Supporting Information

The following Supporting Information is available in this document:

Methods S1. Extended molecular and bioinformatics methods.

Table S1. Summary of plant indicator species present in the study site.

Table S2. Summary of climate variables recorded between November 2007 and August 2008.

Table S3. Summary of amplicon sequence analysis.

Figure S1. Neighbour-joining phylogeny of MOTUs.

Figure S2. Rarefied species accumulation curves.

Figure S3. Species accumulation curves based on 11 temporal samples.

Methods S1 - Extended molecular and bioinformatics methods

Molecular methods

We extracted DNA from 50 mg of mixed, homogenised, plant roots from each of the 66 soil cores

using MoBio PowerPlant DNA isolation kits following the manufacturer‟s instructions (Mo Bio

Laboratories, Inc. Carlsbad, USA). In order to quantify the AM fungal community from the mixed plant

roots, we used 454 GS FLX pyrosequencing of amplicons of the small subunit (SSU) region of ribosomal

DNA (rDNA), which has previously been shown to produce estimates of community composition and

relative abundance from AM fungal assemblages consistent with those obtained from cloning and Sanger

sequencing (Öpik et al., 2009).

We used a semi-nested PCR protocol to produce amplicon libraries for 454 sequencing. A 550-bp

partial fragment of SSU rDNA was first amplified by PCR using Taq DNA polymerase (Invitrogen Co.

Carlsbad, USA) and the universal eukaryotic primer NS31 (Simon et al., 1992) and the primer AM1, which

excludes plants and amplifies the major Glomeromycotan families (Helgason et al., 1998). PCR was carried

out in a 25 μL reaction volume with 1 μL of DNA template, 2 mM dNTPs, 10 pmol of each primer (PCR

conditions: 95 °C for 2 min; 30 cycles at 94 °C for 0.5 min, 58 °C for 0.5 min and 72 °C for 1 min; and 72

°C for 10 min) on a Gradient96 Robocycler (Stratagene, La Jolla, CA, USA). Three samples failed to yield

any PCR product and were excluded from further analysis. PCR products were purified using QIAquick

PCR Purification Kit (Qiagen Ltd. Crawley, UK.). A secondary semi-nested PCR was then used to add the

fusion primers required for 454 sequencing, which contained the GS FLX LR70 specific sequencing

adaptors A and B, a multiplex identifier (MID), and a new forward primer „WANDA‟. The „WANDA‟

primer is a universal Eukaryotic primer, verified by BLAST matching and is located 23 bp downstream from

the start of NS31. „WANDA‟ is internal to NS31 and shortens the length of the PCR product, bringing the

informative region closer to the start of each amplicon sequence. The fusion primers used for the secondary

PCR were:

Forward

5′ GCCTCCCTCGCGCCATCAG (10-bp MID) CAGCCGCGGTAATTCCAGCT 3′

Reverse

5′ GCCTTGCCAGCCCGCTCAG GTTTCCCGTAAGGCGCCGAA 3′

The forward primer comprises the A adaptor (highlighted in bold) for the pyrosequencing reaction and the

10-bp MID is 1 of 12 published by Roche (http://www.454.com/). The sequences for the 12, 10-bp MIDs,

are as follows:

1. 5′ ACGAGTGCGT 3′

2. 5′ ACGCTCGACA 3′

3. 5′ AGACGCACTC 3′

4. 5′ AGCACTGTAG 3′

5. 5′ ATCAGACACG 3′

6. 5′ ATATCGCGAG 3′

7. 5′ CGTGTCTCTA 3′

8. 5′ CTCGCGTGTC 3′

9. 5′ TAGTATCAGC 3′

10. 5′ TCTCTATGCG 3′

11. 5′ TGATACGTCT 3′

12. 5′ TACTGAGCTA 3′

The final part of the forward primer „WANDA‟, is a universal Eukaryotic primer located 23 bp downstream

from the start of NS31. The reverse primer comprises the B adaptor (in bold), and the reverse primer AM1

(Helgason et al., 1998). The secondary PCR was performed using Taq DNA polymerase (Invitrogen Co.

