 1997 W–1Mars Hill 7 3 0 1976 L–1Marshall 38 14 0 2008 W–4Maryland 0 1 0 2012 L–1Maryville 1 0 0 1971 W–1Mercer 1 1 0 2008 W–1Miami (Fla.) 2 5 0 1994 L–3MIAMI (OHIO) 5 1 0 2004 L–1MICHIGAN STATE 0 1 0 2008 L–1Milligan 5 0 0 1996 W–5Mississippi State 1 2 0 1989 L–2Montreat 2 0 0 1996 W–2Morehead State 5 1 0 2011 W–4New Mexico 1 0 0 2005 W–1Newberry 6 0 0 1972 W–6New York Tech 2 1 0 2010 W–2North Carolina 2 12 0 2007 L–5North Carolina A&T 8 0 0 2002 W–8UNC ASHEVILLE 46 25 0 2012 L–3UNC Charlotte 10 6 0 2010 W–5UNC GREENSBORO 23 29 0 2012 L–1UNC Wilmington 14 7 0 2006 L–2North Carolina State 8 25 0 2007 W–1Northwestern 3 0 0 1992 W–3Ohio 3 0 0 1983 W–3Ohio State 6 5 0 2007 W–2Oklahoma State 2 2 0 2003 W–2Old Dominion 4 7 0 1997 L–1Pembroke State 4 3 0 1981 W–1Pepperdine 0 1 0 2007 L–1Pfeiffer 1 1 0 1969 W–1Piedmont 5 1 0 1992 W–5Presbyterian 2 0 0 1992 W–2Princeton 3 0 0 2006 W–3Providence 0 1 0 1990 L–1Purdue 1 1 0 2012 L–1Radford 4 1 0 1992 W–4Rice 0 3 0 2008 L–3Richmond 4 1 0 1998 N/ASAMFORD 4 9 0 2012 L–6San Diego 0 1 0 2009 L–1San Diego State 0 3 0 2011 L–3St. Bonaventure 2 0 0 1998 W–2St. John’s 3 1 0 1999 L–1Salem (W.Va.) 13 5 0 1980 W–8Slippery Rock 9 0 0 1984 W–9South Carolina 6 24 0 2008 L–3South Carolina State 7 1 0 1974 W–3

OPPONENT W L T LAST STRKUSC Aiken 3 7 0 1994 W–1USC Spartanburg 6 2 0 1989 W–3Southern California (USC) 2 1 0 2009 W–1South Florida 4 4 0 2006 L–2SIU–Edwardsville 3 0 0 2010 W–3Stanford 1 0 0 1992 W–1Stetson 4 2 0 2006 W–4TENNESSEE 4 18 0 2010 L–1TENNESSEE TECH 12 4 0 2010 L–1Texas A&M 0 1 0 1988 L–1Toledo 0 4 0 1973 L–4Troy State 3 1 0 1995 L–1Vanderbilt 0 4 0 2008 L–4Virgina 1 0 0 2002 W–1Virginia Commonwealth 2 1 0 2003 W–1Virginia Military Institute 55 15 0 2003 W–3Virginia Tech 5 10 1 2002 L–4Voorhees 2 0 0 1972 W–2Wagner 3 0 0 2004 W–3WAKE FOREST 3 4 0 2011 L–1WASHINGTON STATE FIRST EVER MEETINGWestern Kentucky 2 0 0 1990 W–2Western Maryland 1 1 0 1974 L–1West Liberty State 1 0 0 1981 W–1West Virginia 1 2 0 2010 W–1West Virginia State 8 3 0 1981 W–1William & Mary 4 0 0 1998 W–4Winthrop 13 5 0 2012 L–1WOFFORD 53 16 0 2012 L–1Wright State 32 9 0 2005 W–1Xavier 2 1 9 2007 W–1Yale 0 1 0 1973 L–1

WCU SERIES HISTORY IN NCAA REGIONALS

Arizona State 0 1 0 1994 L–1Auburn 0 1 0 1997 L–1East Carolina 1 1 0 2007 W–1Florida State 1 2 0 1992 L–2Georgia Tech 0 1 0 1986 L–1Indiana State 0 1 0 1989 L–1Jacksonville 1 0 0 2007 W–1Kent State 1 1 0 1993 L–1La Salle 0 1 0 1985 L–1Le Moyne 1 0 0 2003 W–1Louisiana State 0 1 0 1993 L–1Marist 1 0 0 1997 W–1Miami (FL) 1 1 0 1993 W–1Mississippi State 1 2 0 1989 L–2North Carolina 0 1 0 2007 L–1North Carolina State 0 1 0 2003 L–1Oklahoma State 0 2 0 1987 L–2Old Dominion 1 0 0 1985 W–1Purdue 1 0 0 1987 W–1South Carolina 0 1 0 1985 L–1South Florida 0 1 0 1997 L–1St. Johns 1 0 0 1985 W–1Stanford 1 0 0 1992 W–1Tennessee 0 1 0 1994 L–1Texas A&M 0 1 0 1988 L–1Virginia Commonwealth 1 1 0 2003 W–1



– T H E A’ s –Adair, Rick ............................ 1977-79Adams, Charles ...........................1941Ahearn, Chris ............................. 2005Aiello, Bobby ............................. 1972Allen, Billy.................................. 1992Allison, Steve ........................ 1990-91Amos, Lynn ...........................1987-88Anderson, Willis .................... 1957-60Andrus, Connor .......................... 2012Ardrey, Sam ..........................1938-40Arnette, Johnny Mack ................. 1954ATTAWAY, AARON ............. 2011-PRES.

– T H E B ’ s –Bailey, Phil ................................. 1958Bain, Brian............................1995-98Baker, Adam .............................. 2007Baker, Garrett ............................ 2009Baldwin, Kevin ......................1995-96Ball, David ............................ 1977-79Ballance, Bobby .................... 1957-60Ballard, Danny ........................... 1955Ballard, Dave ............................. 1955Baquer, Bryan ............................ 1983Barile, Jordan .............................1991Barkley, Steve .......................1967-70Barnes, Brian ........................2002-05Barnhorst, Howard ..................... 1948Barnwell, Alex ....................... 1981-84Barnwell, Don ............................ 1962Barnwell, Howard .................. 1938-41Barrow, Martin ......................1995-98Bartlett, Rodney .................... 1961-62Basner, Ryan.........................2000-03Batts, Mat ...................................2010Baxter, Mark .............................. 1980Beacham, Wade ......................... 1997Beck, Alan ............................2000-03Beddingfi eld, Jim .................. 1957-58Belcolle, Chris.......................1994-96Bellomo, Kevin ...................... 1988-91Benedict, Matt ......................2008-11Bennett, Bill..........................1952-53Bentley, Wes .....................1999-2000Bethel, Bobby .......................1994-95Beverlin, Jason ......................1992-94Biggs, Tracy ......................1997-2000Blackwell, Andrew .................2009-12Blair, Leslie ................................ 1959Blake, Dennis ....................... 1974-77Bland, Logan ............................. 2009Booth, John........................... 1968-71Bowles, Gene ........................ 1970-72Bowman, Randy ......................... 1979Boyd, Billy............................. 1978-80Bracken, Cary ............................ 1975Bradburn, C. Wayne .............. 1941-46Bradley, Dwayne ...................1989-92Brady, Robert ............................. 1960Brandon, Tom ............................ 1961Bratcher, Toby .............................1981Bright, Don ........................... 1971-73Brigman, Bill .............................. 1961BRISTER, HUNTER ............2012-PRES.Brittain, Grant .......................1987-90Brock, McDonald ....................... 1942

W E S T E R N C A R O L I N A B A S E B A L L R E C O R D B O O K – A L L - T I M E L ET T E R W I N N E R S

Brogden, Jim ............ 1953-54, ‘56-57Brooks, Craig ........................1983-86Brooks, Eric ............................... 1986Brooks, P.J. ...........................1986-87Brown, Bobby ............................ 1973Brown, Freddy ....................... 1976-79Brown, Garrett ........................... 2012Brown, George ...............1942, ‘48-49Brownlow, Tyler .......................... 2009Bruce, Jeremy ....................... 1997-98Bryant, George ......................1954-55Bryant, Jennings ...................1939-40Buchanan, Todd ....................2000-03Buda, Mike ...........................2005-06Bullins, Jim ...........................1965-68Bunting, Jim ............................... 1966Burns, Ronnie ............................ 1950Burton, Jared ........................2000-02Burwell, J.P. .......................... 1994-97Bush, Andy................................. 1996Byrd, Bruce ...........................1965-66Byrd, Cary .................................. 1960

– T H E C ’ s –Cagle, O.V. ..................... 1951-53, ‘55Caldwell, Cecil ......................1963-67Camac, Joe ...........................2000-03Cantrell, John ..............................1977Capobianco, E.G. ..................1992-93Carlton, Wayne........................... 1955Carpenter, Willie ................... 1977-80Carson, Kyle .......................... 1981-82Carson, Mike ........................1984-87Carswell, Danny .................... 1972-75Carter, Darryl ........................ 1991-92Carter, Artis ............................... 1950Carter, Mike ............................... 1980Carter, Mike .......................... 1957-58Case, Kevin .................................1981Caskey, Jerry .........................1960-63Chamberlain, Jody ................ 1981-82Chamlee, Steve ..................... 1979-80Champion, Russ ......................... 1983Chapman, Russ.......................... 1992Chavers, Sam ............................ 1995Chavis, Vance .......................2008-12Cherry, Rick ................................1976Chilcoat, Andrew ................... 2010-11Christian, Jim ............................. 1985Clark, Joe ................................... 1961Clark, Jon................................... 2001Clements, Jack......................1960-62Cloer, Dallas .........................1955-56Cochran, Jimmy ....................2002-03Cockrell, Derek .....................1993-96Cogburn, Barry ............................1977Cole, Ed ................................1969-70Collias, Trevor .......................2009-10Collins, Harold ........................... 1942Colvin, Robert ....................... 1960-61Connolly, John .......................1993-94Cooper, Bob ............................... 1959Corbett, Bryan ......................2006-08Corn, Jackie ..........................2007-08Cowan, Leo ...........................1939-40Cowan, Ray .................................1941Cox, Joey ...............................1989-92

Crawford, Charles ................. 1955-57Crawford, Doug .......................... 1955Crawford, Dewey .........................1981Crawley, Justin ......................2009-10Crocker, Lawrence ................. 1949-51Crotts, Earl ............................1961-64Crowell, Wayne .......................... 1954Cunningham, R.L. ...................... 1956CURTIS, ADAM ................. 2010-PRES.

– T H E D ’ s –Daniels, Joe .......................... 1960-61Davidson, Chris .....................1996-98Davidson, Mike ..................... 1979-80Davis, Bill .................................. 1950Davis, Chris ...........................2002-05Davis, Eddie .......................... 1972-74Deal, Mike ............................1967-69de Graff, Dylan ...................... 2007-10Deese, Kyle .................................2011Dellinger, Denny ......................... 1965Demeree, George ....................... 1985Derosia, Dan .........................1992-94Deweese, Tim................. 1974, ‘76-78DiFelice, Mark.......................1995-98DiFelice, Matt ............................ 1996Dixon, Allen ..........................1959-62Doherty, Rob .........................1990-93Donovan, Al ............................... 1985Dotson, Darron ..................... 2011-12Downs, John..........................1968-69Drury, Ken .................................. 1960DuBard, Danny ..................... 1977-79Duke, Harry ................................ 1950Dullnig, Cameron .................. 2010-11Duncan, Keith ............................ 1982Dunlap, Mike ............................. 1984Dunn, Andy ........................... 1988-91

– T H E E ’ s –Eads, James ............................... 1960Ebersole, Keith ..................... 1977-78Edens, Dick ................................ 1950Eddick, Denver ....................2003-04Edwards, Roddey ..................1964-67Eldredge, Jim ........................1984-86Ellingburg, Ray ........................... 1958Ellenburg, Jeremy ..................2003-06Elsesser, Mike .............................1974Eubanks, Tim ............................. 1980Evans, Jim .................................. 1950

– T H E F ’ s –Fairey, Clint ...........................1986-89Fann, Waldo ............................... 1942Feimster, Emmett ..................1950-52Feimster, Tim ..............................1981Feilds, McCauley, Jr. ................... 1959Fishel, Gary ........................... 1972-75Fisher, Chip.................... 1983, ‘85-87Fisher, Harry .............................. 1956Fogleman, Craig......................... 1967Foley, Dan .............................2001-02Fonville, Charlie .................... 1981-84Ford, Lynn .............................1967-68Foster, John ..........................1950-53Foster, Ryan ..........................2000-03

Foster, Seth ..........................2000-03Fowler, Tony .......................... 1974-75Fox, Buddy ............................ 1974-77Fox, Dale............................... 1972-75Fraser, Joe ............................1965-67Frazier, Morgan .................1999-2000FRAZIER, WILL .................2012-PRES.Frye, Revis ............................ 1940-41Fugate, James ............................ 1953Fulbright, Brent .....................1988-89Fulmer, Mark ............................. 1973

– T H E G ’ s –Gabrielian, Aaron ....................... 2006Gaines, Jerry .............................. 1975Galloway, Grady ......................... 1938Gambill, Mike ............................ 1972Game, Bobby ........................ 1957-58Garcia, Carlos ........................... 2003Gary, Alex .............................2002-03Gay, Scott .............................1983-85Gayle, Ted .............................1949-50Gaylor, Fred ............................... 1942Geiger, Jim ............................1983-84Gheen, Tom ........................... 1941-42Gibson, Sam ..................1942, ‘48-49Giles, Kelly ............................1989-90Gilmore, Bobby ..................... 1973-76Giunta, Rich ............................... 1995Glance, Bill ................................ 1950Glover, Glenn ........................ 1970-73Glymph, Danny............................1977Godfrey, Josh ............................. 1998Goforth, Leonard...................1960-63Goldston, Larry .....................1994-95Goldston, Rod .......................2000-03Gonzalez, Luis Mario .................. 1954Goodwin, Larry ...................... 1971-72Gordon, Blake ............................ 2000Gordon, Robbie .....................1985-88Goulder, Ollie ..............................2010GRAGG, LUKE .................. 2011-PRES.Graham, Jeff ......................... 1990-91Graham, Joe .............................. 1961Grande, Jeff ..........................1984-85Grant, Shelton ......................1988-89Graves, Tommy ........................... 1996Greene, Jonathan ..............2005-2007Greenwood, Jared .................2004-05Greer, Brent ..........................2007-09Greeson, Chet ....................... 1979-82Gregory, Grey ................... 2005-2006Grieve, Kevin .............................. 1998Griffi n, Andy ..........................1983-84Griffi n, Brown ............................. 1942Griffi n, Odell .........................1939-40Griffi n, Dwight ............................ 1950Griffi n, U.S. ................................ 1950Griffi th, Reed ............................. 1969Grindstaff, Gary .................... 1973-76Grogan, John.............................. 1959Grove, Jim ............................. 1970-73Grundy, Phillip ...................... 1991-93Gudger, Frank .......................1940-42Gunter, Sam............................... 1959Guy, Randy ............................ 1972-75