Carlsbad, USA) and carried out in a 25-μL reaction volume with 1 μL of PCR template, 2 mM dNTPs, 10

pmol of each primer (PCR conditions: 95 °C for 5 min; 10 cycles at 94 °C for 0.5 min, 60 °C for 0.5 min

and 72 °C for 1 min; and 72 °C for 10 min) on a Techne TC-512 (Techne Co. Staffs. UK). PCR products

were purified using QIAquick PCR Purification Kit (Qiagen Ltd. Crawley, UK.). The purified PCR products

were then quantified using Q-PCR. We used the Q-PCR methods described in Meyer et al. (2007), which

have been shown to provide a more accurate quantification of 454 libraries than other quantification

methods. This Q-PCR methodology has been demonstrated to reduce sequencing costs by increasing output

from pyrosequencing runs and ultimately provides a higher proportion of usable data (Meyer et al., 2007).

Equimolar concentrations of 12 MID tagged samples were then loaded into individual lanes on GS-FLX

LR70 plate (non-titanium) separated with an eight lane gasket (454 Life Sciences ⁄ Roche Applied

Biosystems, Nutley, NJ, USA). Three of the original 66 samples taken in this study did not yield any PCR

product and were excluded from sequencing. The 63 samples sequenced in this study were run on a single

LR70 plate that also contained 28 additional samples from another study and we loaded an approximately

equal numbers of samples into each lane; thus each sample was subjected to the same sequencing intensity.

Data from the two sets of samples were separated before analysis. The 63 samples from this study were

loaded onto the plate and separated by MIDs as follows:

Lane 1. 2 samples (MIDs 1, 10)

Lane 2. 2 samples (MIDs 1, 10)

Lane 3. 8 samples (MIDs 1-4, 7, 9-10, 12)

Lane 4. 12 samples (MIDs 1-12)

Lane 5. 12 samples (MIDs 1-12)

Lane 6. 11 samples (MIDs 1-9, 11-12)

Lane 7. 11 samples (MIDs 1-9, 11-12)

Lane 8. 5 samples (MIDs 3-5, 8, 11)

All pyrosequencing was conducted at the University of York in The Department of Biology‟s Technology

Facility.

Bioinformatics

The 142,004 amplicon sequences were checked for presence of the correct forward primer (A adaptor, MID

and WANDA) and were then sorted into molecular operational taxonomic units (MOTUs). Amplicon

sequences that did not contain the correct primer and MID sequence were considered sequencing errors and

removed from further analysis. First, all amplicon sequences were aligned against a comprehensive database

of previously recorded AM fungal taxa using the Needleman-Wunsch global alignment algorithm

(Needleman & Wunsch, 1970). We used the “needle” program from the EMBOSS package (Rice et al.,

2000) to implement the Needleman-Wunsch global alignment with a gap opening penalty of 100 and a gap

extend penalty of 0.01. These parameters were chosen as they reflect that most of the sequence differences

will be SNPs except for unpredictable homopolymer lengths. The database of AM fungal taxa contained

sequences of the NS31/AM1 region of the SSU rDNA gene from all known isolates and representative

sequences of AM fungi from environmental samples based on sequences analysed in Öpik et al. (2006) and

Dumbrell et al. (2010b). The reference database contained 230 unique sequences that were extracted from

named cultured isolates published in Schüßler et al. (2001), and from the 37 separate studies analysed in the

metaanalyses of Öpik et al. (2006) and Dumbrell et al. (2010b). In addition, the reference database also

contained sequences from common Ascomycota and Basidiomycota that are occasionally detected using the

NS31/AM1 primers; including these sequences allows the identification of any non-Glomeromycotan

sequences and their subsequent removal from further analysis. The output from the Needleman-Wunsch

global alignment was then sorted into counts of each MOTU, where each amplicon sequence was assigned

the identity of the sequence from the reference database with the closest match. The Needleman-Wunsch

global alignment sorted sequences into MOTUs based on the best alignment across the entire read length

and the only sequences that were not sorted into MOTUs using this method were those that did not match

any reference sequence with ≥ 97% similarity. A total of 4640 amplicon sequences did not match any

reference sequence with ≥ 97% similarity. These unassigned sequences were not sorted into MOTUs using

the Needleman-Wunsch global alignment, but were aligned and clustered using the BLASTclust algorithm

with default parameters (Altschul et al., 1997). This reduced the complexity of the non-matched sequence

set which was then passed to the CAP3 assembler in the EMBOSS package (Rice et al., 2000) which was

used to generate consensus sequences from each cluster. The consensus sequences from CAP3 were then

used to check that no sequences had been split between clusters and that all MOTU clusters only contained

sequences > 3% different to sequences in other clusters. This produced four MOTU clusters that did not

match the database of previously recorded sequences. Consensus sequences from each of the four clusters

were generated, and in order to check their identity were compared against sequences from cultured isolates

and environmental samples (http://blast.ncbi.nlm.nih.gov/Blast.cgi) using the Blast algorithm (Altschul et

al., 1990). The four MOTUs generated by the BLASTclust algorithm were then incorporated into the final

output allowing all sequences to be assigned to MOTUs. The clustering method described above was used to

sort only those sequences (4% of the final dataset) that were not assigned to MOTUs using the Needleman-

Wunsch algorithm and these four clusters were clustered at the standard 97% similarity level commonly

employed to examine AM fungal communities. Finally, sequences less than 100 bp in length or not of

Glomeromycotan origin were then excluded from any further analysis.

References

Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic Local Alignment Search Tool.

Journal of Molecular Biology 215: 403-410.

Altschul SF, Madden TL, Schaffer AA, Zhang JH, Zhang Z, Miller W, Lipman DJ. 1997. Gapped

BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research

25: 3389-3402.

Dumbrell AJ, Nelson M, Helgason T, Dytham C, Fitter AH. 2010b. Idiosyncrasy and overdominance in

the structure of natural communities of arbuscular mycorrhizal fungi: is there a role for stochastic processes?

Journal of Ecology 98: 419-428.

Helgason T, Daniell TJ, Husband R, Fitter AH, Young JPW. 1998. Ploughing up the wood-wide web?

Nature 394: 431.

Meyer M, Briggs AW, Maricic T, Höber B, Höffner B, Krause J, Weihmann A, Pääbo S, Hofreiter M.

2008. From micrograms to picograms: quantitative PCR reduces the material demands of high-throughput

sequencing. Nucleic Acids Research 36: e5

Needleman SB, Wunsch CD. 1970. A general method applicable to search for similarities in amino acid

sequence of 2 proteins. Journal of Molecular Biology 48: 443-453

Öpik M, Metsis M, Daniell TJ, Zobel M, Moora M. 2009. Large-scale parallel 454 sequencing reveals

host ecological group specificity of arbuscular mycorrhizal fungi in a boreonemoral forest. New Phytologist

184: 424-437.

Öpik M, Moora M, Liira J, Zobel M. 2006. Composition of root-colonizing arbuscular mycorrhizal fungal

communities in different ecosystems around the globe. Journal of Ecology 94: 778-790.

Rice P, Longden I, Bleasby A. 2000. EMBOSS: The European Molecular Biology Open Software Suite

(2000). Trends in Genetics 16: 276-277.

Schüßler A, Schwarzott D, Walker C. 2001. A new fungal phylum, the Glomeromycota: phylogeny and

evolution. Mycological Research: 105 1413–1421.

Simon L, Lalonde M, Bruns TD. 1992. Specific amplification of 18s fungal ribosomal genes from

vesicular-arbuscular endomycorrhizal fungi colonizing roots. Applied Environmental Microbiology 58: 291-

295.

Table S1. Summary of plant indicator species present in the study site (NVC-CG3)

Plant species were recorded by personnel from Yorkshire Wildlife Trust based on walking a transect with 20

sampling points in the grassland area sampled in this study. Nomenclature follows Stace (2010).

Reference

Stace CA. 2010. New Flora of the British Isles (3rd edn). Cambridge UK: Cambridge University Press.