JARED BURTON, 2000-02JARED BURTON, 2000-02

SAM “HOOT” GIBSON, 1942, ‘48-’49SAM “HOOT” GIBSON, 1942, ‘48-’49

ROD GOLDSTON, 2000-03ROD GOLDSTON, 2000-03

CLINT FAIREY, 1986-89CLINT FAIREY, 1986-89

JOEY COX, 1989-92JOEY COX, 1989-92




– T H E H ’ s –Haddad, Radley ....................2009-10Hager, Rusty .............................. 1978Hailey, Freddie ......................1984-87Hall, Ed ...................................... 1970Hall, Nate .................................. 2005Hallam, Tim ..........................2005-06Hampton, Gray ...................... 1937-40Hamrick, Brad ............................ 1998Hamrick, Jeremy ........................ 2000Hannon, Bill ............................... 1968Hansil, John .......................... 1951-54Hardin, Frank ............................. 1950Hare, Ken .......................1980, ‘82-84Hargett, Ron ...............................1976Harp, Gerald .............................. 1979Harris, Steve .............................. 1998Harwell, Wayne ..................... 1978-79HATCHER, PRESTON ......... 2010-PRES.Hatley, Mitchell .....................2006-09Hawk, Derrick .......................2003-05Hawkins, Chris ........................... 1984Hawkins, Jerry ....................... 1957-58Haynes, Jason .......................2005-08Hayes, Tommy ....................... 1969-71Haynes, Bill ....................1962, ‘64-65Haynes, Leslie ............................ 1959Hearrell, Ryan ............................ 1993Heavner, Bob ........................1949-50Heffl ey, Ross .........................2009-12Hennon, Rodney ....................1990-93Hensley, McKinley ............... 1942, ‘48Henson, Jody.........................1992-95Hicks, Jerry ...........................1965-66Hicks, Mickey ........................ 1968-71Hicks, Mike ........................... 1973-76Hicks, Robert ........................1965-66Hill, David .............................1980-83Hilliard, Robert ..................... 1961-63Hilton, Mike ..........................1990-93Holcombe, Bobby.................. 1954-57Holland, Greg ....................2005-2007Hollifi eld, Sonny .................. 1964, ‘66Hollow, Dennis ........................... 1983Holloway, Ray ............................. 1958Holshouser, Jeff ......................... 1985Hooper, Jon ................................ 1989Hooven, Branan ....................1989-92Hoover, Rob ......................1998-2002Hope, Eddie ..........................1968-70Hornaday, Tommy ................ 1950, ‘53Horne, Tony ...........................1993-96House, Brad ......................1999-2000Howard, Grady ........................... 1942Howard, Herbert.................... 1938-41Howard, William ......................... 1942Howell, Charles D. .................1952-53HOYLE, JACOB ..................2012-PRES.Hudson, Steve .............................1981Huie, Brian ............................1988-89Huntington, Ron ....................1983-86Hurst, Roy .............................1992-94Hutchinson, Brian .................1996-98Hutchinson, John ..................1952-54Hyatt, David ..........................1984-86Hyde, Ken .............................1965-66Hyde, Todd ............................1989-90

– T H E I ’ s –Ibraham, Jack ....................... 1957-59Idol, David ............................ 1975-76Ingle, Don ............................. 1979-82Ingram, John .............................. 2007Ivie, Glenn.............................1963-66

– T H E J ’ s –Jarrett, Bill ................................. 1978Jarvis, George .......................1936-38John, Andy ............................2006-09Johns, Matt ...........................2008-11Johnson, Brandon .................2008-11Johnson, Charles ........................ 1952Johnson, Eric......................... 1997-98Johnson, Greg .......................1980-83Johnson, Kenneth .................1949-50Johnson, Tyler ...................2006-2007Jolly, Ed ..................................... 1964Jones, Chip .................................1991JONES, CODY ................... 2011-PRES.Jones, Danny.........................1964-67Jones, Lackie ............................. 1966Jones, Lewis ............................... 1990Jones, Preston ......................1959-60Jones, Tom ................................. 1942Josey, Brad ...........................2002-04Joyce, Lon .............................1967-70

– T H E K ’ s –Kay, Johnny ........................... 1977-80Kasten, Kasten .......................... 2003Keener, Harold ...................... 1950-51Kendrick, Patrick...................1990-92Keppler, Howard ........................ 1961Keyes, Stewart ......................1986-89Kibler, Jon .................................. 2005Kilpatrick, James ....................... 1965Kimbrell, Jim .........................1965-67Kimel, Jack ...........................1989-92Kilmer, Wayne ............................ 2003King, Fred ............................. 1950-51King, Wesley .............................. 1998Kinsey, Mel ...........................1980-83Kirby, Aaron ......................1998-2000Kirby, George ........................1955-56Kirkpatrick, Tyler ................... 2007-10Klutz, Mike ................................. 1982Knight, John ............................... 1978Koone, Chad .............................. 1998Koone, Chuck ....................... 1997-98Koontz, Chip ......................... 1974-77Kuykendall, Bob ......................... 1954Kuykendall, Jim .....................1952-55Kyslinger, Dan ............................ 1992

– T H E L’ s –Lackey, Hal ................................ 1955Lamb, Ed ................................... 1959Landing, Frank ............................1976Larrimore, Andrew .............2005-2007Lasher, Ernie ......................... 1974-77Laughridge, Jim..................... 1971-72Lawrence, David .................... 1938-41Leagan, Charles .................... 1941-42LeClair, Keith ........................1985-88Ledford, Buddy .......................... 1957

Lee, George ..........................1939-40Leger, Freddy ............................. 1955Lethcoe, Johnny ......................... 1979Lewis, Tommy ............................. 1954Liles, Nick .............................2007-09Lindley, Owen ............................. 1942Liner, Fred ......................1952, ‘55-56Lister, Ted .................................. 1992Lloyd, Bill ................................... 1950Lockey, Alfred ....................... 1950-51Logan, Ronnie .......................1964-65Long, Jason .......................1998-2000Lowman, Leon ............................ 1950Lundy, Ralph ......................... 1971-72Lyman, Scott .........................1990-93Lyons, J.C. .............................2008-09Lytle, Ronnie .............................. 1963

– T H E M ’ s –Mabe, Paul ................................ 1982Malchesky, Tom ......................... 1988Maney, Johnny ........................... 1965Manis, Mike ............................... 1970Manning, Mike ...................... 1991-94MARTIN, ADAM ................ 2011-PRES.Martin, Corey ........................2006-09Martin, R.J. ...........................1952-53Marvels, Mike ............................ 1979Mashburn, Cecil .................... 1957-58Mashburn, Jeff ...................... 1979-82Maska, Bob ..........................1964-66Massey, Chris........................1994-95Masters, Chris ......................2007-09Mathews, Ryan .......................... 2008Matthews, Jimmy .................. 1956-57Mattocks, Clen........................... 1980Maxwell, Clark ...................... 1994-97McAvoy, Jeff ............................... 1997McCauley, Wayne ........................1971McClure, David ..................... 1981-82McConnell, Bud .................... 1960-61McConnell, Caleb .................2004-06McCrackine, Travis ..................... 1989McCrary, Charles ......1952-53, ‘56-57McCraw, Reggie .................... 1981-84McCullen, Brian ....................2004-06McCurry, Ryan.......................2000-03McDaniel, Trey ......................2005-06McDowell, Brandon.. 2002-03, ‘05-06McGowan, Mike ......................... 2004McKay, Dave .........................1995-98McKenzie, Donald .................1949-50MCKINNEY, MORGAN ....... 2011-PRES.McKinney, Richard ......................1951Mehaffey, Zeb ............................ 1957Menhart, Paul .......................1988-90Meredith, David ....................1940-42Meredeth, Horace .................1938-40Michalove, Clint .................... 1980-81Mikeal, Norris ............................ 1970Milewski, John ......................1984-85Miller, Luke ...........................2003-05Miller, Roger .........................1968-70Minacci, Mike .............................1991Minero, Donovan ..................2001-02Mintz, Doyle ...................1958-59, ‘64Mitchell, Doug .................... 1980, ‘82

Mitchell, Kevin ...................... 1991-92Mitchell, Jacoby ..........................2011Mitcham, Joe ............................. 2001Moody, Realus ........................... 1955Moore, Arnold ....................... 1956-57Moore, Chad .........................1992-96Moore, Chris .........................1996-98Moore, DeWayne ........................ 1967Moore, Greg ..........................1980-83Moore, Jason ............................. 1995Moore, Robert, Jr. ...................... 1964Morgan, Ken ......................... 1961-63Morgan, Leonard ..................1967-69Morhardt, Darryl ........................ 1983Moss, B.C. ............................1940-42Moss, Kevin ............................... 1995Murphy, Blake .......................2005-08Murray, Lee ................................ 2009Murray, Shannon........................ 1994Myers, Charlie .............................1941Myers, Doug .........................2001-02Myers, Jeff ............................ 1991-92Myers, Tony ...........................1984-87

– T H E N ’ s –NADALE, JON ...................2012-PRES.Nance, Lee ............................ 1979-80Naylor, Eric ................................ 1989Neill, Elmer ................................ 1942Nelloms, Skip .......................1985-88Nelson, Matt .............................. 2003Nesbitt, Ray ............................... 1953Newsom, Tim ........................1966-69Newton, Robert .....................1966-67Nicholson, George ................1954-55Notaro, Stephen ...................2008-11NOTEBOOM, BRYANT........ 2010-PRES.NULL, JEREMY ..................2012-PRES.

– T H E O ’ s –Obert, Alex ............................2002-04Olson, Clair “Ike” ................ 1942, ‘46Osthoff, Glenn ............. 1984, ‘86, ‘88Ottone, Daniel ...................... 2007-10Overbay, Wes ....................1999-2000Overcash, Marvin ....................... 1953Oxendine, Herbert ...................... 1938Ozar, Garrett .........................2008-09

– T H E P ’ s –Page, Bedford ............................ 1950Page, T.J. .............................. 2010-11Pardue, James ...............1950-52, ‘56Parker, Frank ........................1950-53Parker, Larry .........................1962-63Parker, William .....................1960-63Parks, Wayne ........................ 1977-80Pash, Joe ................................... 1983Patterson, Jack ..................... 1972-74Patton, W. .................................. 1938Peek, Bill ................................... 1940Peek, Clyde ........................... 1940-41Pember, David ...................... 1997-98Penland, Doug ........................... 1964Penland, Dustin ......................... 2004Perry, Dennis ............................. 1967Pfeil, Mike ..................................1971

MITCHELL HATLEY, 2006-09MITCHELL HATLEY, 2006-09

ERIC JOHNSON, 1997-98ERIC JOHNSON, 1997-98

KEITH LECLAIR, 1985-88KEITH LECLAIR, 1985-88

BLAKE MURPHY, 2005-08BLAKE MURPHY, 2005-08

MARK POARCH, 1987-90MARK POARCH, 1987-90




Phillips, Roy .......................... 1938-41Phythyon, James ........................ 1959Piela, Dave ................................ 1988Pierce, Maynard ..........................1976Pilgrim, Dale .........................1993-96Plemmons, “Spike” ............... 1938-41Poarch, Mark ........................1987-90Porter, Brad ............................... 1972Posey, Drew ..........................1992-94Powell, Sam ............................... 1958POWELL, TYLER ................2012-PRES.Pressley, W. Clyde .................1948-50Pressley, James .......................... 1952Pressley, Joe .............................. 1950Pritchard, Stephen ................1992-94Price, Benjamin ...................1941, ‘47Price, Glenn ............................... 1942Price, Hooper ........................ 1940-41Price, Joseph C. .............1950, ‘53-54Price, Matt ........................1998-2001Pryor, Floyd ...........................1958-60Pryor, Harris ..........................1956-59Pulliam, Guy .............................. 1954Pulliam, Rusty .............................1977Pusey, Mike ............................... 1978Pust, John .............................1982-85

– T H E R ’ s –Radford, Kyle ........................1980-82Raleigh, Jim ..........................1964-65Raleigh, Matt ........................1989-92Raleigh, Todd ........................ 1988-91Ramsey, Clint ........................2002-05Ramsey, Jerry ........................ 1972-75Ramshaw, Mike ......................... 1989Ray, Jim ................................1959-62Ray, Phillip ..................................1941Reed, Jerry ............................ 1974-77Reese, Bob .................................1941Reeser, Mark ........................ 1976-79Reid, Andy ............................1985-86Reid, Eddie ................................ 1962Reinicker, Jim ................ 1978-80, ‘82Repass, Bill ............................... 1978Rexrode, Kevin ......................1994-95Rhinehart, Bill.......................1962-64Rhinehart, Joe............................ 1957Rhodes, Raymond ................. 1941-42Rhodes, Max ...........1950, ‘52, ‘54-55Rhoney, Ben......................2000-2001Rhyne, Gary .......................... 1973-75Rice, Jerry ............................1942, ‘47Rich, Brian ................................. 1985Rickman, Andy ......................1984-87RIDINGS, JULIAN .............. 2011-PRES.Rieger, Eddie ............................. 1987Rigsby, Bill, Jr. ............................ 1954Riley, Pat ..............................1985-86Roane, Michael .......................... 2001Roberts, Mike .............................1976Robertson, Ralph ....................... 1948Robertson, Russell ................2008-10Robertson, Shelby ...................... 1938Robinson, David Ray .............1980-83Robinson, Edgar ...................1968-69Robinson, J.J. ............................. 1983Robinson, Jay ............................. 1980

Rogers, Clarence............1962-64, ‘66Rogers, Darryl .......................1984-87Rogers, Ronald .....................1950-53Rollison, Reid .......................2007-09Roper, Todd ..........................2001-04Rowley, Chris ........................ 1994-97Royal, Phillip .............................. 1959Rudder, Robert .................1999-2000Rushing, Scott ......................1986-87Rynders, Chris....................... 1996-97

– T H E S ’ s –Saberhagen, Drew ................2007-08SANDEFUR, TAYLOR ......... 2010-PRES.Santarelli, Cal ............................ 1980Saunders, John .......................... 1953Schade, Ryan ........................2000-02SCHNEIDER, DANNY .........2012-PRES.Schreiber, Stan ..................... 1978-79Schultz, Austin ...................... 2010-11Scott, Fred ................................. 1958Seawright, Bobby .................. 1957-58Sellers, Joe Jack ....................1992-95Sells, Danny .......................... 1958-61Selzer, Thomas ......................1949-52Senn, Richie .........................1987-90Sey, Bob .................................... 1954Sexton, Tyler .........................2006-08Shaft, Barrett ........................2005-08Shamel, Herman ........................ 1954Shamp, Gary .........................1984-87Sherrill, Alex .........................1952-53Sherrill, Dwight ..................... 1952-57Sherrill, Jeff ..........................1985-87Short, Jack ............................1953-55Shuford, Albert ..................... 1941-45Shumate, Keith .....................1986-88Sigmon, Brian .......................2001-04Silver, Jack ................................. 1942Simms, Terry ...............................1976Simpson, R. Ray .................... 1940-41Sims, Dale ............................ 1976-78Sims, Randy .......................... 1979-82Singleton, Dick .......................... 1954Sinicki, Tim ...........................1987-88Sisk, Jan .................................... 1954Skinner, Jeff ............................... 2001Slaughter, Jackie...................1984-87Sluder, Bob ...........................1950-53Sluder, Jeremy ...................... 2010-12Smathers, Noland ................. 1968-71SMITH, JORDAN ............... 2011-PRES.Smith, Keith ..........................1984-86Smith, Kenny ....................2003-2007Smith, Macon .............................2011Smith, Mick ............................... 1964Smith, Phil ................................. 1956Smith, Scotty ........................1962-65Smith, Tommy ....................... 1973-74Smithwick, Austin .............1997-2000Snyder, Chris.............................. 1993Snyder, Terry ...............................1974Souther, Ray .........................1968-69Spady, Jack ...................1959, ‘61, ‘63SPIESS, DYKOTA .............. 2011-PRES.Stadler, Lin ...........................1980-83Stallings, Charles ......1950-51, ‘56-57

Stein, Andy ................................ 1988Stevens, Jeff .........................1986-89Stewart, Jerry ............................. 1965Stewart, Jimmy ..................... 1972-75Stewart, Kyle .........................2009-11Stillwell, Matt .......................1995-98Stoudenmire, Jim ........................1976Strausbaugh, Steven ............... 2005-2007Striker, Marc ......................... 1991-94STRONG, BRADLEY...........2012-PRES.Stroud, Aaron .......................1950-52Sudderth, Troy ......................1982-83Sullivan, Jason ......................2009-10Suttles, Donnie .....................1996-98Sutton, Corey ............................. 2007Swartzel, Ronnie ................... 1954-57Sziksai, Jeff ...........................1996-98