Plant species Number of counts

Brachypodium pinnatum 11

Rubus fruticosus 8

Lotus corniculatus 7

Helianthemum nummularium 5

Linum catharticum 5

Poterium sanguisorba 4

Galium aparine 4

Rosa pimpinellifolia 2

Centaurea scabiosa 2

Genista tinctoria 2

Hyacinthoides non-scripta 2

Dactylorhiza fuchsii 2

Cirsium arvense 2

Listera ovata 1

Urtica dioica 1

Cirsium vulgare 1

Table S2. Summary of climate variables recorded between November 2007 and August 2008

Mean sunlight hours per day (hours) Mean daily minimum temperature (°C) Mean daily maximum temperature (°C)

Date Sample Lag 1 Lag 2 Lag 3 Lag 1 Lag 2 Lag 3 Lag 1 Lag 2 Lag 3

12/11/2007 NOV 2.59 4.34 3.83 9.14 4.79 7.36 12.61 9.01 10.75

29/01/2008 JAN 0.51 1.39 1.26 2.77 2.51 5.52 6.39 6.82 9.49

13/03/2008 MARCH 4.33 3.32 4.19 1.32 1 3.66 5.28 4.58 7.73

07/04/2008 Early_ARPIL 4.17 3.97 4.28 3.89 2.69 2.89 7.89 6.22 7.21

17/04/2008 Late_APRIL 3.21 5.05 4.14 3.69 2.51 1.41 7.45 6.46 6.71

20/05/2008 Early_MAY 3.93 4.34 7.18 2.09 6.22 6.02 7.33 11.78 13.19

27/05/2008 Late_MAY 2.97 7.51 5.04 4.41 7.24 6.05 9.49 13.87 12.6

10/06/2008 Early_JUNE 7.51 5.04 5.61 7.24 6.05 10.19 13.87 12.6 15.87

30/06/2008 Late_JUNE 4.4 6.72 5.05 8.32 9 10.65 14.01 15.34 15.45

15/07/2008 Early_JULY 6.81 5.82 4.2 8.75 10.61 11.16 15.38 16.06 16.43

29/07/2008 Late_JULY 5.82 4.2 6.74 10.61 11.16 12.65 16.06 16.43 17.46

Mean temperature at grass level (°C) Mean soil temperature at 10 cm depth (°C) Mean soil temperature at 30 cm depth (°C)

Date Sample Lag 1 Lag 2 Lag 3 Lag 1 Lag 2 Lag 3 Lag 1 Lag 2 Lag 3

12/11/2007 NOV 5.56 0.93 3.01 11.54 8.26 8.75 13.39 11.49 10.84

29/01/2008 JAN -0.14 -0.76 2.66 4.39 4.03 5.99 5.69 5.69 6.81

13/03/2008 MARCH -2.79 -3.01 1.01 3.67 3.46 4.76 5.79 4.95 6.29

07/04/2008 Early_ARPIL 0.96 -0.35 -0.47 4.81 4.44 5.35 6.21 6.36 6.83

17/04/2008 Late_APRIL 0.72 -0.47 -2.44 5.09 4.58 5.87 6.5 6.24 7.82

20/05/2008 Early_MAY -1.16 3.07 2.69 6.07 9.63 12.7 7.76 10.15 12.95

27/05/2008 Late_MAY 1.53 4.41 2.53 7.65 11.91 12.19 8.61 12.03 12.48

10/06/2008 Early_JUNE 4.41 2.53 7.47 11.91 12.19 14.3 12.03 12.48 14.11

30/06/2008 Late_JUNE 5.42 5.09 7.37 12.81 14.6 14.31 12.67 14.84 14.62

15/07/2008 Early_JULY 4.55 7.33 7.93 14.52 14.48 15.25 14.84 14.7 15.73

29/07/2008 Late_JULY 7.33 7.93 9.86 14.48 15.25 16.56 14.7 15.73 16.81

Mean soil temperature at 100 cm depth (°C)

Date Sample Lag 1 Lag 2 Lag 3

12/11/2007 NOV 13.76 12.88 11.94

29/01/2008 JAN 7.29 7.08 7.24

13/03/2008 MARCH 7.1 6.26 6.69

07/04/2008 Early_ARPIL 6.57 6.96 6.88

17/04/2008 Late_APRIL 6.87 6.74 7.55

20/05/2008 Early_MAY 7.65 8.64 10.82

27/05/2008 Late_MAY 7.95 9.71 11.26

10/06/2008 Early_JUNE 9.714 11.26 12.09

30/06/2008 Late_JUNE 11.39 12.79 13.37

15/07/2008 Early_JULY 12.89 13.4 14.18

29/07/2008 Late_JULY 13.4 14.18 14.91

Table S3. Summary of amplicon sequence analysis

Number of amplicon sequences from each sampling date

MOTU Taxon ID* Genus Species** Accession no.*** 12/11/2007 29/01/2008 13/03/2008 07/04/2008 17/04/2008 20/05/2008 27/05/2008 10/06/2008 30/06/2008 15/07/2008 29/07/2008 Total