– T H E T ’ s –Tanner, Ronnie ............................1971Tate, Phil ...............................1963-65Tatham, Bergin ..................... 1972-74Tavernier, Mike ......................2008-09Taylor, Brad ................................ 1990Taylor, Guy ............................1956-58Taylor, Ricky ............................... 1994Teague, Garnett ......................... 1966Teague, Marshall ..................1949-50Tebo, Brian ...........................1983-86Teeter, James ............................. 1959Tesh, Rodney ......................... 1988-91Tharpe, Danny .......................1963-64Thomas, Dakotah ........................2011Thomas, Charles ...............1998-2000Thomas, Mike ....................... 1989-91Thompson, Ed .......................1967-70Thompson, Jim ......................1966-69Thornburg, Brock ..............2006-2007Thrasher, Matt.......................1980-83Tidick, Mike ..........................1990-94Tiger, Matt ............................ 1996-97Tilley, Charles ............................ 1942Tolbert, Alex .......................... 1994-97Tolleson, Wayne .................... 1975-78Tomberlin, Hugh .................... 1937-39Torres, Chris ......................1999-2000Towery, Mike .............................. 1979Treadway, Phillip .........................2011Treadway, Wes ........................... 1984Tupper, Bryan ........................2005-06Turner, Alfred ........................1984-85Turnrose, Erik ........................1996-98Tuttle, Larry ...........................1954-56Tweedlie, Brad ...................... 1991-93

– T H E U ’ s –Urey, Max ................................... 1957URQUHART, DALE .............2012-PRES.Ussery, Ira.............................1952-53Uzdilla, Doug ........................1987-90

– T H E V ’ s –Valley, Tom ................................. 1983Vestal, Randy ............................. 1985Volpe, Gary ...........................1986-89Volrath, Ray ................... 1954, ‘57-58

– T H E W ’ s –Waddell, Ken ............................. 1960Waddell, Scott ........................... 1988Wagoner, Mike ............................1977Walker, Charles .....................1960-62Wall, Ronnie ......................... 1968-71Wallace, Herb ............................ 1989Wallen, J.C. ................................ 1961Wands, Charlie..................1998-2000Ward, Carl .................................. 1950Ward, Frankie ....................... 1997-98Ward, Heath ............................... 1990Ward, Larry ................................ 1978Ward, Scott .......................2006-2007Ware, Joe ..............................1952-55Warren, Ed ............................1986-87Warren, Jerry ......................... 1978-79Wasik, Peter..........................1983-84Waters, Chris ........................1995-98Watson, Flip .......................... 1973-76Watson, Nat ............................... 1975Weams, Steve ....................... 1970-71Webster, Jerry ....................... 1961-62Weeden, Linden ......................... 1968West, Bruce .......................... 1970-73West, Larry ............................1965-66Whetstine, Darryl ....................... 1969Whitaker, Ron ...........1960-61, ‘63-64White, Lyndon ................ 1937, ‘39-40White, Steve .............................. 1963WHITE, TYLER ................... 2010-PRES.Whitfi eld, Joel ............................ 1964Whitson, Eric .........................1992-95Whittington, D. Gene .................. 1952Whitworth, Ted ......................1969-72Wilhoit, Harold ........................... 1959Wilhoit, Kevin ........................1994-95Williams, Al .................................1941Williams, Don ....................... 1978-79Williams, Lowell ......................... 1954Williams, Olin........................1956-58Williamson, Robert ...............1949-50Wilkerson, Ken ........................... 1964Wilson, Dave .............................. 1987Wilson, Donnie ......................2006-08Wilson, Landrum ........................ 1950Wilson, Ryan .............................. 2005Wilson, Wesley ........................... 1961Withrow, Ward ......................1987-88Witzke, Karl ........................... 1978-79Wofford, Bill ......................... 1968-71Woodley, Dan ........................2001-02Wright, Lester........................ 1972-75Wright, Ron ................................ 1963Wright, Thelbert ......................... 1938

– T H E Y ’ s –York, Phillip................................ 1950Youmans, Kirk ............................ 1979Young, Ronnie ................1962, ‘64-65Yount, Ron ..................................1971Yarbrough, Jeff ........................... 1979

– T H E Z ’ s –Zollman, Brandon .................2004-05

MATT STILLWELL, 1995-98MATT STILLWELL, 1995-98

STEVEN STRAUSBAUGH, 2005-07STEVEN STRAUSBAUGH, 2005-07

MARC STRIKER, 1991-94MARC STRIKER, 1991-94

MIKE TIDICK, 1990-94MIKE TIDICK, 1990-94

DAN WOODLEY, 2001-02DAN WOODLEY, 2001-02



W E S T E R N C A R O L I N A A N D M A J O R L E A G U E B A S E B A L L

JARED BURTONWas a Rule 5 Draft Pick by Cincinnati in 2006Major League Debut: With Cincinnati on April 4, 2007 vs. Chicago Cubs

CAREER MAJOR LEAGUE STATISTICS:Year Team W-L ERA G GS CG SHO Sv IP H R ER BB SO2007 Reds 4-2 2.51 47 0 0 0 0 43.0 28 15 12 22 362008 Reds 5-1 3.22 54 0 0 0 0 58.2 56 24 21 25 582009 Reds 1-0 4.40 53 0 0 0 0 59.1 61 30 29 23 452010 Reds 0-0 0.00 4 0 0 0 0 3.1 0 0 0 0 12011 Reds 0-0 3.86 6 0 0 0 0 4.2 6 2 2 3 32012 Twins 3-2 3.68 64 0 0 0 5 62.0 41 21 15 16 55TOTALS 13-5 3.08 228 0 0 0 5 231.0 192 92 79 89 198

MARK DIFELICEMajor League Debut: With Milwaukee on May 18, 2008 vs. Boston Red Sox

CAREER MAJOR LEAGUE STATISTICS:Year Team W-L ERA G GS CG SHO Sv IP H R ER BB SO2008 Brewers 1-0 2.84 15 0 0 0 0 19.0 17 7 6 4 202009 Brewers 4-1 3.66 59 0 0 0 0 51.2 49 21 21 15 48TOTALS 5-1 3.44 74 0 0 0 0 70.2 66 28 27 19 68

GREG HOLLANDMajor League Debut: With Kansas City on August 2, 2010 at Oakland Athletics

CAREER MAJOR LEAGUE STATISTICS:Year Team W-L ERA G GS CG SHO Sv IP H R ER BB SO2010 Royals 0-1 6.75 15 0 0 0 0 18.2 23 15 14 8 232011 Royals 5-1 1.80 46 0 0 0 4 60.0 37 13 12 19 742012 Royals 7-4 2.96 67 0 0 0 16 67.0 58 22 22 34 91TOTALS 12-6 2.97 128 0 0 0 20 145.2 118 50 48 61 188

CHARLES THOMASMajor League Debut: With Atlanta June 23, 2004 at Florida Marlins

CAREER MAJOR LEAGUE STATISTICS:Year Team G AVG AB R H 2B 3B HR RBI TB BB SO SB-SBA2004 Braves 83 .288 236 35 68 8 4 7 31 105 21 45 3-42005 Athletics 30 .109 46 4 5 0 0 0 1 5 5 8 0-1TOTALS 113 .259 282 39 73 8 4 7 32 110 26 53 3-5

DAVID PEMBERMajor League Debut: With Milwaukee Sept. 3, 2002 at Chicago Cubs

CAREER MAJOR LEAGUE STATISTICS:Year Team W-L ERA G GS CG SHO Sv IP H R ER BB SO2002 Brewers 0-1 5.19 4 0 0 0 0 8.2 7 6 5 6 5TOTALS 0-1 5-19 4 0 0 0 0 8.2 7 6 5 6 5

JASON BEVERLINMajor League Debut: With Cleveland July 29, 2002 at Oakland Athletics

CAREER MAJOR LEAGUE STATISTICS:Year Team W-L ERA G GS CG SHO Sv IP H R ER BB SO2002 Indians 0-0 7.36 4 0 0 0 0 7.1 9 7 6 4 9 Tigers 0-3 9.49 7 3 0 0 0 12.1 18 15 13 5 7TOTALS 0-3 8.69 11 3 0 0 0 19.2 27 22 19 9 16

PAUL MENHARTMajor League Debut: With Toronto Apr. 27, 1995 vs. the Oakland Athletics

CAREER MAJOR LEAGUE STATISTICS:Year Team W-L ERA G GS CG SHO Sv IP H R ER BB SO1995 Blue Jays 1-4 4.92 21 9 1 0 0 78.2 72 49 43 47 501996 Mariners 2-2 7.29 11 6 0 0 0 42.0 55 36 34 25 181997 Padres 2-3 4.70 9 8 0 0 0 44.0 42 23 23 13 22TOTALS 5-9 5.47 41 23 7 0 0 164.2 169 108 100 85 90

WAYNE TOLLESONMajor League Debut: With Texas Sept. 1, 1981 vs. Toronto Blue Jays

CAREER MAJOR LEAGUE STATISTICS:Year Team G AVG AB R H 2B 3B HR RBI TB BB SO SB-SBA1981 Rangers 14 .167 24 6 4 0 0 0 1 4 7 5 2-21982 Rangers 38 .114 70 6 8 1 0 0 2 9 5 14 1-21983 Rangers 134 .260 470 64 122 13 2 3 20 148 40 68 33-431981 Rangers 118 .213 338 35 72 9 2 0 9 85 27 47 22-261985 Rangers 123 .313 323 45 101 9 5 1 18 123 21 46 21-331986 White Sox 81 .250 260 39 65 7 3 3 29 87 38 43 13-19 Yankees 60 .284 215 22 61 9 2 0 14 74 14 33 4-81987 Yankees 121 .221 349 48 77 4 0 1 22 84 43 72 5-81988 Yankees 21 .254 59 8 15 2 0 0 5 17 8 12 1-11989 Yankees 80 .164 140 16 23 5 2 1 9 35 16 23 5-61990 Yankees 73 .149 74 12 11 1 1 0 4 14 6 21 1-1TOTALS 863 .241 2322 301 559 60 17 9 133 680 219 384 108-149

JERRY REEDMajor League Debut: With Philadelphia Sept. 11, 1981 at Pittsburgh Pirates

CAREER MAJOR LEAGUE STATISTICS:Year Team W-L ERA G GS CG SHO Sv IP H R ER BB SO1981 Phillies 0-1 7.71 4 0 0 0 0 4.2 7 4 4 6 51982 Phillies 1-0 5.19 7 0 0 0 0 8.2 11 6 5 3 Indians 1-1 3.45 6 1 0 0 0 15.2 15 6 6 3 101983 Indians 0-0 7.17 7 0 0 0 0 21.1 26 19 17 9 111985 Indians 3-5 4.11 33 5 0 0 8 72.1 67 41 33 19 371986 Mariners 4-0 3.12 11 4 0 0 0 34.2 38 13 12 13 161987 Mariners 1-2 3.42 39 1 0 0 7 81.2 79 32 31 24 511988 Mariners 1-1 3.96 46 0 0 0 1 86.1 82 42 39 33 481989 Mariners 7-7 3.19 52 1 0 0 0 101.2 89 44 36 43 501990 Mariners 0-1 4.91 4 0 0 0 0 7.1 8 4 4 3 2 Boston 2-1 4.80 29 0 0 0 2 45.0 55 27 24 16 17TOTALS 20-19 4.82 238 12 0 0 18 479.1 477 238 210 172 248



YEAR PLAYER SIGNED BY Rnd Overall Pick2012 Ross Heffl ey Atlanta Braves 18 5692011 Kyle Deese St. Louis Cardinals 23 710 Matt Benedict Pittsburgh Pirates 30 9022010 Daniel Ottone San Diego Padres 33 9942009 Nick Liles San Francisco Giants 7 207 Chris Masters Atlanta Braves 11 328 Brent Greer Arizona Diamondbacks 14 426 Corey Martin Chicago Cubs 27 8302008 Tyler Sexton Baltimore Orioles 31 926 Blake Murphy St. Louis Cardinals 42 12652007 Jonathan Greene Texas Rangers 8 260 Greg Holland $ Kansas City Royals 10 306 Kenny Smith Texas Rangers 20 620 Steven Strausbaugh New York Yankees 37 1135 Blake Murphy Chicago Cubs 50 14352006 Brian McCullen Pittsburgh Pirates 38 11302005 Jared Greenwood New York Yankees – Free Agent2003 Ryan Basner Atlanta Braves 7 217 Todd Buchanan Arizona Diamondbacks 13 396 Alan Beck Baltimore Orioles 16 464 Ryan Schade Florida Marlins – Free Agent2002 Jared Burton $ Oakland A’s 8 2482001 Matt Price Milwaukee Brewers – Free Agent2000 Charles Thomas $ Atlanta Braves 19 5801999 Eric Johnson Cleveland Indians 3 107 David Pember $ Milwaukee Brewers 8 244 Chris Moore Colorado Rockies 11 3401998 Chris Davidson Baltimore Orioles 4 129 Mark DiFelice $ Colorado Rockies 15 450 Donnie Suttles Cleveland Indians 12 363 Jeff Sziksai New York Yankees 22 662 Brian Hutchinson Toronto Blue Jays 40 1191 Chuck Koone Baltimore Orioles NA Martin Barrow Frontier League – Free Agent1997 Alex Tolbert Pittsburgh Pirates 22 6621996 Eric Whitson Tampa Bay Devil Rays N/A1994 Jason Beverlin $ Oakland Athletics 4 93 Stephen Pritchard Milwaukee Brewers 22 599 Mike Tidick Chicago White Sox 47 1299 Roy Hurst Chicago Cubs N/A – Mike Manning Texas Rangers N/A –1993 Brad Tweedlie Cincinnati Reds 3 92 Phillip Grundy Kansas City Royals 4 1051992 Dan Kyslinger Milwaukee Brewers 5 136 Matt Raleigh Montreal Expos 14 379 Jack Kimel Texas Rangers 32 902 Patrick Kendrick Chicago Cubs N/A –1991 Kevin Bellomo San Francisco Giants 56 1406 Todd Raleigh Boston Red Sox Free Agent1990 Paul Menhart $ Toronto Blue Jays 8 225 Grant Brittain Atlanta Braves Free Agent1989 Jeff Stevens Cleveland Indians – –1988 Tom Malchesky St. Louis Cardinals 12 314 Skip Nelloms New York Yankees 22 573 Dave Piela Atlanta Braves 54 1296 Keith LeClair Atlanta Braves – Free Agent1987 Freddie Hailey New York Yankees 19 496 Andy Rickman Cincinnati Reds N/A1986 Ron Huntington Atlanta Braves 39 486 Keith Smith Atlanta Braves N/A1985 Scott Gay New York Yankees 4 103 John Pust New York Mets – Free Agent1984 Charlie Fonville Seattle Mariners 38 796 John Pust Cleveland Indians 43 8201983 David Hill Seattle Mariners N/A –1982 Kyle Carson Seattle Mariners N/A –1980 Willie Carpenter Texas Rangers N/A –

C ATA M O U N T S I N T H E M A J O R L E A G U E B A S E B A L L D R A F T

1979 Rick Adair # Seattle Mariners 3 53YEAR PLAYER SIGNED BY Rnd Overall Pick1978 Wayne Tolleson $ Texas Rangers 8 202 Keith Ebersole Chicago Cubs N/A –1977 Wayne Tolleson Pittsburgh Pirates 12 304 Jerry Reed $ Philadelphia Phillies 22 5591976 Mike Hicks Texas Rangers N/A – Flip Watson Texas Rangers N/A –1975 Jerry Gaines Texas Rangers N/A –1973 Don Bright Texas Rangers N/A –1972 Jim Grove Texas Rangers N/A –1971 Tommy Hayes Chicago White Sox N/A – Wayne McCauley Washington Senators N/A –1969 Jim Thompson St. Louis Cardinals N/A –1967 Roddy Edwards Washington Senators N/A –

$ — Denotes player played on a major league club# — Pitching coach with the Cleveland Indians from 1991-93, Detroit Tigers from 1996-2000, Atlanta Braves from

2001-03; minor league pitching coordinator with Texas Rangers, and currently Seattle Mariners Pitching Coach

FORMER CATAMOUNTS THAT PLAYED ON MAJOR LEAGUE CLUBS:ATLANTA BRAVES:Charles Thomas .............................................................2004

BOSTON RED SOX:Jerry Reed ...................................................................... 1990

CHICAGO WHITE SOX:Wayne Tolleson .............................................................. 1986

CINCINNATI REDS:Jared Burton .............................................................2007-10

CLEVELAND INDIANS:Jerry Reed ................................................................ 1982-85Jason Beverlin ................................................................2002

DETROIT TIGERS:Jason Beverlin ................................................................2002

KANSAS CITY ROYALS:Greg Holland ......................................................... 2010-pres.