Acau14 Acaulospora AY273613 0 0 0 0 0 0 0 0 0 0 1 1

D_spurca Diversispora spurcum AJ276077 0 0 0 13 0 0 0 0 0 1 0 14

Gi_candida Gigaspora candida AJ276091 93 0 0 0 81 109 91 78 69 147 117 785

Gi_gigantea Gigaspora gigantea AJ852602 0 0 0 0 1 4 2 2 0 3 5 17

Gi_m_W2992 Gigaspora AJ276090 0 0 0 0 0 0 0 3 1 2 0 6

Gi_rosea Gigaspora rosea AJ852608 591 6 0 12 558 769 659 749 602 1220 871 6037

newMOTU5 Gigaspora EF447242*** 389 2 0 17 413 504 495 576 550 985 652 4583

1E_23_T7_I Glomus FN869900 0 0 0 0 0 0 0 4 1 0 0 5

2A_46_T7_F Glomus FN869887 0 2 3 11 0 0 0 0 0 0 1 17

1F_43_T7_M Glomus FN869895 0 0 0 0 0 0 0 2 0 0 0 2

2B_17_T7_K Glomus FN869888 0 148 828 936 5 7 3 1 1 12 16 1957

2B_50_T7_S Glomus FN869891 164 14 1 4 154 228 173 196 154 452 215 1755

2F_13_T7_O Glomus FN869889 2 0 0 1 11 0 5 14 24 4 11 72

2F_40_T7_C Glomus FN869885 0 0 0 4 0 0 0 0 0 0 0 4

2F_48_T7_E Glomus FN869884 0 2 3 4 0 0 2 0 0 0 0 11

2G_08_T7_J Glomus FN869898 0 0 0 7 0 0 0 2 0 1 0 10

Chalky_2 Glomus AM946950 0 1 2 0 0 0 1 0 0 0 0 4

Chalky_3 Glomus AM946814 0 1403 2633 2048 14 54 152 19 4 27 222 6576

Chalky_4 Glomus AM946832 1 1229 2657 2938 30 37 50 17 4 40 282 7285

G_aurantium Glomus aurantium EF581880 0 0 0 0 0 0 0 0 0 1 0 1

G_caledonium Glomus caledonium Y17653 1740 14 2 38 1566 2418 2022 2569 1797 4856 2221 19243