MILWAUKEE BREWERS:David Pember ................................................................2002Mark DiFelice ........................................................... 2008-09

MINNESOTA TWINS:Jared Burton ......................................................... 2012-pres.

NEW YORK YANKEES:Wayne Tolleson ........................................................ 1986-90

OAKLAND ATHLETICS:Charles Thomas .............................................................2005

PHILADELPHIA PHILLIES:Jerry Reed .................................................................1981-82

SAN DIEGO PADRES:Paul Menhart ................................................................. 1997

SEATTLE MARINERS:Paul Menhart ................................................................. 1996Jerry Reed ................................................................ 1986-90

TEXAS RANGERS:Wayne Tolleson .........................................................1981-85

TORONTO BLUE JAYS:Paul Menhart ................................................................. 1995



Western Carolina University’s Athletics Hall of Fame was established in 1990 to recognize the outstanding accomplishments of former student-athletes, coaches and administrators.Inductees are selected by a 10-member committee composed of representatives from the University’s alumni association, former athletes association, faculty athletics committee,

administration, athletics department, the Catamount Club and area media representatives.

PAT R O N A W A R D 1992 ..................................... Ralph Sutton 1993 ........ E.J. Whitmire & Dr. Wallace Hyde 1994............................Dr. Quinn Constantz 1995.......................................Alice Benton 1996................................. Dr. Jim Hamilton 1998..........................Dr. Gurney Chambers 1999..................................Jimmy Childress 2004 ..................................Larry Stanberry 2005 ....................................Nathan Arthur

C A R E E R A C H I E V E M E N T2007 ................Dave Bristol & Jim Garrison

NAME (INDUCTED) .......................YEARS AT WCU

ARDREY, Sam (1997) ............................1937-40.................. Baseball, Men’s Basketball, Football

ARLEDGE, Jayne (1992) ........................1976-79........................................... Women’s Basketball

BEVERLIN, Jason (2008) ...................... 1992-94.............................................................Baseball

BIASUCCI, Dean (1997) ....................... 1980-83..............................................................Football

BODINE, Tom (2010) .............................1991-94..............................................................Football

BROWN, Regina (1998) ........................ 1987-92...........................Volleyball, Women’s Basketball

BYRD, Art (1990) ................................. 1946-49..............................................................Football

CARPENTER, Wille (1994) .....................1976-80............................................ Football & Baseball

CARMICHAEL, Alonzo (2008) ............... 1983-86..............................................................Football

CARR, Ronnie (1999) ........................... 1980-83................................................Men’s Basketball

CHEUNG, Patrick (1990) .......................1970-73......................................................Men’s Soccer

CHILDERS, Tobe (2010) .........................1957-60..............................................................Football

COOPER, Louis (2005) ..........................1981-84..............................................................Football

DALTON, Don (1995) .............................1966-81....................................Football (Player & Coach)

DENNIS, Greg (1997) ............................1979-82................................................Men’s Basketball

DODSON, Clinton F. (1991) .................. 1934-69..................................................... Administrator

DOWELL, Jean (1992) .......................... 1963-66........................................... Women’s Basketball

DURR, Walter J. (1991) ..........................1951-98...................................................Team Physician

FAIREY, Clint (1998) ............................. 1986-89.............................................................Baseball

FERGUSON, Mark (2006) ......................1970-73..............................................................Football

FINCH, Nora Lynn (1991) ...................... 1967-70..................... Women’s Basketball, Field Hockey,................................................ Tennis, Volleyball

GAINES, Jerry (1991).............................1970-75.......................Football, Track & Field & Baseball

GARDNER-MAYHORN, Susie (2004) ..... 1989-93................ Women’s Track & Field/Cross Country

GAY, Scott (2006) ................................ 1983-85.............................................................Baseball

GIBSON, Mel (1992) ............................ 1960-63................................................Men’s Basketball

GILBERT, Jeff (2000) .............................1981-84..............................................................Football

GREEN, Judy (1990) ............................. 1980-84.............Women’s Basketball, Softball, Volleyball

GREENE, George “Tiger” (1998) ............1981-84..............................................................Football


GRIFFIN, Odell (1992) .......................... 1939-40................................................Men’s Basketball

GRUNDY, Phillip (2005) .........................1991-93.............................................................Baseball

GUDGER, Jim (1990) ............................ 1940-69................................................. Athlete & Coach

HAILEY, Freddie (1999) ........................ 1984-87.............................................................Baseball

HAMILTON, Hugh “Pee Wee” (1992) ......1947-50..............................................................Football

HARKINS, Todd (2011) ......................... 1989-92..............................................................Football

HARP, Gerald (1992) .............................1977-80..............................................................Football

HARTBARGER, Jim (2000) .................... 1969-75.................................................................Coach

HARTSELL, Susan B. (1994) .................1973-76.........................................................Gymnastics

HASTINGS, Rebecca Twiner (2010) ....... 2000-04..................................................... Women’s Golf

HAYES, Kerry (2010) ..............................1991-94..............................................................Football

HAYWOOD, Bill (1996) ..........................1969-81.................................................. Baseball Coach

HELMS, Terry (2011) ............................ 1968-72................................Cross Country, Track & Field

HOLLIDAY, Emily (1996) ....................... 1982-86...........................Women’s Basketball, Volleyball

HOOVER, Brad (2008) .......................... 1996-99..............................................................Football

HOWELL, Charles “Babe” (1998) .......... 1950-53............................................ Football & Baseball

JAMES, Anthony (1991) .........................1979-83........................................ Football, Track & Field

JOHNSON, Eric (2012) .......................... 1995-99...............................................Baseball, Football

JONES, Paul (2002) ........ 1967-68 and 1969-81.. Cross Country/Track & Field (player and coach)

LAVELLE, Tommy (2000) ....................... 1961-64................................................Men’s Basketball

LeCLAIR, Keith (2002) ..... 1985-88 and 1992-97...............................Basetball (player and coach)

LEGGETT, Jack (2001) ...........................1983-91.................................................. Baseball Coach

LIPFORD, Darrell (2004)........................1974-77..............................................................Football

LIVESAY, Robyn Keeler (1995) .............. 1980-84..............................................Softball, Volleyball

LOGAN, Henry (1990) ........................... 1965-68................................................Men’s Basketball

LUNDY, Ralph (2006) ............................1970-71......................................................Men’s Soccer

LYONS Wilson, Lori (2002) ................... 1990-93........................................... Women’s Basketball

McCOLLUM, Anquell (2010) ................. 1992-96.................................... Men’s Basketball, Coach

McGINN, Bob (1992) ............................1947-50................................................Men’s Basketball


McINTOSH, Otis (1997) .........................1968-71..............................................................Football

McKENNIE, Tony (2008) ....................... 1986-90.......................................................Track & Field

MILLER, Brett D. (2001) ....................... 1984-86..........................................................Men’s Golf

MOORE, Chris (2011) ........................... 1996-99.............................................................Baseball

MOORE, Nardia (2011) .................... 1999-2002................................................. Women’s Soccer

MORGAN, Ken (1998) .......................... 1960-63............................................ Football & Baseball

MURRAY, Darrell (2006) ....................... 1960-64................................................Men’s Basketball

PEELE, Betty (1997) ............................. 1963-96..........................................Coach, Administrator

PERSONS, Susan (2005)...................... 1969-75.................................................................Coach

PETERSON, Bruce (2001) ..................... 1960-64......... Football, Men’s Basketball & Men’s Tennis

POINDEXTER, C.C. (1991)..................... 1930-35....................................Athletic Director & Coach

PRYOR, Harris (1994) ........................... 1956-59.................................Men’s Basketball, Baseball

RALEIGH, Matt (2004).......................... 1989-92.............................................................Baseball

RASHEED, Eric (2000) ...........................1981-84..............................................................Football

RATCLIFFE, Carl (1992) ........................ 1933-36..............................................................Football

RAY, Dr. Bob (2009) ..............................1951-92..................... Basketball, Coach & Administrator

REED, Jerry (1994) ................................1974-77.............................................................Baseball

ROACH, Kirk (1996) ............................. 1984-87..............................................................Football

ROBINSON, Dan (1990) ....................... 1946-68................................................. Athlete & Coach

ROGERS, Ronald (1990) ...................... 1950-53................................................Men’s Basketball

ROSS, Devondia (2005) ....................... 1990-93........................................Women’s Track & Field

RUTA, John (2008) .............................. 1962-65..............................................................Football

SALTZ Simmons, Cindi (2000) ...............1979-82........................................... Women’s Basketball

SANDERS Peterson, Karen (2001) ........ 1962-64.......................................................Men’s Tennis

SCHRADER, Dr. Charles (1998) ............ 1968-93........................................... Men’s Soccer Coach

SEAL, Gaston (2010) ............................ 1959-63................................................Men’s Basketball

SELZER, Tommy “Bromo” (1995) .......... 1948-52...............................................Football, Baseball

SETZER, Bobby (1992) ..........................1951-92......................... Football, Coach & Administrator

SIMMONS, Clyde (2002) ...................... 1982-85..............................................................Football


SPRADLING, Steve (2009).................... 1967-70..............................................................Football

STANKUNAS, Frank (1992) ................... 1960-63..............................................................Football

STANLEY, Bill (2012) ............................ 1964-69..............................................................Football

STROUD, Judy (1999) ............................1973-76........................................... Women’s Basketball

TIESZEN Kamarainen, Laura (2012) ...... 2002-05........................................Women’s Track & Field

WESTMORELAND Suhre, Betty (1990) .... 1965-79.................................................................Coach

THARPE, Danny (1991) ......................... 1960-64.... Men’s Basketball, Baseball, Football & Tennis

TOLLESON, Wayne (1990) .....................1974-78............................................ Football & Baseball

WATERS, Bob (1993)............................ 1969-88...................... Football Coach & Athletic Director

WELLMON, Laura Echols (2009) ....... 1999-2002........................................... Women’s Basketball

WIKE, Johnny (2009) ........................ 1964-2004...............Football, Men’s & Women’s Golf Coach

WILLIAMS, Denny (2004) ..................... 1955-60..............................................................Football

WILLIAMS, Jim (1992) .......................... 1964-66..............................................................Football

WILLIAMS, Steve (1996) .......................1968-71..............................................................Football

WILLIAMS, Willie (2006) ...................... 1990-92..............................................................Football

WILSON, Thomas “Bubba” (2002) .........1975-78................................................Men’s Basketball

WITTMAN, Greg (1996) ......................... 1966-69................................................Men’s Basketball

WHITE, Steve (1999) .............................1970-98..................................................... Administrator

YATES, Steve (2009) .............................. 1971-74..............................................................Football

YOUNG, Tom (1990) ............................ 1946-68....................................Athletic Director & Coach

1983 FOOTBALL TEAM (2003)

1963 MEN’S BASKETBALL TEAM (2003)

1969 WOMEN’S BASKETBALL TEAM (2003)

1949 FOOTBALL TEAM (2007)



SAM ARDREY – (1937-40) – Inducted in 1997A three sport star in the pre-World War II years as he was a standout for the baseball, basketball and football teams in the 1938 and 1940 seasons. He was the baseball team’s regular catcher for three seasons and hit a .360 pace as a senior when he captained the 1940 squad. He averaged 14 points a game for his three season basketball career and was a fi rst team All North State conference selection in his senior season. He was a two way starter for the football team at offensive and defensive end.

JASON BEVERLIN – (1992-94) – Inducted in 2008Beverlin is the most honored pitcher in Western Carolina baseball history. He was a consensus All-America selection, SoCon Pitcher and Male Athlete of the Year, a two-time All-Atlantic Region All-Star and helped lead WCU to three-con-secutive NCAA Regional meets from 1992 through 1994. In addition, he was named to the SoCon’s 75th Anniversary Baseball Team, meaning he was voted one of the six best pitchers in the conference, 1921 to 1996. Only pitching for the Catamounts for three seasons, Beverlin won 27 games and was the all-time, single-season leader in wins (12) and led the nation with a school and conference season strike-out record of 154. He also set league benchmark for con-secutive wins in a season (11 in 1994) and most wins in a conference tournament in 1993. In addition, Beverlin was a two-time member of the SoCon All-Academic Team. Drafted in the fourth round of the 1994 Major League Baseball Draft by the Oakland Athletics, Beverlin pitched in Major Leagues for both the Cleveland Indians and Detroit Tigers.

WILLIE CARPENTER – (1976-80) – Inducted in 1994A rare two sport star of the 1970’s that won all conference honors in baseball and football. He played every baseball game in the WCU outfi eld for four seasons, 1977-80, and broke 11 season career records. His .359 career batting average ranks among WCU’s all-time top fi ve. He was an All-Southern Conference baseball selection twice. On the foot-ball side, he started in the Catamount backfi eld for three seasons and was fi rst team All-Southern Conference selec-tion twice. He led the conference in interceptions in 1978 and was runner up for All Conference Athlete of the Year in 1980. Following graduation he signed a professional base-ball contract and spent three seasons in the Texas Rangers organization.

CLINT FAIREY – (1986-89) – Inducted in 1998Completed his career as the most honored position player in WCU’s baseball history. A key performer on WCU’s four consecutive Southern Conference Championship teams and NCAA tournament teams, 1986-89. He was named Southern Conference Player of the Year in three of his four seasons, 1987-89, and is the only player in Southern Conference history to win the coveted award three times. All-America selection in 1987 when he batted .405, hit 19 home runs and batted in 68 runs. All-Atlantic Region All-Star in 1987 and 1989, three-time All-Southern Conference selection as designated hitter )1987) and as fi rst baseman (1988 and 1989), and MVP of the 1987 Southern Confer-ence Tournament. Finished his career with 61 home runs, 199 RBI and .387 average.

SCOTT GAY – (1983-95) – Inducted in 2006A fi rst-team All-SoCon selection in 1984 and 1985, Gay was additionally named Western’s third Southern Confer-ence Player of the Year after leading WCU to the fi rst of fi ve-straight, SoCon championships and the school’s fi rst ever

NCAA Tournament berth in 1985. At the East Regional, Gay pitched a complete game in the fi rst game, leading West-ern to an upset over top-seed Old Dominion to give the Cats their fi rst NCAA victory. He led SoCon in strikeouts in 1984 (62) and 1985 (118). Not only was his 12 wins in 1985 a WCU single-season record (later tied by Jason Beverlin in 1993), but it was a SoCon record and currently ranks sec-ond in league history. Gay ranks fi rst in all-time winning per-centage at Western (.788), going 23-7 over his career. His career winning percentage was bolstered by a perfect 10-0 record in 1984 and a 12-4 mark in 1985. Gay and fellow Catamount pitchers Beverlin and Mark DiFelice (along with ETSU’s Matt Barber) are the only pitchers in SoCon history to post two, 10-win seasons. Gay, who was 17-2 against So-Con opponents over his career, fi nished with 26 career wins in just three seasons, which was a school record in 1985 and now ranks fi fth on the WCU all-time list, and 213 career strikeouts, which ranked second in 1985 and now ranks ninth. Also, Gay’s 26 career wins ranked third on the SoCon all-time list upon his leaving WCU and still ranks 12th-tied. A 19th-round draft pick of the Boston Red Sox out of high school, Gay left Western after his junior season as he was drafted by the New York Yankees in the fourth round (103rd pick overall) in 1985 amateur baseball draft. He played seven in years in the Yankees and San Francisco Giants or-ganizations.