G_clarum Glomus clarum AJ852597 6 0 0 0 0 0 0 0 1 0 2 9

G_constrictum Glomus constrictum AJ506090 0 8 12 12 0 0 0 0 0 0 0 32

G_eburneum Glomus eburneum EF581877 0 0 0 0 0 0 0 0 0 1 0 1

G_fragilis Glomus fragilistratum AJ276085 15 0 0 0 13 17 9 11 10 23 7 105

G_geosporum Glomus geosporum AJ245637 13 0 0 1 13 17 18 17 28 41 19 167

G_intraradices Glomus intraradices AJ301859 44 0 0 0 28 66 77 56 26 82 67 446

G_versiforme_m Glomus versiforme X86687 0 1 0 0 15 0 0 0 0 0 0 16

G_verrucul Glomus verruculosum AJ301858 13 0 0 0 31 47 45 56 21 12 20 245

Glo1A Glomus AJ309457 2158 6 1 27 1957 2853 2367 2848 2270 5681 2768 22936

Glo12 Glomus AF437656 0 0 1 20 0 0 0 0 0 0 0 21

Glo13 Glomus AF437660 0 0 8 2 0 0 0 0 0 0 0 10

Glo1B Glomus AJ309432 0 0 6 0 0 0 0 0 0 3 0 9

Glo24 Glomus AF437701 0 0 0 0 0 0 0 0 1 4 0 5

Glo29 Glomus AY273554 1 384 498 244 14 12 46 6 6 60 49 1320

Glo3 Glomus AF437721 3 0 0 0 17 4 15 0 6 18 5 68

Glo50 Glomus AY512350 0 0 0 1 4 0 0 0 1 2 0 8

Glo53 Glomus AY512345 0 0 2 12 0 0 1 0 1 7 0 23

Glo7 Glomus AF074370 0 24 189 54 0 0 1 0 0 1 12 281

Glo8 Glomus AY512369 15 397 429 281 30 34 41 30 67 182 88 1594

Glo9 Glomus AJ716012 0 0 11 3 0 0 2 0 0 0 0 16

Table S3. Summary of amplicon sequence analysis cont.

Number of amplicon sequences from each sampling date

MOTU Taxon ID* Genus Species** Accession no.*** 12/11/2007 29/01/2008 13/03/2008 07/04/2008 17/04/2008 20/05/2008 27/05/2008 10/06/2008 30/06/2008 15/07/2008 29/07/2008 Total

Hetchell_10 Glomus FN556648 0 2 4 8 0 0 0 0 1 0 0 15

Hetchell_11 Glomus FN556647 0 190 431 405 2 22 26 5 0 4 54 1139

Hetchell_12 Glomus FN556646 0 4 60 1 4 0 7 0 0 2 0 78

Hetchell_13 Glomus FN556645 0 0 0 1 0 1 0 0 0 0 0 2

Hetchell_15 Glomus FN556639 0 369 830 1014 1 15 11 8 0 19 99 2366

Hetchell_17 Glomus FN556641 0 2 8 10 0 0 0 0 0 0 0 20

Hetchell_18 Glomus FN556643 0 77 335 426 6 4 6 4 0 1 54 913

Hetchell_19 Glomus FN556636 0 32 140 394 2 6 4 1 0 1 24 604

Hetchell_20 Glomus FN556635 0 42 157 400 0 9 8 0 0 3 21 640

Hetchell_21 Glomus FN556638 0 18 232 96 1 5 2 0 0 0 10 364

Hetchell_22 Glomus FN556637 1 494 1636 3413 10 60 40 10 1 38 200 5903

Hetchell_23 Glomus FN556644 0 540 1154 1409 4 29 78 2 0 19 154 3389

Hetchell_6 Glomus FN556619 0 1 12 5 0 0 0 0 0 0 0 18

Hetchell_7 Glomus FN556628 0 15 23 70 0 0 0 0 2 4 10 124

Hetchell_8 Glomus FN556634 1 0 0 0 2 0 5 6 19 0 3 36

Hetchell_Gl_2 Glomus FN556625 0 0 0 0 0 0 0 0 0 2 0 2

Hetchell_Gl_10 Glomus FN556627 0 6 201 77 0 2 2 0 0 0 6 294

Hetchell_Gl_12 Glomus FN556614 0 0 3 3 0 0 0 0 0 0 0 6

Hetchell_Gl_23 Glomus FN556622 0 0 0 0 0 3 0 0 0 18 1 22

Hetchell_Gl_41 Glomus FN556621 134 5 0 25 346 57 147 417 1303 202 432 3068

Hetchell_Gl_UY Glomus FN556629 0 1 0 0 0 0 1 0 0 1 1 4

Hetchell_Gl_cl Glomus FN556620 1 5 2 3 3 4 4 2 17 24 1 66

MO_G3 Glomus AJ496054 1384 11 4 34 988 1453 1452 1770 1091 3372 1764 13323

MO_G4 Glomus AJ418866 0 0 0 2 0 0 0 0 0 0 0 2

ORVIN_G3A Glomus FJ194507 0 0 2 7 0 0 0 0 0 0 0 9

Polluted_soil_glo Glomus DQ164813 0 5 73 3 0 0 1 1 0 0 1 84

newMOTU2 Glomus FJ831575*** 3 0 9 7 0 0 3 0 0 0 2 24

newMOTU6 Glomus AM946964*** 0 0 0 0 4 0 0 0 0 0 0 4

newMOTU8 Glomus AM911127*** 0 1 0 0 10 1 0 8 4 3 2 29

Total number of amplicon sequences 6772 5461 12602 14503 6338 8851 8074 9490 8083 17581 10490 108245