ODELL GRIFFIN –(1939-40) – Inducted in 1992Odell Griffi n was Western Carolina’s fi rst nationally recog-nized baseball player. He threw a no hitter at Tennessee as a freshman and set standards that would stand for three decades. He posted a 21-2 record in only two seasons and averaged 16 strikeouts per game in his collegiate career. He signed with the Philadelphia Athletics after the 1940 sea-sons, but World War II cut his professional career short. He later distinguished himself as a coach and administrator at West Henderson High. An endowed scholarship bearing his name is awarded annually to the outstanding WCU pitcher.

PHILLIP GRUNDY – (1991-93) – Inducted in 2005An All-American in 1993, batting .333 with 17 home runs and a SoCon-leading 66 RBI, while posting a 3.12 ERA on the mound. Led WCU to the 1993 SoCon tournament cham-pionship, earning tournament MVP honors. Was a two-time, fi rst team All-SoCon pick (1991 and ‘93), a second team All-SoCon pick as a pitcher and designated hitter in 1992, as well as a two-time ABCA All-Atlantic Region selection (1991 and ‘93). Played a key role in the 1992 Catamounts winning both the SoCon regular season and tournament crowns and get two within two outs from advancing to the College World Series. As a freshman (1991), was used solely as a pitcher and went 11-4 with a 3.86 ERA, leading all NCAA freshmen in victories (ranking seventh overall) and earning Collegiate Baseball’s Freshman All-America honors. In three seasons as a pitcher, posted a 24-16 record with a 3.09 ERA and struck out 263 batters in 294.1 innings. At the plate had .335 career average with 27 home runs and 106 RBI in less than 100 games. Grundy left Western after his junior season after being a fourth-round pick of the Kansas City Royals (second overall pick by the organization). JIM GUDGER – (1940-69) – Inducted in 1990 Jim Gudger’s athletic career at Western spanned 29 years (1940-69) as he played and coached three sports – basket-ball, football and baseball. He played three sports before and after World War II and was an All-Conference selection

in all three. He became head basketball and baseball coach in 1950 and was also assistant football coach. He led the basketball program for 19 seasons and his team won 311 games and three conference championships. His 1963 team advanced to the NAIA national championship game. He guided the baseball team to nine winning records in 11 seasons and three conference titles. He is also in the NAIA and Western North Carolina halls of fame.

FREDDIE HAILEY – (1984-87) – Inducted in 1999All-Star outfi elder on WCU’s 1984-87 baseball team that won four Southern Conference Championships and played in three NCAA tournaments. He is the ONLY baseball player in WCU and Southern Conference history to be named All-Conference for four seasons. He ranks in WCU’s all time top 10 in base hits, RBI, triples, and stolen bases and batting average and owns three seasons and three game bests and made only three errors in four seasons. He led the South-ern Conference in hitting as a freshman and was among the leagues top fi ve hitters in each of his four seasons. He collected 10 hits in the 1987 NCAA Midwest regional when WCU defeated Big Ten and Southeastern Conference cham-pions and fi nished 28th nationally.

BILL HAYWOOD – (1969-81) – Inducted in 1996Head baseball coach for 13 seasons (1969-81) and his 1981 team owns distinction of winning WCU’s fi rst ever Southern Conference Championship. He led WCU’s base-ball teams to a 251-181 record that included NAIA District Six Championships in 1971 and 1972 and the 1981 South-ern Conference’s fi rst division. 14 of his players signed professional contracts and two reached the major league level where each played several seasons. He was a baseball All-America selection at the University of North Carolina and went on to pitch for the Washington Senators in the Ameri-can League. Also managed in he Texas Rangers organization and was player personnel director for the Seattle Mariners.

CHARLES “BABE” HOWELL – (1950-53) – Inducted in 1998A WCU football and baseball standout in the early 1950’s who went on to become the winningest high school football coach in North Carolina history. Graduated from WCU in 1954 after four seasons in both football in baseball. Named outstanding player as a tackle for the 1951 football team and starting pitcher for three baseball seasons. After nine seasons as head coach in Georgia, he returned to coach Sylva-Webster High (now Smoky Mountain) for the next 25 years to lead the school to fi ve state football champion-ships and two state baseball championship and completed his coaching career at Avery High. Finished football coach-ing career with state record 301 wins and also led baseball teams with 618 wins. Awarded numerous coaching honors and chosen to serve on several state and national boards in distinguished career that spanned fi ve decades.

ERIC JOHNSON – (1995-99) – Inducted in 2012A two-sport standout playing both football and baseball, twice earning football All-America accolades in 1997 and consensus fi rst team plaudits in 1998. Named to WCU’s All-20th Century Team in 2000, was a two-time All-Southern Conference selection as a defensive back and one of just fi ve student-athletes in SoCon history to earn fi rst team all-conference honors in football and baseball in the same year (1998-99). Drafted in the third round by the Cleveland Indians in 1999, played both professional baseball and football, making the Chicago Bears practice squad in 2001.

C ATA M O U N T B A S E B A L L I N T H E W C U AT H L ET I C S H A L L O F FA M E



KEITH LECLAIR – (1985-88, 1992-97) – Inducted in 2002Played on four consecutive Southern Conference Champi-onship Baseball teams (1985-88) as a fi rst baseman. At the time of his induction he ranked in the top 10 in six different WCU hitting categories while posting a career .375 batting average. He was named MVP of the 1988 Southern Confer-ence Tournament (batted .600/12 RBI). In 1992 he be-came Western’s head coach and led the Catamounts to the Southern Conference regular season and tournament cham-pionships as well as the championship of the NCAA south regional. Overall he lead WCU to three Southern Conference tournament titles and three Southern Conference regular season titles. LeClair was a three time Southern Conference Coach of the Year with a career record of 229-135.

JACK LEGGETT – (1983-91) – Inducted in 2001The winningest baseball coach in WCU history upon in-duction with 302 wins in nine seasons. He served as head baseball coach from 1983 through the 1991 seasons before leaving for Clemson University. He guided WCU to fi ve consecutive Southern Conference tournament cham-pionships, followed by fi ve trips to the NCAA tournament, 1985-89. Only one of his nine teams fi nished lower than second place in the Southern Conference standings with fi ve regular season championships and seven of his teams played for the conference tournament championship. His team posted a 23-7 record in conference tournament play. Five of his teams were nationally ranked during regular sea-son play and two fi nished in the top 30 nationally. He was named NCAA Division I Atlantic Region Baseball Coach of the Year in 1987 and was appointed to the NCAA Division I Baseball Committee in 1989. 35 of his players were named fi rst team All Southern Conference, six where named con-ference player of the year, six where All American selections and 25 signed professional contracts.

KEN MORGAN – (1960-63) – Inducted in 1998All-star performer in two sports - football and baseball- in early 1960’s. Came to Western in 1959 after earning all-state honors at Marion (NC) High. Moved into starting quar-terback sport during the 1960 season and led the team to 6-5 which included upsets of Tampa when he scored three touchdowns and Emory and Henry with a game winning 70 yard punt return. Second in conference in offense. All Caro-lina’s Conference in 1961 when he played quarterback and halfback and started in the defensive backfi eld. Became full time running back in 1962 and led the team in receiving. Baseball all conference in 1961, and again in 1962 when he led WCU in batting average, RBI and home runs. His career home run record stood for 15 seasons after completion of his college career.

CHRIS MOORE – (1996-99) – Inducted in 2011A four-time All-SoCon selection, one of just three in school history at the time of his induction. Was a two-time All-America selection, garnering freshman All-America honors in 1996 and Collegiate Baseball Louisville Slugger All-America honors in 1999. Finished his WCU career with 311 career base hits and a school-record 254 RBI. He was draft-ed in the 11th round of the 1999 MLB Draft by the Colorado Rockies and spent four years in the farm system before em-barking on his coaching career … Inducted in 2011.

HARRIS PRYOR – (1956-59) – Inducted in 1994A two sport all-star in the late 1950’s, he started for four seasons, 1956-1959, on the basketball and baseball teams. As the starting point guard for four seasons, led WCU

to four consecutive winning records and averaged scoring in double fi gures. He was an all-conference selection twice and was named to the conference all-tournament team three times. In 1959, he led Western to its fi rst North State Conference championship and was the tournament’s MVP and was named All-NAIA District 26. In baseball, he was a two time all-conference selection and in his senior season posted an 11-4 record with 12 complete games while lead-ing the team in hitting and home runs. He was voted 1959 Western North Carolina Athlete of the Year.

MATT RALEIGH – (1989-92) – Inducted in 2004Played baseball at Western Carolina from 1989-92 and left as not only one of the school’s top hitters but the Southern Conference’s as well. A 1992 second team All-American, he was a three-time, fi rst team All-SoCon pick, earning the league’s Player of the Year honor in 1992. In 1992, Raleigh led the SoCon in home runs (25), runs scored (77), slugging percentage (.783) and RBI (73), while helping the Cats to a then school-record 44 wins and one game shy of the College World Series, falling twice to Florida State in the champion-ship of the NCAA South Region II. Also in 1992, he became the fi rst Catamount to hit at least 20 home runs and steal at least 20 bases, while his 25 home runs ranked second in the nation. He additionally paced the SoCon in home runs in 1991 (19). When he left Western, Raleigh had set both WCU and SoCon records for career hits (302), career games played (342), career at bats (837), career runs scored (251), career home runs (68), career total bases (580) and career runs batted in (239). He also set WCU and SoCon season records for runs scored (77 in 1992) and home runs (25 in 1992). Currently, he ranks ninth on the WCU career batting average list (.361), second on the WCU career hits list (302), fi fth on the WCU career doubles list (56), eighth on the WCU career triples list (8), fi rst on the WCU career home runs list (68), second on the WCU career RBI list (239), ninth on the WCU career stolen bases list (47), and fi rst on the WCU ca-reer runs scored list (251).

JERRY REED – (1974-77) – Inducted in 1994The fi rst WCU pitcher to play Major League baseball and NCAA Division I all-star pitcher. The ace of the 1977 pitch-ing staff that helped WCU to fi nish one win shy of the South-ern Conference Championship as he posted a 10-0 record. He ranks in the top fi ve on WCU’s career wins and earned runs average list. First team all-state and all Atlantic Region teams in 1977. After graduation he spent four years in the minor leagues with Philadelphia before making in to the ma-jors. He pitched all or part of eight seasons in Major League Baseball with Philadelphia (1981-82), Cleveland (1982-85), Seattle (1986-90) and Boston (1990). He was one of Seattle’s top pitchers for three seasons.

TOMMY “BROMO” SELZER – (1948-52) – Inducted in 1995An outstanding two sport star in post World War II era who continued to give his best effort for the Catamounts four decades after graduation. All-North State conference se-lection as a defensive back in 1951 and teams defensive captain. Two time All-Conference selection in baseball as an outfi elder, a twice named team captain. Rare four time letterman in both sports (1947-52). Named school’s out-standing athlete in his senior year. Served as assistant foot-ball coach in 1953. Decorated for participation in fi ve World War II Naval invasions. One of the fi rst WCU alumni to fund an athletic scholarship, a key organizer in the Catamount Club’s successful Charlotte auction and Charlotte’s number one Western Carolina ambassador.

DANNY THARPE – (1960-64) – Inducted in 1991Danny Tharpe is arguably the most versatile athlete in the history of WCU athletics as he started in four sports. He was a four year starter in basketball as point guard, and led the Catamounts to three 20 win seasons, a Carolina’s confer-ence championship, and the championship game in the NAIA National Tournament in 1963. He averaged in double fi gures in all four seasons. He was a regular on the tennis team for two seasons. He led the 1964 baseball team in hit-ting. He started at line backer for the 1964 football team before suffering a mid-season injury. He also excelled in the class room with 3.00 and he was a double major in biology and physical education.

WAYNE TOLLESON – (1974-78) – Inducted in 1990Wayne Tolleson became Western Carolina’s fi rst Southern Conference Athlete of the Year when he received that honor for 1977-78. He was a two sport star and All-Southern Con-ference selection in both. He was a starting wide receiver in football for three and a half season (1974-77) and led the nation in pass receptions in 1977 with 73 catches and was the team’s place kicker. He started at short stop for four season (1975-78), named All Southern Conference twice and was conference Player of the Year in 1978. He spent the past 10 years playing Major League Baseball most recently with the New York Yankees.

DAVE BRISTOL - Inducted in 2007CAREER ACHIEVEMENT AWARDBegan a 42-year career in professional baseball in 1951 when he signed with the Cincinnati Reds and played as an infi elder with the Reds Minor League system for 11 seasons. Became a player/manager at age 22 and won fi ve league championships in nine years as a minor league manager. Became Major League Baseball’s youngest manager at 33 in 1966 when he was named the Reds manager. Also managed the Milwaukee Brewers, Atlanta Braves and San Francisco Giants and coached for the Reds and Phillies. Previously inducted into four halls of fame, Bristol is a 1959 Western Carolina honor graduate.

PATRON AWARD RECIPIENTS WITH WCU BASEBALL TIES:

JIMMY CHILDRESS – Inducted in 1999The Childress Family has great ties to Western Carolina baseball through generous contributions, as well as broad-casting Catamount baseball on the radio at 680 AM, WRGC.

LARRY STANBERRY – INDUCTED IN 2004In 2003, Stanberry donated $300,000 to the Catamount baseball program, providing what is believed to be the second-largest, one-time gift ever given to the University Stanberry was recognized by the Southern Conference as one of its 10 recipients of the 2003-04 Distinguished Ser-vice Award. However, his affi liation with Western goes back many years. A Sylva High School graduate in 1957 and after serving in the U.S. Marine Corps, Stanberry began his re-lationship with Western’s baseball program in the mid-to-late 1960’s when he served as the team’s manager and right-hand man for then coach Ron Blackburn. Upon his graduation from Western in 1968, he entered the insurance business. Starting with Aetna Insurance then moving on to Hartford Insurance and Wachovia Insurance, which became Alexander & Alexander. In 1980, he and his late wife Susan, started Stanberry Insurance Agency, which is now owned by his sons, Kevin and Scott.

C ATA M O U N T B A S E B A L L I N T H E W C U AT H L ET I C S H A L L O F FA M E

















Belcher began his academic career in 1988 as an assistant professor of music at Mis-Belcher began his academic career in 1988 as an assistant professor of music at Mis-souri State University. During his 15-year tenure at MSU, he rose steadily through the aca-souri State University. During his 15-year tenure at MSU, he rose steadily through the aca-demic and administrative ranks. After serving as coordinator of keyboard studies in MSU’s demic and administrative ranks. After serving as coordinator of keyboard studies in MSU’s Music Department (1989-92) and assistant dean of the College of Arts and Letters (1993), Music Department (1989-92) and assistant dean of the College of Arts and Letters (1993), he was named dean of the College of Arts and Letters in 1994. He left Missouri in 2003 to he was named dean of the College of Arts and Letters in 1994. He left Missouri in 2003 to join UALR as provost and vice chancellor for academic affairs.join UALR as provost and vice chancellor for academic affairs.

At UALR, Belcher was credited with leading strategic planning and emphasizing the cam-At UALR, Belcher was credited with leading strategic planning and emphasizing the cam-pus’ institutional mission to be responsive to regional and state priorities. Under his leader-pus’ institutional mission to be responsive to regional and state priorities. Under his leader-ship, the campus has launched seven new doctoral degree programs, created an Offi ce of ship, the campus has launched seven new doctoral degree programs, created an Offi ce of Innovation and Commercialization to capitalize on faculty research and promote economic Innovation and Commercialization to capitalize on faculty research and promote economic development, implemented initiatives to improve student retention and graduation rates, development, implemented initiatives to improve student retention and graduation rates, earned designation as a Carnegie Community Engaged institution, and begun a thorough earned designation as a Carnegie Community Engaged institution, and begun a thorough review of the undergraduate curriculum. Belcher also is a member of the leadership team review of the undergraduate curriculum. Belcher also is a member of the leadership team for UALR’s fi rst comprehensive development campaign, which reached its $75-million fund-for UALR’s fi rst comprehensive development campaign, which reached its $75-million fund-raising goal 1½ years ahead of schedule in summer 2010 and has now been extended to raising goal 1½ years ahead of schedule in summer 2010 and has now been extended to $100 million.$100 million.