Total number of taxa 22 36 38 47 34 32 40 33 31 44 41 70

*Arbitrary taxon ID used to name sequences during bioinformatic analysis

**Species names are given for known cultured isolates, sequences from environmental samples are only identified to genus

***Accession numbers for sequences included in analysis, the accession number for new MOTUs is the closest matched sequences on Genebank (http://blast.ncbi.nlm.nih.gov/Blast.cgi)

Table S3. Summary of amplicon sequence analysis. Values are the total number of sequences that matched each reference sequence after sequences less than 100 bp in length, not containing the correct primer or tag

sequence, and those not of Glomeromycotan origin had been excluded. Sequences from each of the six soil cores sampled on each date are pooled to aid clarity, the full dataset from individual soil-core samples is

available from the authors by request.

Figure S1. Neighbour-joining phylogeny of MOTUs

Figure S1. Neighbour-joining phylogeny of arbuscular mycorrhizal (AM) fungal MOTUs recorded at Hetchell

Wood between November 2007 and August 2008. MOTUs highlighted in blue were only recorded during the

winter period and MOTUs highlighted in green were only recorded during the summer period. MOTUs

highlighted in purple were recorded during both the summer and winter periods, a grey background is used to

denote those MOTUs that were more abundant in winter than summer. MOTU names correspond to those in

Table S3 to allow cross referencing. Each MOTU starts with an accession number followed by an arbitrary

taxon ID used to name sequences during bioinformatics analyses as included in Table S3. Finally a binomial

species name is included where possible. Sequences from cultured isolates are named fully and sequences from

environmental samples are named to genus level. The four new MOTUs recorded in this study are represented

by their closest matched sequences from the NCBI database (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Bootstrap

values ≥ 75% (10 000 replicates) are shown above the branches and before the node to which they correspond.

ClustalX (Thompson et al., 1997) was used for multiple alignments and calculation of neighbour-

joining phylogeny (Saitou & Nei 1987) using Geosiphon pyriformis (Gehrig et al., 1996) as a specific outgroup

to the AM fungi as well as Corallochytrium limacisporum, a choanozoan, as a general outgroup to all fungi

(Vandenkoornhuyse et al., 2002). Phylogenetic support was calculated using nonparametric bootstrapping

(Felsenstein 1985), with 10 000 pseudoreplicates.

References

Felsenstein J. 1985. Confidence-limits on phylogenies – an approach using the bootstrap. Evolution 39: 783–

791.

Gehrig H, Schüßler A, Kluge M. 1996. Geosiphon pyriformis, a fungus forming endocytobiosis with Nostoc

(Cyanobacteria), is an ancestral member of the Glomales: evidence by SSU rRNA analysis. Journal of

Molecular Evolution 43: 71–81.

Saitou N, Nei M. 1987. The neighbor-joining method – a new method for reconstructing phylogenetic trees.

Molecular Biology and Evolution 4: 406–425.

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The CLUSTAL-X interface:

flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25:

4876–4882.

Vandenkoornhuyse P, Baldauf SL, Leyval C, Straczek J, Young JPW. 2002. Evolution – extensive fungal

diversity in plant roots. Science 295: 2051.

Figure S2. Rarefied species accumulation curves

Figure S2. Rarefied species accumulation curves from each temporal sample, dates sampled are shown next

to the corresponding curve.

0

5

10

15

20

25

30

35

40

45

50

0 2000 4000 6000 8000 10000 12000 14000 16000

Nu

mb

er o

f A

M f

un

gal

tax

a

Number of amplicon sequences

30/06/2008

12/11/2007

20/05/200810/06/200817/04/2008

13/03/2008

15/07/20087/04/2008

29/07/200827/05/2008

# 29/01/2008

#

Figure S3. Species accumulation curves of temporal samples

Figure S3. Species accumulation curves based on pooled data from each of the 11 temporal samples. Data

points show rarefied species richness (+SE).

50

55

60

65

70

75

0 2 4 6 8 10 12

Nu

mb

er o

f A

M f

un

gal

tax

a

Number of temporal samples