Throughout his career, Belcher has appeared widely as a recitalist and chamber musician Throughout his career, Belcher has appeared widely as a recitalist and chamber musician and been active in civic and community organizations. He currently serves on the boards of and been active in civic and community organizations. He currently serves on the boards of directors of the Arkansas Symphony Orchestra and the Winthrop Rockefeller Institute. A directors of the Arkansas Symphony Orchestra and the Winthrop Rockefeller Institute. A past chair of the Little Rock Arts and Culture Commission, he has previously led the boards past chair of the Little Rock Arts and Culture Commission, he has previously led the boards of the Springfi eld (Missouri) Regional Opera and the Springfi eld Regional Arts Council and of the Springfi eld (Missouri) Regional Opera and the Springfi eld Regional Arts Council and has held leadership positions with the National Conference of Governors’ Schools, Missouri has held leadership positions with the National Conference of Governors’ Schools, Missouri Citizens for the Arts, the Missouri Alliance for Arts Education, and the Urban Districts Alli-Citizens for the Arts, the Missouri Alliance for Arts Education, and the Urban Districts Alli-ance. Voted 2004 Administrator of the Year by UALR students, he also received the 1999 ance. Voted 2004 Administrator of the Year by UALR students, he also received the 1999 Ozzie Award from the Springfi eld Regional Arts Council in recognition of his outstanding Ozzie Award from the Springfi eld Regional Arts Council in recognition of his outstanding contributions to the arts.contributions to the arts.

Belcher is married to Susan Brummell Belcher, who taught voice at UALR and co-chaired Belcher is married to Susan Brummell Belcher, who taught voice at UALR and co-chaired the UALR Music Department Recruitment Committee.the UALR Music Department Recruitment Committee.

David O. Belcher, provost and vice chancellor David O. Belcher, provost and vice chancellor for academic affairs at the University of Arkansas for academic affairs at the University of Arkansas at Little Rock since 2003, was elected chancel-at Little Rock since 2003, was elected chancel-lor of Western Carolina University by the Board lor of Western Carolina University by the Board of Governors of the multi-campus University of of Governors of the multi-campus University of North Carolina. UNC President Tom Ross placed North Carolina. UNC President Tom Ross placed Belcher’s name in nomination Friday, April 8, 2011, Belcher’s name in nomination Friday, April 8, 2011, during a regular meeting of the board. Belcher, 53, during a regular meeting of the board. Belcher, 53, assumed his new duties July 1, succeeding John W. assumed his new duties July 1, succeeding John W. Bardo, who stepped down after 16 years.Bardo, who stepped down after 16 years.

In recommending Belcher to the Board of Gov-In recommending Belcher to the Board of Gov-ernors, Ross said: “David Belcher brings to the task ernors, Ross said: “David Belcher brings to the task more than two decades of academic and leader-more than two decades of academic and leader-ship experience at highly respected public univer-ship experience at highly respected public univer-sities. At each step along the way, he has proven sities. At each step along the way, he has proven himself to be an energetic and effective leader himself to be an energetic and effective leader who encourages strategic thinking, promotes col-

laboration and inclusiveness, and makes student success a university-wide responsibility. laboration and inclusiveness, and makes student success a university-wide responsibility. He has also earned a reputation for great integrity, sound decision-making, and a strong He has also earned a reputation for great integrity, sound decision-making, and a strong commitment to community engagement and outreach. I am convinced that Dr. Belcher has commitment to community engagement and outreach. I am convinced that Dr. Belcher has the right mix of experience, skills, and passion needed to take Western Carolina to the next the right mix of experience, skills, and passion needed to take Western Carolina to the next level, and I am thrilled that he has agreed to join our leadership team.”level, and I am thrilled that he has agreed to join our leadership team.”

A member of the University of Arkansas System, the University of Arkansas at Little Rock A member of the University of Arkansas System, the University of Arkansas at Little Rock is a doctoral research university enrolling more than 13,000 students at the undergraduate, is a doctoral research university enrolling more than 13,000 students at the undergraduate, master’s, and doctoral levels. Its six colleges and UALR’s William H. Bowen School of Law master’s, and doctoral levels. Its six colleges and UALR’s William H. Bowen School of Law include more than 100 programs of study. Like Western Carolina, UALR has experienced sig-include more than 100 programs of study. Like Western Carolina, UALR has experienced sig-nifi cant enrollment growth while increasing academic standards and has focused on meet-nifi cant enrollment growth while increasing academic standards and has focused on meet-ing regional and state needs in education, health-related fi elds, and strategic areas of re-ing regional and state needs in education, health-related fi elds, and strategic areas of re-search and development. As provost and vice chancellor for academic affairs, Belcher was search and development. As provost and vice chancellor for academic affairs, Belcher was UALR’s chief academic offi cer. In that role, he was responsible for overseeing all academic UALR’s chief academic offi cer. In that role, he was responsible for overseeing all academic programs, as well as providing leadership for the Offi ces of Research and Graduate Studies, programs, as well as providing leadership for the Offi ces of Research and Graduate Studies, Innovation and Commercialization, and Extended Programs; UALR’s Ottenheimer Library; Innovation and Commercialization, and Extended Programs; UALR’s Ottenheimer Library; student recruitment; the UALR Nanotechnology Center; the Sequoyah National Research student recruitment; the UALR Nanotechnology Center; the Sequoyah National Research Center; the Arkansas Studies Institute; and the Donaghey Scholars Program.Center; the Arkansas Studies Institute; and the Donaghey Scholars Program.

A native of Barnwell, S.C., Belcher graduated from Furman University in 1979 with a de-A native of Barnwell, S.C., Belcher graduated from Furman University in 1979 with a de-gree in piano performance. After receiving a master’s degree (1981) in the fi eld at the Uni-gree in piano performance. After receiving a master’s degree (1981) in the fi eld at the Uni-versity of Michigan, he studied in Vienna, Austria, on a Rotary Foundation Graduate Fellow-versity of Michigan, he studied in Vienna, Austria, on a Rotary Foundation Graduate Fellow-ship before earning his doctorate (1989) at the University of Rochester’s Eastman School of ship before earning his doctorate (1989) at the University of Rochester’s Eastman School of Music. While a student at Eastman, he received the Jerald C. Graue Memorial Scholarship Music. While a student at Eastman, he received the Jerald C. Graue Memorial Scholarship for excellence in musicological research.for excellence in musicological research.

DR. DAVID O. BELCHERDR. DAVID O. BELCHERWestern Carolina University ChancellorWestern Carolina University Chancellor

102102






very carefully, and guide the development of new resources through fundraising, increased very carefully, and guide the development of new resources through fundraising, increased ticket sales and additional corporate sponsorships,” he said. “He is extremely well-versed in ticket sales and additional corporate sponsorships,” he said. “He is extremely well-versed in NCAA compliance and issues of gender equity, and has substantial experience in strategic NCAA compliance and issues of gender equity, and has substantial experience in strategic planning. Perhaps best of all, Randy is a great human being with a wonderful personality, planning. Perhaps best of all, Randy is a great human being with a wonderful personality, and I believe he makes a great addition to our Catamount family.”and I believe he makes a great addition to our Catamount family.”

Eaton’s career includes nearly seven years as part of the athletics department adminis-Eaton’s career includes nearly seven years as part of the athletics department adminis-tration at East Tennessee State University, a former member of the Southern Conference, the tration at East Tennessee State University, a former member of the Southern Conference, the intercollegiate conference in which WCU competes.intercollegiate conference in which WCU competes.

“From my days at ETSU, my wife and I have fond memories of trips to Western Carolina for “From my days at ETSU, my wife and I have fond memories of trips to Western Carolina for football and basketball games, and how friendly and warm the Catamount fan base was to football and basketball games, and how friendly and warm the Catamount fan base was to the fans from ETSU. In addition to the affability of the fans, I was impressed that WCU was the fans from ETSU. In addition to the affability of the fans, I was impressed that WCU was always a tough opponent, regardless of the sport,” Eaton said. “What solidifi ed my decision always a tough opponent, regardless of the sport,” Eaton said. “What solidifi ed my decision to join the Catamount program was the family atmosphere I found on the entire campus dur-to join the Catamount program was the family atmosphere I found on the entire campus dur-ing the interview process. This athletics program and the entire university are poised to take ing the interview process. This athletics program and the entire university are poised to take off to, and reach, new heights, and I want to be a part of that journey.”off to, and reach, new heights, and I want to be a part of that journey.”

Eaton said he possesses an overarching desire to “win every game, graduate every Eaton said he possesses an overarching desire to “win every game, graduate every student-athlete, and do it all with class” that helps him maintain a focus on what is most student-athlete, and do it all with class” that helps him maintain a focus on what is most important - the student-athletes. “Additionally, I believe my years of varied experience important - the student-athletes. “Additionally, I believe my years of varied experience within intercollegiate athletics have prepared me for this opportunity and will serve both within intercollegiate athletics have prepared me for this opportunity and will serve both myself and the entire athletics program well,” he said. “I would also like to think my straight-myself and the entire athletics program well,” he said. “I would also like to think my straight-forwardness and outgoing nature will benefi t me in leading this department. I told people forwardness and outgoing nature will benefi t me in leading this department. I told people during my interview ‘what you see is what you get,’ and I meant it.”during my interview ‘what you see is what you get,’ and I meant it.”

Eaton was selected from among approximately 75 potential candidates for the posi-Eaton was selected from among approximately 75 potential candidates for the posi-tion, said Shea Browning, WCU associate general counsel and chair of the athletics director tion, said Shea Browning, WCU associate general counsel and chair of the athletics director search committee. Seven candidates were interviewed by the search committee in Asheville.search committee. Seven candidates were interviewed by the search committee in Asheville.

“The number of well-qualifi ed candidates in the pool is a testament to how Western “The number of well-qualifi ed candidates in the pool is a testament to how Western Carolina University is viewed beyond these mountains,” Browning said. “I am extremely ex-Carolina University is viewed beyond these mountains,” Browning said. “I am extremely ex-cited with the selection and hiring of Randy Eaton. I believe his expertise and experience will cited with the selection and hiring of Randy Eaton. I believe his expertise and experience will carry the department of athletics to new heights. I also applaud the effort and the hard work carry the department of athletics to new heights. I also applaud the effort and the hard work of the search committee. Our task of selecting two fi nalists to recommend to Chancellor of the search committee. Our task of selecting two fi nalists to recommend to Chancellor Belcher, from a very strong applicant pool, was a daunting one, especially given our time Belcher, from a very strong applicant pool, was a daunting one, especially given our time constraints.”constraints.”

Belcher appointed the search committee on Nov. 4 and tasked the group to fi nd a per-Belcher appointed the search committee on Nov. 4 and tasked the group to fi nd a per-manent successor for C. Joseph “Chip” Smith, WCU’s former director of athletics who held manent successor for C. Joseph “Chip” Smith, WCU’s former director of athletics who held the position from September 2004 until Oct. 25 of this year. Fred Cantler, WCU’s longtime the position from September 2004 until Oct. 25 of this year. Fred Cantler, WCU’s longtime senior associate athletic director for internal operations, who retired in March after 33 years senior associate athletic director for internal operations, who retired in March after 33 years of athletics administration, agreed to come out of retirement to serve as interim director of of athletics administration, agreed to come out of retirement to serve as interim director of athletics.athletics.

Belcher assigned the task force an ambitious, fast-track timetable so that a new leader Belcher assigned the task force an ambitious, fast-track timetable so that a new leader for Catamount athletics could be in place perhaps as early as January. The fi rst major re-for Catamount athletics could be in place perhaps as early as January. The fi rst major re-sponsibility of the new athletics director will be hiring a head football coach to replace Den-sponsibility of the new athletics director will be hiring a head football coach to replace Den-nis Wagner, who resigned from the position Nov. 13 after four years in the post.nis Wagner, who resigned from the position Nov. 13 after four years in the post.

Eaton said he is ready to get to work right away on fi nding the Catamounts’ next football Eaton said he is ready to get to work right away on fi nding the Catamounts’ next football coach. “I will focus on someone who will come in and concentrate on building a program, not simply a team,” he said. “There will be several qualities I will look for in our next head not simply a team,” he said. “There will be several qualities I will look for in our next head coach. Among them is a strong commitment to our student-athletes and a proven history of success. I also would like someone with recruiting ties and relationships within this area.”

After serving in the U.S. Air Force, Eaton earned his bachelor’s degree in business ad-After serving in the U.S. Air Force, Eaton earned his bachelor’s degree in business ad-ministration from the University of Texas at San Antonio in 1990 and his master’s degree in ministration from the University of Texas at San Antonio in 1990 and his master’s degree in sports administration from Ohio State in 1992. He and his wife, Jeannette, are parents of one daughter, Alex, who is working in athletics administration at Maryland.

Eaton’s boss at Maryland praised WCU for its decision. “He will do a great job as direc-Eaton’s boss at Maryland praised WCU for its decision. “He will do a great job as direc-tor of athletics,” said Kevin Anderson, director of athletics at Maryland. “In Randy, you get someone with both expertise in college athletics and a person who really cares about the student-athletes.”

Deborah A. Yow, director of athletics at North Carolina State University, called Eaton Deborah A. Yow, director of athletics at North Carolina State University, called Eaton “...a high-energy and results-oriented professional, held in high esteem by his peers,” while “...a high-energy and results-oriented professional, held in high esteem by his peers,” while James Franklin, head football coach at Vanderbilt University, characterized Eaton as “...a fi rst-class guy with tremendous experience.”

“He is one of those I’ve worked with in college athletics that gets it,” Franklin said. “He “He is one of those I’ve worked with in college athletics that gets it,” Franklin said. “He understands college athletics, revenue and nonrevenue sports and how to make them coex-understands college athletics, revenue and nonrevenue sports and how to make them coex-ist. He is a guy that will represent the athletics department and the university very well.”ist. He is a guy that will represent the athletics department and the university very well.”

Randy Eaton, former senior associate director of Randy Eaton, former senior associate director of athletics at the University of Maryland, was named athletics at the University of Maryland, was named the director of athletics at Western Carolina Univer-the director of athletics at Western Carolina Univer-sity by Chancellor David O. Belcher on Wednesday, sity by Chancellor David O. Belcher on Wednesday, Dec. 14. Eaton, brings more than 20 years of athlet-Dec. 14. Eaton, brings more than 20 years of athlet-ics administration experience to the post.ics administration experience to the post.

Eaton’s appointment followed a national search Eaton’s appointment followed a national search conducted by a 14-member committee working conducted by a 14-member committee working with the assistance of Todd Turner of Collegiate with the assistance of Todd Turner of Collegiate Sports Associates, a North Carolina-based execu-Sports Associates, a North Carolina-based execu-tive search consulting fi rm.tive search consulting fi rm.

Eaton had been senior associate director of ath-Eaton had been senior associate director of ath-letics at the University of Maryland and the athlet-letics at the University of Maryland and the athlet-ics department’s chief fi nancial offi cer since June ics department’s chief fi nancial offi cer since June 2008. He joined the Terrapins’ athletics program in 2008. He joined the Terrapins’ athletics program in 2003 as associate director in charge of business 2003 as associate director in charge of business operations. At Maryland, he was the No. 2 admin-operations. At Maryland, he was the No. 2 admin-

istrator in the athletics department and oversaw a $60 million annual operating budget. He served as interim director in 2010, and recently assumed additional responsibility for new served as interim director in 2010, and recently assumed additional responsibility for new revenues, facilities and operations.revenues, facilities and operations.

He also has held positions at the University of Houston, Texas A&M University, East Ten-He also has held positions at the University of Houston, Texas A&M University, East Ten-nessee State University, Ohio State University and the University of Texas at San Antonio, nessee State University, Ohio State University and the University of Texas at San Antonio, and with the Ohio Glory of World League Football.and with the Ohio Glory of World League Football.

Belcher introduced Eaton to the news media, Catamount athletics fans and members Belcher introduced Eaton to the news media, Catamount athletics fans and members of the campus community in a press conference in the in the Peele, Westmoreland Suhre, of the campus community in a press conference in the in the Peele, Westmoreland Suhre, Hartshorn Hospitality Room of the Liston B. Ramsey Regional Activity Center.Hartshorn Hospitality Room of the Liston B. Ramsey Regional Activity Center.

“When I talked with the members of search committee last month, I asked them to fi nd “When I talked with the members of search committee last month, I asked them to fi nd someone who is a true leader - someone who has the capacity to hire, retain and mentor someone who is a true leader - someone who has the capacity to hire, retain and mentor excellent coaches, assistant coaches and other athletics staff. I charged them with identify-excellent coaches, assistant coaches and other athletics staff. I charged them with identify-ing a director of athletics candidate who shares Western Carolina University’s core values of ing a director of athletics candidate who shares Western Carolina University’s core values of excellence, student success and external focus. I am extremely pleased that the committee excellence, student success and external focus. I am extremely pleased that the committee has found just that person in Randy Eaton,” Belcher said.has found just that person in Randy Eaton,” Belcher said.

“What impresses me most about Randy is his unwavering commitment to the student-“What impresses me most about Randy is his unwavering commitment to the student-athlete and the fact that he understands that the word `student’ is the most important part athlete and the fact that he understands that the word `student’ is the most important part of that hyphenated term,” he said. “He is totally committed to the concept that these young of that hyphenated term,” he said. “He is totally committed to the concept that these young people who come to our university are students fi rst, and athletes second. That’s not to say people who come to our university are students fi rst, and athletes second. That’s not to say that Randy does not want success on the fi elds and courts of play, because he shares the that Randy does not want success on the fi elds and courts of play, because he shares the same expectations of excellence that I have for all of our sports teams. He has a passion for same expectations of excellence that I have for all of our sports teams. He has a passion for winning, and for winning the right way. But he also understands the role that athletics plays winning, and for winning the right way. But he also understands the role that athletics plays in the university and that it is not a stand-alone entity apart from the academy.”in the university and that it is not a stand-alone entity apart from the academy.”

Eaton also has strong skills in fi scal management and developing athletics program Eaton also has strong skills in fi scal management and developing athletics program budgets, which will serve WCU well during times of fi nancial constraints, Belcher said. “His budgets, which will serve WCU well during times of fi nancial constraints, Belcher said. “His strengths will allow him to construct a strategically designed budget, manage our resources strengths will allow him to construct a strategically designed budget, manage our resources

MR. RANDY EATONMR. RANDY EATONWestern Carolina University Director of AthleticsWestern Carolina University Director of Athletics

104104






Todd Lawing joined Catamount Athletics in mid-July, 2011 as the Associate Athletic Director for Internal Operations, bringing a wealth of collegiate experience to Cullowhee. Before coming to Cullowhee, he most recently served as the Senior Executive Associate Director of Intercollegiate Athletics and Director of NCAA Compliance at Division-II member institution, Lenoir-Rhyne, in Hickory, N.C.

Lawing’s duties include overseeing all internal operations of the Catamount Athletic Department including the athletic training and weight rooms, compliance, as well as game day operations for football, women’s soccer and baseball.

A native of Denver, N.C., Lawing spent seven years at his alma mater, Lenior-Rhyne, working his way up to Senior Executive Associate Athletic Director in the summer of 2010 after serving as Associate Athletic Director the three years prior at L-R. He got his start with the Bears’ athletics department from 2000-2002 while earning his master’s degree, working as the department’s fi rst-ever athletic marketing intern after lettering for four years on the baseball diamond.

Lawing also worked as an Assistant Athletic Director and Director of Special Events from 2004-06.

During his tenure at Lenoir-Rhyne, the university hosted one NCAA Division II Women’s Basketball (2009) and three Softball Southeast Regional Tournaments (2009, 2010 and 2011) where Lawing served as tournament director for all three events. He also served as an Associate Trustee for the Piedmont Educational Foundation/Bears Club.

Prior to Lenoir-Rhyne, Lawing worked with his family at Ken Lawing Builders, Inc., in Denver, N.C.

Lawing received his bachelor’s degree in sports management with a minor in business administration in the spring of 2000 and earned his master’s degree in business administration in 2002, both from Lenoir-Rhyne.

Lawing is married to the former Andi Penley, who is also a graduate of Lenoir-Rhyne (2002) and is originally from nearby Enka, N.C. The couple has one daughter, Kenna and one son, Grady.

Jamaal Mayo is amidst his sixth year as a member of the WCU Department of Athletics, serving most recently as the Assistant Athletics Director for Academic Services.

As of July 1, 2012, Mayo began a new role as Assistant Athletic Director for Facilities and Operations. In this new role, Mayo has been charged with galvanizing WCU’s Facilities and Operations unit. This is an effort to ensure that positive experiences of WCU’s student athletes, coaches and fans are equal from venue to

venue, game to game and practice to practice. This deals with pre-game preparation, fi eld/arena maintenance and overseeing the day-to-day operations for all of Western Carolina’s venues and facilities.

In addition to his role with Facilities and Operations, Mayo is the sport supervisor for volleyball, softball and women’s tennis, while also serving as the game day administrator for the men’s and women’s basketball and track & fi eld.

As the Assistant Athletic Director for Academic Services, Mayo oversaw the day-to-day operations of the Student-Athlete Academic Support Program. Prior to being promoted to Academic Services, Mayo served as the Coordinator of Student-Athlete Academic Support while also overseeing the NCAA Student-Athlete Affairs, formerly CHAMPS/Life Skills.

The Hillsborough, N.C.-native also coordinates the NCAA Student-Athlete Affairs Program – formerly known as CHAMPS Life Skills – for the athletic department.

A 2003 graduate of Western Carolina University, Mayo earned his bachelor’s degree in Sport Management while also playing football for the Catamounts. Mayo returned to his alma mater in August of 2007 after a brief stint with the Durham Bulls as the team’s group ticket sales associate.

Mayo is also pursuing his master’s degree in College Student Personnel from WCU.

TODD LAWING

JAMAAL MAYO

associate ad / internal operations

assistant ad / facilities & operations

Dr. Angela Johnson (A.J.) Grube was named Western Carolina’s Faculty/Athletics Representative during the 2012 spring semester. It is the second such appointment for Grube during her tenure at WCU.

Grube is an associate professor and department head in the Department of Business Administration & Law and Sport Management. She earned her Ph.D. from The Florida State University in 1998, an M.P.A. from Georgia College and State

University in 1994, an M.S. degree in Sport Management from Georgia Southern in 1991, and a B.B.A. in marketing and management from Georgia College and State University in 1990.

Grube has a long and diverse history in athletics including teaching as an assistant professor of sport management at Daniel Webster College from 1998-99 before coming to Cullowhee. While completing her Ph.D. in sport management at FSU, she was a graduate assistant for the CHAMPS/Life Skills program – what is now called Student-Athlete Affairs. Also during her time in Tallahassee, she spent the summer of 1996 as training site offi ce manager with the British Olympic Association. Grube was additionally the Coordinator of the International Sport Management Conference at Georgia Tech (1993-93).

Grube worked for six years in the prestigious summer wooden bat Cape Cod Baseball League including three years as an Assistant General Manager for the Chatham A’s and three years as General Manager of the Wareham Gatemen.

Since arriving at Western Carolina in 1999, Grube has served as Assistant to the Chancellor for Equal Opportunity Programs and as the Assistant Vice Chancellor for Academic Affairs. In addition, Grube is currently a member of the NCAA’s Committee on Athletic Certifi cation.

Grube is married to Dr. Dan Grube, an associate professor of physical education and is the Director of the School of Teaching and Learning.

DR. ANGELA GRUBEfaculty/athletics representative

Dr. Jennifer Brown was appointed to the position as Western Carolina’s fi fth Senior Woman Administrator (SWA) on July 1, 2005. She was additionally promoted to the level of Associate Athletic Director in 2010.

A native of Eden, N.C., Brown is in her eighth year at WCU, coming to Cullowhee in August of 2001 as the Director of Academic Support Services for Student-Athletes. In that capacity, Brown was responsible for overseeing all of the of

the academic support programs for Catamount athletics which includes the Academic Enhancement Program (AEP).

As the Senior Woman Administrator, Brown has continued her supervision of AEP, with the addition of sport administration for women’s volleyball, women’s basketball, women’s tennis, men’s and women’s golf, men’s and women’s cross country, men’s and women’s track & fi eld and softball. She also coordinates the CHAMPS / Life Skills programs and serves as the athletic department advisor to WCU’s Student-Athlete Advisory Council (SAAC).

Brown earned her Bachelor of Arts degree in psychology from North Carolina State University in 1992 and received her Masters of Arts in counselor education in ‘96 from North Carolina Central University. She was awarded her Doctoral degree in counselor education in the spring of 2004 from N.C. State, and began instructing a counseling course in the fall of 2005 in WCU’s college student personnel graduate degree program.

Prior to coming to Western Carolina, Brown worked with Academic Support Programs for Student-Athletes at both North Carolina and North Carolina State. She has also served as the program coordinator for the Youth Out of the Edcuation Mainstream Project at the Center for the Prevention of School Violence. Additionally, Brown worked with the North Carolina Association of Educators as the parent coordinator of the North Carolina Foundation for Public School Children.

During her tenure in Cullowhee, Brown has garnered numerous accolades. She was named the Most Outstanding Academic Advisor during the 2002-03 academic calendar year, as well as the Last Minute Productions Staff Supporter of the Year during that same time frame. In 2003-04, Brown was awarded the John Fry Advising Award which honors excellence in working and dealing with students.

Brown gave birth to a son – Jayden Ronald Brown – on June 16, 2012.

DR. JENNIFER BROWNassoc. ad / senior woman administrator



ADDITIONAL CATAMOUNT ATHLETIC DEPARTMENT STAFF MEMBERS

Denise GideonDirector of

Media Relations

Larry HunterHead Coach

Men’s Basketball

Jonelle StreedAssistant Coach

Women’s Basketball

Danielle GlossonAssistant Coach

Softball

Jim CliftHead Coach

Softball

Bryan PowellAssistant Directorof Media Relations

Brian AngelottiAssistant

Athletic Trainer

Eric WilsonAssistant Coach

Men’s Basketball

Brigham WagingerVolunteer Assistant Coach

Men’s Basketball

Kim Cherry-BeckHead Coach

Cheerleading

Karen GloverHead Coach

Volleyball

Nicole McCoyAssistant Coach

Volleyball

Stefanie ConleyDirector of Corporate

Sponsorships & Special Events

Anquell McCollumAssistant Coach

Men’s Basketball

Hillary BeckAssistant Coach


Chris WollettHead Coach

Women’s Tennis

Andrew BrowderAssociate

Athletic Trainer

Mark SpeirHead Coach

Football

Brad GlennAssistant Coach

Football

Eddie WellsAssistant Coach

Cheerleading

Larry ArbaughAssociate AD for Business

Development & Media Relations

Lindsey LessingDirector of Marketing

& Promotions

Melanie DalpiasAssistant

Athletic Trainer

Danny WilliamsonHead Coach

Cross Country / Track & Field

Matt Harlfi ngerAssistant Coach

Cross Country / Track & Field

Mark ConlinHead Grounds /

Facility Technician

Gorham BradleyAssociate AD for Development / Director of the Catamount Club

Corinne HahnAthletics Ticket

Offi ce Coordinator

Julie MillerAssistant Director ofthe Catamount Club

Chris EverettCatamount Club

Assistant

David PryorAssociate

Athletic Trainer

Carrie WilliamsAthletic Trainer

Assistant

Jessica WebsterAthletic Trainer

Assistant

John HoltAssistant Coach

Football

Mark RheaAssistant Coach

Football

Carter ChevesHead CoachMen’s Golf

Mike TaylorHead Athletic

Equipment Manager

Will AdamsMedia Relations

Video Coordinator

Cheryl PlemmonsAthletic Executive

Assistant

Trey ElderAssistant Coach

Football

Mallory HetzelHead Coach

Women’s Golf

Kellen BewseyAssistant Athletic

Equipment Manager

Stacey MillerAssistant Athletic Director

for Compliance

Kim JamisonAthletic Department

Administrative Assistant

Jeff PitmanDirector of Athletic

Performance

Karen MiddletonHead Coach


Steve SisaAssistant Coach

Football

Chad MillerHead Coach

Women’s Soccer

Rick FultonAthletics

Business Offi cer

Nick WhiteAssistant Director

of Athletic Performance

Dan O’ConnellAthletic Performance

Assistant

Tre’ka McMillanAssistant Coach


Todd HermanAssistant CoachWomen’s Soccer

Shawn QuinnAssistant Coach

Football



YEAR-BY-YEAR RECORDS ATYEAR-BY-YEAR RECORDS ATCHILDRESS FIELD / HENNON STADIUMCHILDRESS FIELD / HENNON STADIUM

108108

YearYear OverallOverall SoConSoCon19781978 ......................... ......................... 12-212-2 ...................... ...................... 5-25-219791979 ........................... ........................... 7-57-5 ...................... ...................... 3-33-319801980 ......................... ......................... 14-714-7 ...................... ...................... 6-36-319811981 ......................... ......................... 10-410-4 ...................... ...................... 5-35-319821982 ......................... ......................... 21-321-3 ...................... ...................... 8-08-019831983 ......................... ......................... 18-718-7 ...................... ...................... 4-24-219841984 ....................... ....................... 15-1015-10 ...................... ...................... 6-26-219851985 ......................... ......................... 16-916-9 ...................... ...................... 6-26-219861986 ......................... ......................... 18-918-9 ...................... ...................... 7-27-219871987 ......................... ......................... 16-416-4 ...................... ...................... 7-27-219881988 ......................... ......................... 19-519-5 ...................... ...................... 5-15-119891989 ......................... ......................... 13-913-9 ...................... ...................... 6-36-319901990 ......................... ......................... 23-523-5 ...................... ...................... 7-27-219911991 ....................... ....................... 17-1017-10 ...................... ...................... 6-36-319921992 ......................... ......................... 22-522-5 .................... .................... 11-111-119931993 ......................... ......................... 16-616-6 ...................... ...................... 8-18-119941994 ......................... ......................... 24-524-5 ...................... ...................... 8-38-319951995 ....................... ....................... 17-1017-10 ...................... ...................... 8-48-419961996 ....................... ....................... 16-1016-10 ...................... ...................... 7-57-519971997 ......................... ......................... 22-422-4 .................... .................... 11-211-219981998 ......................... ......................... 19-319-3 ...................... ...................... 9-29-219991999 ......................... ......................... 19-719-7 ...................... ...................... 7-57-520002000 ....................... ....................... 11-1411-14 ...................... ...................... 7-97-920012001 ......................... ......................... 18-618-6 .................... .................... 11-411-420022002 ......................... ......................... 20-620-6 .................... .................... 10-510-520032003 ......................... ......................... 25-325-3 .................... .................... 13-213-220042004 ......................... ......................... 18-918-9 ...................... ...................... 8-78-720052005 ......................... ......................... 19-919-9 .................... .................... 11-411-420062006 ......................... ......................... 21-821-8 ...................... ...................... 9-69-620072007 ......................... ......................... 20-720-7 .................... .................... 10-210-220082008 ......................... ......................... 16-916-9 ...................... ...................... 9-69-620092009 ....................... ....................... 18-1118-11 ...................... ...................... 8-78-720102010 ......................... ......................... 21-721-7 .................... .................... 11-411-420112011 .................... .................... 14-14-114-14-1 ...................... ...................... 8-78-720122012 ......................... ......................... 19-719-7 .................... .................... 10-510-5TotalsTotals ............... ...............614-249-1614-249-1 .............. .............. 275-121275-121 (.711) (.694) (.711) (.694)



The 2013 season marks the 36th that the Western Carolina University baseball program has called Ronnie G. Childress Field its home. Prior to fi rst pitch in 2011, The 2013 season marks the 36th that the Western Carolina University baseball program has called Ronnie G. Childress Field its home. Prior to fi rst pitch in 2011, the facility received one of its most dramatic face lifts. Offi cially renamed Childress Field at Hennon Stadium in a dedication ceremony on April 23, 1994, off-season the facility received one of its most dramatic face lifts. Offi cially renamed Childress Field at Hennon Stadium in a dedication ceremony on April 23, 1994, off-season improvements in ‘11 included such as the addition of a new brick back stop, lower level fi eld seating, brick facade down both foul lines including bullpen benches, improvements in ‘11 included such as the addition of a new brick back stop, lower level fi eld seating, brick facade down both foul lines including bullpen benches, center fi eld batter’s eye and the construction of a courtyard plaza have helped heighten the game-day and playing experience at Childress Field / Hennon Stadium.center fi eld batter’s eye and the construction of a courtyard plaza have helped heighten the game-day and playing experience at Childress Field / Hennon Stadium.

The Catamounts moved approximately 200 yards to the east from Haywood Field early in the 1978 season and have won over 71 percent of their home games since The Catamounts moved approximately 200 yards to the east from Haywood Field early in the 1978 season and have won over 71 percent of their home games since then, with a 614-249-1 record in 35 seasons. Bill Haywood-, head baseball coach from 1969 through 1981, and Mr. E.J. Whitmire, longtime supporter and benefactor then, with a 614-249-1 record in 35 seasons. Bill Haywood-, head baseball coach from 1969 through 1981, and Mr. E.J. Whitmire, longtime supporter and benefactor from Franklin, were the driving forces behind the building of the facility.from Franklin, were the driving forces behind the building of the facility.

Childress Field, built at an initial cost of $125,000, was dedicated April 26, 1978 (pictured below), and named in honor of the late Ronnie G. Childress, an avid sup-Childress Field, built at an initial cost of $125,000, was dedicated April 26, 1978 (pictured below), and named in honor of the late Ronnie G. Childress, an avid sup-porter of WCU athletics and a special friend of the baseball program. Childress, through his family’s radio station (WRGC) in Sylva, N.C., pioneered broadcasts of WCU’s porter of WCU athletics and a special friend of the baseball program. Childress, through his family’s radio station (WRGC) in Sylva, N.C., pioneered broadcasts of WCU’s baseball games. He died in May 1975 as the result of an electrical accident at the radio station. The James B. Childress family established the Ronnie Childress Memo-baseball games. He died in May 1975 as the result of an electrical accident at the radio station. The James B. Childress family established the Ronnie Childress Memo-rial Fund Scholarships in 1975 and scholarships have been awarded annually to one or more WCU baseball player for the past 33 years.rial Fund Scholarships in 1975 and scholarships have been awarded annually to one or more WCU baseball player for the past 33 years.

The facility received a $500,000-plus face lift over an eight-year time period, thanks in large part to the generosity of Mr. Lamar Hennon of Dalton, Ga., and has become The facility received a $500,000-plus face lift over an eight-year time period, thanks in large part to the generosity of Mr. Lamar Hennon of Dalton, Ga., and has become a showplace of Southern Conference baseball. Permanent bleacher seating, grandstand chair-back seats, and the facility’s fi rst-ever press box were installed prior to a showplace of Southern Conference baseball. Permanent bleacher seating, grandstand chair-back seats, and the facility’s fi rst-ever press box were installed prior to and during the 1990 season. A modern scoreboard, concession stands, rest rooms, and a new infi eld were added prior to the 1991 season.and during the 1990 season. A modern scoreboard, concession stands, rest rooms, and a new infi eld were added prior to the 1991 season.

The growth of the facility continued as part of Western’s new building projects. Lights and a new sound The growth of the facility continued as part of Western’s new building projects. Lights and a new sound system were added to the ballpark in the Fall of 2002. Western played its fi rst ever night game on March system were added to the ballpark in the Fall of 2002. Western played its fi rst ever night game on March 25, upsetting 10th-ranked Clemson, who is led by former WCU head coach Jack Leggett. In the summer 25, upsetting 10th-ranked Clemson, who is led by former WCU head coach Jack Leggett. In the summer of 2003, Childress Field was completely refurbished with nearly $500,000 worth of improvements, in-of 2003, Childress Field was completely refurbished with nearly $500,000 worth of improvements, in-cluding new drainage and irrigation, a new Bermuda playing surface, new infi eld dirt and a new warning cluding new drainage and irrigation, a new Bermuda playing surface, new infi eld dirt and a new warning track. The warning track was extended to encompass the entire playing surface prior to the 2009 season.track. The warning track was extended to encompass the entire playing surface prior to the 2009 season.

A new clubhouse on the fi rst-base side is planned for upcoming seasons.A new clubhouse on the fi rst-base side is planned for upcoming seasons.

The fi eld’s dimensions are 325 feet down each line, 375 feet to the right and left center power alleys and The fi eld’s dimensions are 325 feet down each line, 375 feet to the right and left center power alleys and 390 feet to straight away center fi eld. The “Purple Monster” in left fi eld is 100 feet long and is divided 390 feet to straight away center fi eld. The “Purple Monster” in left fi eld is 100 feet long and is divided into two 50-foot levels. The fi rst and tallest level is 20 feet high and the second level is 14 feet tall. A into two 50-foot levels. The fi rst and tallest level is 20 feet high and the second level is 14 feet tall. A matching length “batter’s eye” in straight-away center fi eld was added during the off-season.matching length “batter’s eye” in straight-away center fi eld was added during the off-season.

WCU hosted the 1984 and 1986 Southern Conference Tournaments at Childress Field and has welcomed WCU hosted the 1984 and 1986 Southern Conference Tournaments at Childress Field and has welcomed out-of-conference teams representing such schools as Clemson, Georgia, Tennessee, Ohio State, San out-of-conference teams representing such schools as Clemson, Georgia, Tennessee, Ohio State, San Diego State, South Carolina and North Carolina State to the facility in addition to the SoCon slate.Diego State, South Carolina and North Carolina State to the facility in addition to the SoCon slate.





The The Southern ConferenceSouthern Conference, which entered its 92nd , which entered its 92nd season of intercollegiate competition in 2012, has become season of intercollegiate competition in 2012, has become known as one of the nation’s leaders in emphasizing the known as one of the nation’s leaders in emphasizing the development of the student-athlete and defi ning the league’s development of the student-athlete and defi ning the league’s role in helping to build lifelong leaders and role models.role in helping to build lifelong leaders and role models.

The Southern Conference is the nation’s fi fth-oldest NCAA The Southern Conference is the nation’s fi fth-oldest NCAA Division I collegiate athletic association. Only the Big Ten Division I collegiate athletic association. Only the Big Ten (1896), the Missouri Valley (1907), the Pacifi c 10 (1915) and (1896), the Missouri Valley (1907), the Pacifi c 10 (1915) and the Southwestern Athletic (1920) conferences are older in the Southwestern Athletic (1920) conferences are older in terms of origination.terms of origination.

The Southern Conference has excelled as the premier The Southern Conference has excelled as the premier Football Championship Subdivision conference since earning Football Championship Subdivision conference since earning that classifi cation in 1981. SoCon member Appalachian State that classifi cation in 1981. SoCon member Appalachian State won three-straight Football Championship Subdivision titles. won three-straight Football Championship Subdivision titles. The Conference currently consists of 12 members in four states The Conference currently consists of 12 members in four states throughout the Southeast and sponsors 19 varsity sports and championships that produce participants for NCAA Division I Championships.throughout the Southeast and sponsors 19 varsity sports and championships that produce participants for NCAA Division I Championships.

Throughout its history, the Southern Conference has been an innovator in college athletics. The Southern Conference was the fi rst “super Throughout its history, the Southern Conference has been an innovator in college athletics. The Southern Conference was the fi rst “super conference” with its charter membership including the likes of Alabama, Auburn, and North Carolina. The SoCon, as it has come to be known conference” with its charter membership including the likes of Alabama, Auburn, and North Carolina. The SoCon, as it has come to be known by headline writers throughout the country, is the league that gave birth to the three-point shot in college basketball at Western Carolina by headline writers throughout the country, is the league that gave birth to the three-point shot in college basketball at Western Carolina University, and was the college home of such sporting greats as Arnold Palmer, Jerry West and Charlie “Choo Choo” Justice.University, and was the college home of such sporting greats as Arnold Palmer, Jerry West and Charlie “Choo Choo” Justice.

Academic excellence has been a major part of the Southern Conference’s tradition. League athletes have been recognized countless times on Academic excellence has been a major part of the Southern Conference’s tradition. League athletes have been recognized countless times on Verizon/CoSIDA Academic All-America and district teams. A total of 19 Rhodes-Scholarship winners have been selected from the conference.Verizon/CoSIDA Academic All-America and district teams. A total of 19 Rhodes-Scholarship winners have been selected from the conference.

M E M B E R S H I P H I S T O R YM E M B E R S H I P H I S T O R Y

The Southern Conference was formed on February 25, 1921 at a meeting in Atlanta, Ga. Fourteen institutions from the 30-member Southern The Southern Conference was formed on February 25, 1921 at a meeting in Atlanta, Ga. Fourteen institutions from the 30-member Southern Intercollegiate Athletic Association (SIAA) reorganized as the Southern Conference. Those charter members included Alabama, Auburn, Intercollegiate Athletic Association (SIAA) reorganized as the Southern Conference. Those charter members included Alabama, Auburn, Clemson, Georgia, Georgia Tech, Kentucky, Maryland, Mississippi State, North Carolina, North Carolina State, Tennessee, Virginia, Virginia Clemson, Georgia, Georgia Tech, Kentucky, Maryland, Mississippi State, North Carolina, North Carolina State, Tennessee, Virginia, Virginia Tech and Washington & Lee. Athletic competition began in the fall of 1921.Tech and Washington & Lee. Athletic competition began in the fall of 1921.

In 1922, six more schools - Florida, Louisiana State, Mississippi, South Carolina, Tulane and Vanderbilt - joined the fold. A year later, the In 1922, six more schools - Florida, Louisiana State, Mississippi, South Carolina, Tulane and Vanderbilt - joined the fold. A year later, the University of the South joined the ranks. Virginia Military Institute became a member in 1925 and Duke University came into the fold in 1929. University of the South joined the ranks. Virginia Military Institute became a member in 1925 and Duke University came into the fold in 1929. Since then, conference membership has experienced a series of membership changes with 42 institutions having been affi liated with the league. Since then, conference membership has experienced a series of membership changes with 42 institutions having been affi liated with the league. The league has undergone two major transitions during its history.The league has undergone two major transitions during its history.

The fi rst occurred in December 1932 when the Southeastern Conference was formed out of the 23-school Southern Conference. The The fi rst occurred in December 1932 when the Southeastern Conference was formed out of the 23-school Southern Conference. The league’s 13 members west and south of the Appalachian Mountains reorganized to help reduce the extensive travel demands that were league’s 13 members west and south of the Appalachian Mountains reorganized to help reduce the extensive travel demands that were present in the league at the time. In 1936, the Southern Conference invited The Citadel, William & Mary, Davidson, Furman, Richmond and present in the league at the time. In 1936, the Southern Conference invited The Citadel, William & Mary, Davidson, Furman, Richmond and Wake Forest to join the membership.Wake Forest to join the membership.

The second major shift happened in 1953 when Clemson, Duke, Maryland, North Carolina, North Carolina State, South Carolina and Wake The second major shift happened in 1953 when Clemson, Duke, Maryland, North Carolina, North Carolina State, South Carolina and Wake Forest offi cially withdrew from the league to form the Atlantic Coast Conference. This change was brought about due to the desire of many of Forest offi cially withdrew from the league to form the Atlantic Coast Conference. This change was brought about due to the desire of many of those schools to schedule a greater number of regular season basketball games against their local rivals.those schools to schedule a greater number of regular season basketball games against their local rivals.

Today, the league continues to thrive with a 12-school membership that spans four Southeastern states. Current league members are Today, the league continues to thrive with a 12-school membership that spans four Southeastern states. Current league members are Appalachian State, College of Charleston, The Citadel, Davidson, Elon, Furman, Georgia Southern, UNC Greensboro, Chattanooga, Western Appalachian State, College of Charleston, The Citadel, Davidson, Elon, Furman, Georgia Southern, UNC Greensboro, Chattanooga, Western Carolina and Wofford, with Samford offi cially joining the league on July 1, 2008. Carolina and Wofford, with Samford offi cially joining the league on July 1, 2008.

C H A M P I O N S H I P S H I S T O R YC H A M P I O N S H I P S H I S T O R Y

The fi rst Southern Conference Championship was the league basketball tournament held in Atlanta in 1922. The North Carolina Tar Heels The fi rst Southern Conference Championship was the league basketball tournament held in Atlanta in 1922. The North Carolina Tar Heels won the tournament to become the fi rst recognized league champion in any sport. The Southern Conference Tournament remains the oldest won the tournament to become the fi rst recognized league champion in any sport. The Southern Conference Tournament remains the oldest of its kind in college basketball.of its kind in college basketball.

The Southern Conference began sponsoring women’s sports during the 1983-84 season. That year, volleyball, basketball and tennis The Southern Conference began sponsoring women’s sports during the 1983-84 season. That year, volleyball, basketball and tennis championships were held in the league. Cross country joined the mix in 1985 and the league began holding indoor and outdoor track championships were held in the league. Cross country joined the mix in 1985 and the league began holding indoor and outdoor track championships in 1988. Most recently, the conference instituted golf and softball championships in the spring of 1994 and added soccer championships in 1988. Most recently, the conference instituted golf and softball championships in the spring of 1994 and added soccer in the fall of 1994.in the fall of 1994.

The Southern Conference currently declares champions in 10 men’s sports - football, soccer, cross country, basketball, indoor track and The Southern Conference currently declares champions in 10 men’s sports - football, soccer, cross country, basketball, indoor track and fi eld, outdoor track and fi eld, wrestling, baseball, tennis and golf - and nine women’s sports - soccer, volleyball, cross country, basketball, fi eld, outdoor track and fi eld, wrestling, baseball, tennis and golf - and nine women’s sports - soccer, volleyball, cross country, basketball, indoor track and fi eld, outdoor track and fi eld, tennis, golf and softball.indoor track and fi eld, outdoor track and fi eld, tennis, golf and softball.

Women’s sports are relatively young in the league’s history. In 1992-93, the Southern Conference celebrated its 10th Anniversary of women’s Women’s sports are relatively young in the league’s history. In 1992-93, the Southern Conference celebrated its 10th Anniversary of women’s athletics. Furman golfer Dottie Pepper was named the SoCon Women’s Athlete-of-the-Decade in conjunction with that event. Appalachian athletics. Furman golfer Dottie Pepper was named the SoCon Women’s Athlete-of-the-Decade in conjunction with that event. Appalachian State’s Mary Jayne Harrelson won the NCAA Outdoor title at 1500 meters in 1999 and 2001. Furman’s Brandi Jackson won the NCAA Women’s State’s Mary Jayne Harrelson won the NCAA Outdoor title at 1500 meters in 1999 and 2001. Furman’s Brandi Jackson won the NCAA Women’s Golf East Regional in the spring of 2003.Golf East Regional in the spring of 2003.



Date post:	08-Mar-2016
Category:	Documents
Upload:	western-carolina-university-athletics
View:	242 times
Download:	8 times

2013 WCU Baseball Yearbook

Documents